Method for evaluating scrotal hernia risk of boar and SNP site used by method

Abstract

The invention discloses a method for evaluating the risk of scrotal hernia of a boar and an SNP (Single Nucleotide Polymorphism) site used by the method. According to the method, genotypes based on a C201T SNP site, a C269T SNP site and a T346A SNP site in a genome of a boar to be detected are detected, so that the risk of scrotal hernia is judged; the C201T SNP site, the C269T SNP site and the T346A SNP site are nucleotides at the 201st site, the 269th site and the 346th site from the 5'tail end of SEQ ID NO: 1 in a pig genome respectively. The kit can be used for evaluating or assisting in evaluating the risk of the scrotal hernia of the boar, is reliable, stable and accurate in result, and has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for evaluating the risk of scrotal hernia in boars and SNP loci used therefor. Background Art

[0002] Scrotal hernia is one of the most common genetic defect diseases in boars and has also been widely reported in mammals such as mice and humans, which brings serious harm to animal and human health. The occurrence of scrotal hernia not only directly reduces the breeding value of pigs, but also causes serious economic losses in the pig industry and poor animal welfare. The number of pigs raised in China accounts for more than half of the total number of pigs raised in the world. Identifying the pathogenic genes and causal variations of scrotal hernia and applying them to pig molecular breeding is of great significance to the pig industry in China. In addition, as an ideal animal model for human disease research, the identification and research of the pathogenic genes of pig scrotal hernia also provide a basis and clues for analyzing the molecular genetic mechanism of the occurrence of this disease in humans, which has important practical significance.

[0003] With the advent of commercial pig single nucleotide polymorphism (SNP) chips and the rapid development of genome sequencing technology, using genome-wide association analysis methods to mine SNPs or major genes affecting pig scrotal hernia has become a research hotspot. Many studies have mined candidate genes related to the incidence of pig scrotal hernia on different chromosomes, but no subsequent functional verification has been carried out, so the definite pathogenic genes or genetic variations have not been determined, making it difficult to completely eradicate this disease in the pig population.

[0004] Latent TGF-β Binding Protein 1 (LTBP1) is a key regulatory factor in the TGF-β signaling pathway, responsible for fixing the TGF-β latent complex in the extracellular matrix, thereby regulating its activation and release, and playing an important role in tissue development, extracellular matrix remodeling and fibrosis processes. Functional defects or abnormal expressions of LTBP1 are considered to be related to the occurrence of various diseases, including cardiovascular diseases, fibrosis, etc. Summary of the Invention

[0005] The purpose of the present invention is to evaluate the risk of scrotal hernia in boars, so as to be applied to actual boar breeding.

[0006] The present invention first protects a method for evaluating the risk of scrotal hernia in boars.

[0007] The method for evaluating the risk of scrotal hernia in boars to be protected by the present invention can specifically be Method 1, and may include the following steps: detecting whether the genotype of the boar to be tested is Genotype I, Genotype II, or Genotype III. The risk of scrotal hernia in boars with Genotype I is higher than that in boars with Genotype II or Genotype III.

[0008] The boars with Genotype I are boars with a CC homozygous genotype based on the C201T SNP locus, a CC homozygous genotype based on the C269T SNP locus, and / or a TT homozygous genotype based on the T346A SNP locus;

[0009] The boars with Genotype II are boars with a CT heterozygous genotype based on the C201T SNP locus, a CT heterozygous genotype based on the C269T SNP locus, and / or a TA heterozygous genotype based on the T346A SNP locus;

[0010] The boars with Genotype III are boars with a TT homozygous genotype based on the C201T SNP locus, a TT homozygous genotype based on the C269T SNP locus, and / or a AA homozygous genotype based on the T346A SNP locus;

[0011] The C201T SNP locus is the nucleotide at the 201st position from the 5'-end of SEQ ID NO: 1 in the pig genome;

[0012] The C269T SNP locus is the nucleotide at the 269th position from the 5'-end of SEQ ID NO: 1 in the pig genome;

[0013] The T346A SNP locus is the nucleotide at the 346th position from the 5'-end of SEQ ID NO: 1 in the pig genome.

[0014] The method for evaluating the risk of scrotal hernia in boars to be protected by the present invention can specifically be Method 2, and may include the following steps:

[0015] (1) Using the genomic DNA of the boar to be tested as a template, performing PCR amplification with a primer pair composed of an upstream primer F and a downstream primer R to obtain a PCR amplification product; detecting the PCR amplification product, and then making the following judgments:

[0016] If only C is present at the 201st position of the PCR amplification product, the genotype of the boar to be tested based on the C201T SNP locus is CC homozygous; if only T is present at the 201st position of the PCR amplification product, the genotype of the boar to be tested based on the C201T SNP locus is TT homozygous; if both T and C are present at the 201st position of the PCR amplification product, the genotype of the boar to be tested based on the C201T SNP locus is CT heterozygous;

[0017] If the 269th position of the PCR amplification product is only C, the genotype of the boar to be tested at the C269T SNP locus is the CC homozygous type; if the 269th position of the PCR amplification product is only T, the genotype of the boar to be tested at the C269T SNP locus is the TT homozygous type; if the 269th position of the PCR amplification product is T and C, the genotype of the boar to be tested at the C269T SNP locus is the CT heterozygous type;

[0018] If the 346th position of the PCR amplification product is only T, the genotype of the boar to be tested at the T346A SNP locus is the TT homozygous type; if the 346th position of the PCR amplification product is only A, the genotype of the boar to be tested at the T346A SNP locus is the AA homozygous type; if the 346th position of the PCR amplification product is A and T, the genotype of the boar to be tested at the T346A SNP locus is the TA heterozygous type;

[0019] The C201T SNP locus is the nucleotide at the 201st position of SEQ ID NO: 1 from the 5' end in the pig genome;

[0020] The C269T SNP locus is the nucleotide at the 269th position of SEQ ID NO: 1 from the 5' end in the pig genome;

[0021] The T346A SNP locus is the nucleotide at the 346th position of SEQ ID NO: 1 from the 5' end in the pig genome;

[0022] The upstream primer F is the single-stranded DNA molecule shown in SEQ ID NO: 2;

[0023] The downstream primer R is the single-stranded DNA molecule shown in SEQ ID NO: 3;

[0024] (2) According to the result of (1), determine whether the genotype of the boar to be tested is genotype I, genotype II or genotype III. The risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II or genotype III;

[0025] The boars with genotype I are those with the CC homozygous type at the C201T SNP locus, the CC homozygous type at the C269T SNP locus and / or the TT homozygous type at the T346A SNP locus;

[0026] The boars with genotype II are those with the CT heterozygous type at the C201T SNP locus, the CT heterozygous type at the C269T SNP locus and / or the TA heterozygous type at the T346A SNP locus;

[0027] The boars of genotype III are boars with a TT homozygous genotype based on the C201T SNP locus, a TT homozygous genotype based on the C269T SNP locus, and / or an AA homozygous genotype based on the T346A SNP locus.

[0028] In the above method, the genomic DNA of the boar to be tested can be the genomic DNA of the tissue of the boar to be tested. Specifically, the tissue can be ear tissue.

[0029] The present invention also protects a kit for evaluating the risk of scrotal hernia in boars, which may include substances for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III;

[0030] Genotype I is a CC homozygous genotype based on the C201T SNP locus, a CC homozygous genotype based on the C269T SNP locus, and / or a TT homozygous genotype based on the T346A SNP locus;

[0031] Genotype II is a CT heterozygous genotype based on the C201T SNP locus, a CT heterozygous genotype based on the C269T SNP locus, and / or a TA heterozygous genotype based on the T346A SNP locus;

[0032] Genotype III is a TT homozygous genotype based on the C201T SNP locus, a TT homozygous genotype based on the C269T SNP locus, and / or an AA homozygous genotype based on the T346A SNP locus;

[0033] The C201T SNP locus is the nucleotide at the 201st position from the 5'-end of SEQ ID NO: 1 in the pig genome;

[0034] The C269T SNP locus is the nucleotide at the 269th position from the 5'-end of SEQ ID NO: 1 in the pig genome;

[0035] The T346A SNP locus is the nucleotide at the 346th position from the 5'-end of SEQ ID NO: 1 in the pig genome.

[0036] The kit for evaluating the risk of scrotal hernia in boars may specifically consist of substances for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III.

[0037] Specifically, the substance for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III in any of the above can be a primer pair composed of any of the above upstream primers F and any of the above downstream primers R.

[0038] The substance for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III as described above can also be to determine the nucleotide types of the C201T SNP locus, C269T SNP locus and / or T346A SNP locus in the boar genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and / or a chip based on fluorescent molecule-DNA binding reaction.

[0039] The present invention also protects the molecular marker shown in SEQ ID NO: 1.

[0040] The application of any of the above-mentioned kits or any of the above-mentioned molecular markers in evaluating the risk of scrotal hernia in boars also belongs to the protection scope of the present invention.

[0041] The application of any of the above-mentioned kits or any of the above-mentioned molecular markers in screening boars with low risk of scrotal hernia also belongs to the protection scope of the present invention.

[0042] In the above application, the boars with low risk of scrotal hernia can specifically be boars of genotype II or genotype III.

[0043] The boars of genotype II can be boars with a CT heterozygous genotype based on the C201T SNP locus, a CT heterozygous genotype based on the C269T SNP locus, and / or a TA heterozygous genotype based on the T346A SNP locus.

[0044] The boars of genotype III can be boars with a TT homozygous genotype based on the C201T SNP locus, a TT homozygous genotype based on the C269T SNP locus, and / or a AA homozygous genotype based on the T346A SNP locus.

[0045] The application of any of the above-mentioned kits or any of the above-mentioned molecular markers in boar breeding. The purpose of the boar breeding is to cultivate boar breeds with low risk of scrotal hernia or not prone to scrotal hernia.

[0046] In the above text, the "higher than" can specifically be higher than in statistics.

[0047] The breed of any of the above-mentioned boars can be Large White pigs or Landrace pigs.

[0048] Experimental results show that the method provided by the present invention can be used to detect the genotypes of boars to be tested at the C201T SNP locus as the CC homozygous type, at the C269T SNP locus as the CC homozygous type, and / or at the T346A SNP locus, so as to evaluate or assist in evaluating the risk of scrotal hernia in boars. The results are reliable, stable, and accurate. The present invention has important application value. The present invention is suitable for large-scale detection and has important application value. Brief Description of the Drawings

[0049] Figure 1 FIGs. are Manhattan plots and QQ-Plot plots of the results of genome-wide association analysis of scrotal hernia traits.

[0050] Figure 2 FIG. is the relative expression levels of LTBP1, COL3A1, FBN1, FBN2, and FN1 genes in the peritoneal tissues of boar individuals in the healthy group and the scrotal hernia affected group detected by real-time fluorescence quantitative PCR. Among them, **** indicates P<0.0001, ** indicates P<0.01, and * indicates P<0.05.

[0051] Figure 3 FIG. is the effects of interfering with LTBP1 in HDF cells on the TGF signaling pathway and the expression of extracellular matrix proteins detected by real-time fluorescence quantitative PCR and Western blot. Among them, **** indicates P<0.0001, *** indicates P<0.001, ** indicates P<0.01, * indicates P<0.05, and ns indicates no significant difference.

[0052] Figure 4 FIG. is the effects of interfering with LTBP1 in HDF cells on the PI3K-AKT signaling pathway and cell proliferation and migration.

[0053] Figure 5 FIG. is the partial sequencing results of a certain boar at 3 SNP loci in Step 1 of Example 5. Detailed Embodiments

[0054] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0055] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0056] Unless otherwise specified, in the following quantitative tests of the examples, three repeated experiments are set, and the results are averaged.

[0057] The Uniprot ID of LTBP1 protein (Pig) is A0A8D1BIJ1, and the GeneBank number of the gene encoding LTBP1 protein (i.e., LTBP1 gene (Pig)) is 100627243. The LTBP1 protein in this application is LTBP1 protein (Pig), and the LTBP1 gene is LTBP1 gene (Pig).

[0058] In the following examples, HDF cells are human dermal fibroblasts, which are products of Shanghai Fuheng Cell Bank, and the product catalog number is FH1092. HDF cells are cultured using RPMI 1640 medium (22400089, Gibico) containing 10% (v / v) fetal bovine serum (A5669701, Gibico).

[0059] In the following examples, the inventors of this application collected ear tissues of 368 boars (including two breeds of Yorkshire and Landrace) and peritoneal tissues of 6 boars (all of Yorkshire breed) through phenotypic observation. The ear tissues of 368 boar individuals were respectively soaked in 75% (v / v) ethanol aqueous solution and stored at -20°C. The peritoneal tissues of 6 boar individuals were respectively stored in liquid nitrogen. Among the 368 boar individuals, 106 individuals suffered from scrotal hernia and formed the scrotal hernia affected group; 262 healthy individuals formed the healthy group. Among the 6 boar individuals, 3 individuals suffered from scrotal hernia and formed the scrotal hernia affected group; 3 healthy individuals formed the healthy group.

[0060] Example 1: Genome-wide association analysis of porcine scrotal hernia disease

[0061] 1. DNA extraction, library construction and sequencing

[0062] Beijing Gezhi Boya Biotechnology Co., Ltd. was responsible for DNA extraction, quality inspection, library construction and sequencing of ear tissue samples from 368 boar individuals. The sequencing data volume for each individual was 50G, and the average sequencing depth was 20×.

[0063] 2. Analysis of genome re-sequencing data

[0064] The genome re-sequencing data of all obtained samples were analyzed. Specifically as follows:

[0065] (1) Use the Fastp software to remove sequencing reads with an N content exceeding 10% of the read length of that read, and sequencing reads with the number of low-quality (Q <= 5) bases exceeding 50% of the read length of that read. Use the BWA software to align the quality-controlled clean reads to the pig reference genome (Sus scrofa 11.1) to obtain a sam file. Use the view command of the Samtools software to convert the sam format file to the bam format, and sort the bam file using the sort command.

[0066] (2) After completing step (1), use the MarkDuplicates command of GATK to identify and mark PCR duplicate sequences in the sorted bam file, and use the index command of Samtools to create an index for the bam file processed with PCR duplicate marking. Use the GATK HaplotypeCaller command to generate a gVCF file for each sample, then use the CombineGVCFs command to merge the gVCF files of all individuals into a total gVCF file, and then use GenotypeGVCFs to convert the total gVCF file into a VCF file, and screen for SNP sites using the SelectVariants command.

[0067] (3) After completing step (2), use the VariantFiltration command for hard filtering of SNP sites, and the filtering conditions are: "QD < 2.0, QUAL < 30.0, MQ < 40.0, SOR > 3.0, FS > 60.0, MQRankSum < -12.5, ReadPosRankSum < -8.0".

[0068] 3. Quality control of SNP sites

[0069] Information on 48,786,453 SNP sites was detected across the genome, and quality control was performed using the Plink software with the following conditions: excluding sites with a detection rate less than 90%; excluding individuals with an SNP detection rate less than 90%; excluding sites with a minor allele frequency less than 0.01; excluding sites with a P-value less than 1E-6 in the Hardy-Weinberg equilibrium test.

[0070] After quality control, a final total of 368 individuals and 21,843,963 SNPs remained for subsequent genome-wide association analysis.

[0071] 4. Genome-wide association analysis (GWAS) method

[0072] Use the GEMMA software for genome-wide association analysis, and the model is as follows:

[0073] y = Sα + Zg + Pk + e

[0074] where y represents the phenotypic value of individual scrotal hernia (0 for healthy and 1 for diseased); α is the fixed effect of a single SNP; g is a random polygenic effect vector conforming to a normal distribution ; where is the polygenic effect variance, G is the genomic relationship matrix based on SNPs; S is the SNP genotype (0, 1, 2) vector, Z is the association matrix of g, P is the principal component covariate matrix, k is the regression coefficient vector, e is a random residual conforming to a normal distribution , I is the identity matrix, is the residual variance.

[0075] 5. Significance detection of SNP loci

[0076] The Bonferrini method is used for multiple test correction to determine the significance threshold of SNP statistical tests. The significance threshold at the genome level is 0.05 / 21,843,963 (the number of effective SNP loci), i.e., 2.29E - 09; the significant threshold at the chromosome level is 1 / 21,843,963 (the number of effective SNP loci), i.e., 4.58E - 08. The Manhattan plot and QQ - Plot are drawn using the CMplot package in R software.

[0077] The Manhattan plot is shown in Figure 1 A in, and the QQ - Plot is shown in Figure 1 B in. The results show that 3 SNP loci within the LTBP1 gene on chromosome 3 all reach the chromosome - significant level, and the specific information is shown in Table 1.

[0078] Table 1. Information and test results of significant SNP loci within the LTBP1 gene in genome - wide association analysis

[0079] Chromosome Position (bp) Minor allele Major allele P value 3 106679262 T C 1.04E-08 3 106679330 T C 1.04E-08 3 106679407 A T 4.27E-09

[0080] Example 2. The expression levels of the LTBP1 gene and extracellular matrix protein genes in the peritoneal diseased tissues of scrotal hernia pigs are significantly down - regulated

[0081] Scrotal hernia is a disease in which abdominal contents enter the scrotum due to the underdevelopment of the abdominal wall or peritoneum, and is usually associated with abnormalities in the extracellular matrix and weakening of connective tissue. The extracellular matrix is a complex structure composed of macromolecules secreted by cells into the extracellular matrix, consisting of interstitial matrix and basement membrane. The interstitial matrix is a reticular structure mainly composed of collagen, elastin, fibronectin and various proteoglycans. COL3A1 is a major component of collagen, and collagen is one of the most abundant protein components in the interstitial matrix, mainly participating in the maintenance of the strength of animal connective tissue. FBN1 and FBN2 are involved in the formation of elastin, and elastin mainly endows tissues with flexibility and extensibility; FN1, as fibronectin, mainly regulates the interaction between cells and the matrix by binding to cell surface integrin receptors. Based on the important role of LTBP1 in maintaining the structure of the extracellular matrix, it is possible that LTBP1 is related to the occurrence of scrotal hernia. In order to determine the expression of important functional genes in the diseased tissue site of the peritoneum of scrotal hernia pigs, real-time fluorescence quantitative PCR (qPCR) was used to detect whether there were significant differences in the expression levels of LTBP1, type III collagen COL3A1, fibrillin FBN1 and FBN2, and fibronectin FN1 in the peritoneal tissues of boars in the scrotal hernia diseased group and the healthy group.

[0082] 1. Respectively take 0.1 g of peritoneal tissue from 6 boar individuals from liquid nitrogen, grind it into powder in liquid nitrogen to obtain peritoneal tissue samples.

[0083] 2. Add 1 mL of Trizol to the peritoneal tissue samples obtained in step 1 respectively, and use the Trizol method to extract the total RNA of the peritoneal tissue; then use a Nanodrop nucleic acid analyzer (Thermo Scientific) to detect the purity and concentration of the total RNA of the peritoneal tissue.

[0084] 3. Reverse transcribe the total RNA of the peritoneal tissue according to the instructions of the reverse transcription kit PrimeScript TM RT reagent Kit with gDNA Eraser(PerfectReal Time)(RR047, TAKARA) (the whole reaction is carried out on ice) to obtain cDNA of the peritoneal tissue. The specific steps are as follows:

[0085] (1) Prepare reaction system ①. Reaction system ① consists of 5 μL of the total RNA of the peritoneal tissue, 2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser and 2 μL of RNase Free dH2O;

[0086] (2) Place reaction system ① in a PCR instrument, treat it at 42 °C for 2 min, and store it at 4 °C.

[0087] (3) Add 1 μL of PrimeScript RT Enzyme Mix, 1 μL of RT Primer Mix, 4 μL of 5×PrimeScript Buffer 2, and 4 μL of RNase Free dH2O to the system that has completed step (2), and mix well; then incubate at 37 °C for 15 min, at 85 °C for 5 s, and store at 4 °C to obtain the cDNA of the peritoneal tissue.

[0088] 5×gDNA Eraser Buffer, gDNA Eraser, PrimeScript RT Enzyme Mix, RT Primer Mix, and 5×PrimeScript Buffer 2 are all components of the PrimeScript TM RT reagent Kit with gDNA Eraser.

[0089] 4. According to the instructions of the TB Premix Ex Taq TM II (Tli RNaseH Plus) (RR820, Takara) kit, use qPCR to detect the relative expression levels of LTBP1 gene, COL3A1 gene, FBN1 gene, FBN2 gene, and FN1 gene in the cDNA of the peritoneal tissue (using the GAPDH gene as an internal reference). The nucleotide sequences of the detection primers for each gene are shown in Table 2.

[0090] Table 2

[0091]

[0092]

[0093] The detection results are shown in Figure 2 . The results showed that compared with the healthy group, the relative expression levels of LTBP1 gene, COL3A1 gene, FBN1 gene, FBN2 gene, and FN1 gene in the peritoneal tissue of boar individuals in the scrotal hernia affected group were all significantly down-regulated. Thus, it can be seen that the expression of extracellular matrix protein genes in the peritoneal tissue of boar individuals in the scrotal hernia affected group is dysregulated.

[0094] Example 3. Interfering with the LTBP1 gene leads to abnormal extracellular matrix protein expression by affecting the TGF signaling pathway. I. Obtaining transfected HDF cells

[0095] 1. Synthesize the LTBP1-Homo interference sequence targeting the knockdown of the LTBP1 gene and the control sequence that does not knockdown any gene by Suzhou GenePharma Co., Ltd.

[0096] The sense strand sequence of the LTBP1-Homo interfering sequence is 5'-AGCAAAGCAUACUUCAUCUTT-3' (SEQ ID NO:4), and the antisense strand sequence is 5'-AGAUGAAGUAUGCUUUGCUGC-3' (SEQ ID NO:5).

[0097] The sense strand sequence of the control sequence is 5'-UUCUCCGAACGUGUCACGUTT-3', and the antisense strand sequence is 5'-ACGUGACACGUUCGGAGAATT-3'.

[0098] 2. Resuspend 1 mL of HDF cell suspension with a cell concentration of 2×10 6 cells / mL evenly in a 6-well plate, and culture at 37°C and 5% CO2 until the cell confluence reaches 90%, then transfect the interfering sequence (LTBP1-Homo interfering sequence or control sequence) to obtain transfected HDF cells.

[0099] II. qPCR detection of the relative expression level of LTBP1 gene in transfected HDF cells

[0100] 1. Use the Trizol method to extract the total RNA of the transfected HDF cells obtained in Step 1, and then refer to Step 3 in Example 2 to obtain the cDNA of the transfected HDF cells.

[0101] 2. According to the instruction manual of the TB Premix Ex Taq TM II (Tli RNaseH Plus) (RR820, Takara) kit, use qPCR to detect the relative expression level of LTBP1 gene in the cDNA of transfected HDF cells (using the TUBA1B gene as an internal reference).

[0102] The primers for detecting the LTBP1 gene are LTBP1-F: 5'-CGTTCACCAAACAAGGCAGG-3' and LTBP1-R: 5'-TCCACAGACATTGACCCCCT-3'. The primers for detecting the TUBA1B gene are TUBA1B-F: 5'-TTAGCTTGTCGGGGACGGTA-3' and TUBA1B-R: 5'-TGGAGATGCACTCACGCATAG-3'.

[0103] The detection results are shown in Figure 3 A. Compared with the HDF cells transfected with the control sequence (i.e., the control group), the relative expression level of the LTBP1 gene in the HDF cells transfected with the LTBP1-Homo interfering sequence (i.e., the LTBP1 interference group) was significantly down-regulated.

[0104] III. Detection of LTBP1 protein expression in transfected HDF cells by Western blot

[0105] The expression of LTBP1 protein in transfected HDF cells was detected by Western blot, and the specific steps were as follows:

[0106] 1. Take the transfected HDF cells obtained in Step 1, gently rinse the 6-well plate twice with 1×PBS, add 200 μL of 1×RIPA lysis buffer to each well, and let it stand on ice for 10 min (for sufficient lysis); then centrifuge at 4°C and 12,000 rpm for 10 min, collect the supernatant, and the supernatant is the cell lysate.

[0107] 2. Add 5× reducing SDS polyacrylamide gel electrophoresis loading buffer to the cell lysate, incubate at 70°C for 10 min, and then perform SDS-PAGE electrophoresis (electrophoresis at 110 V for 10 min, stop electrophoresis when the bromophenol blue migrates to the bottom of the gel at 170 V).

[0108] 3. After completing Step 2, transfer the gel protein to a PVDF membrane (transfer conditions: 300 mA, 1 h), block with 5% skim milk powder, and wash three times with 1×TBST; then add mouse anti-human LTBP-1 antibody (sc-271140, Santa Cruz) for detecting LTBP-1 protein as the primary antibody, wash three times with 1×TBST after incubation; finally, add HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime) as the secondary antibody, incubate; and develop by chemiluminescence.

[0109] According to the above steps, replace the mouse anti-human LTBP-1 antibody with rabbit anti-human HSP70 antibody (T55496, Abmart) for detecting HSP70 protein, and replace HRP-labeled goat anti-mouse IgG (H+L) with goat anti-rabbit IgG-HRP (SE134, Solarbio), and keep other steps unchanged for detecting the expression of HSP70 protein in transfected HDF cells.

[0110] The results of Western blot detection are shown in Figure 3 Figure B. Compared with the HDF cells transfected with the control sequence (i.e., the control group), the LTBP1 protein level in the HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) was significantly downregulated.

[0111] The above results indicate that the LTBP1-Homo interference sequence effectively interferes with LTBP1.

[0112] IV. Detection of the expression levels of extracellular matrix proteins and the activity of the TGF signaling pathway in transfected HDF cells by qPCR and Western blot

[0113] LTBP1 can bind and store the TGF-β precursor, regulating the release and activation of TGF-β. SMAD3 is a signal transduction molecule downstream of TGF-β. After TGF-β binds to its receptor, it phosphorylates SMAD3. Inhibition of the TGF-β signaling pathway will hinder fibroblast activation and the fibrotic phenotype, resulting in a decrease in extracellular matrix secretion. Therefore, this study further detected the levels of extracellular matrix proteins and the activity of the TGF-β pathway in transfected HDF cells.

[0114] 1. Use the Trizol method to extract the total RNA of the transfected HDF cells obtained in Step 1, and then refer to Step 3 in Example 2 to obtain the cDNA of the transfected HDF cells. According to the instructions of the TB Premix Ex Taq TM II (Tli RNaseHPlus) (RR820, Takara) kit, use qPCR to detect the relative expression levels of the COL3A1 gene, FBN1 gene, FBN2 gene, and FN1 gene in the cDNA of the transfected HDF cells (using the TUBA1B gene as an internal reference). The nucleotide sequences of the detection primers for each gene are shown in Table 3.

[0115] Table 3

[0116]

[0117] The results of real-time fluorescence quantitative PCR are shown in Figure 3 C. Compared with the HDF cells transfected with the control sequence (i.e., the control group), the relative expression levels of the FBN1 gene, FBN2 gene, and FN1 gene in the HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) were significantly downregulated.

[0118] 2. Detect the level of extracellular matrix proteins in the culture medium supernatant. The specific steps are as follows: After completing Step 1, collect the culture medium in each well of the 6-well plate, centrifuge at 12,000 rpm for 5 min at 4°C, and collect the supernatant. The supernatant is the culture medium supernatant. Add 5× reducing SDS polyacrylamide gel electrophoresis loading buffer to the culture medium supernatant, incubate at 70°C for 10 min, and then perform SDS-PAGE electrophoresis (electrophoresis at 110 V for 10 min, stop electrophoresis when the bromophenol blue migrates to the bottom of the gel at 170 V). Transfer the gel protein to a PVDF membrane (transfer conditions: 300 mA, 1 h), block with 5% non-fat milk powder, and wash three times with 1×TBST; then add rabbit anti-human COL3A1 antibody (22734-1-AP, Proteintech) for detecting COL3A1 protein, rabbit anti-human FBN1 antibody (29425-1-AP, Proteintech) for detecting FBN1 protein, or rabbit anti-human FN1 antibody (15613-1-AP, Proteintech) for detecting FN1 protein as the primary antibody, wash three times with 1×TBST after incubation; finally, add goat anti-rabbit IgG-HRP (SE134, Solarbio) as the secondary antibody, incubate; and perform chemiluminescence imaging.

[0119] According to the above steps, replace the rabbit anti-human COL3A1 antibody with mouse anti-human FBN2 antibody (sc-393968, SantaCruz), and replace goat anti-rabbit IgG-HRP with HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime), and keep other steps unchanged for detecting the expression of FBN2 protein.

[0120] The detection results are shown in Figure 3 D. The results showed that compared with the HDF cells transfected with the control sequence (i.e., the control group), the protein levels of COL3A1, FBN1, FBN2, and FN1 in the culture medium supernatant of the HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) were significantly downregulated.

[0121] 3. Take the transfected HDF cells obtained in Step 1, gently rinse the 6-well plate twice with 1×PBS, add 200 μL of 1×RIPA lysis buffer to each well, and let it stand on ice for 10 min (for sufficient lysis); then centrifuge at 4°C and 12,000 rpm for 10 min, collect the supernatant, and the supernatant is the cell lysate. Add 5× reducing SDS polyacrylamide gel electrophoresis loading buffer to the cell lysate, incubate at 70°C for 10 min, and then perform SDS-PAGE electrophoresis (electrophoresis at 110 V for 10 min, stop electrophoresis when the bromophenol blue migrates to the bottom of the gel at 170 V). Transfer the gel protein to a PVDF membrane (transfer conditions: 300 mA, 1 h), block with 5% skim milk powder, and wash three times with 1×TBST; then add rabbit anti-human p-SMAD3 antibody (ab52903, Abcam) for detecting p-SMAD3 protein, rabbit anti-human SMAD3 antibody (66516-1-lg, Proteintech) for detecting SMAD3 protein, rabbit anti-human TGFB1 antibody (21898-1-AP, Proteintech) for detecting TGFB1 protein, or rabbit anti-human HSP70 antibody (T55496, Abmart) for detecting HSP70 protein as the primary antibody, wash three times with 1×TBST after incubation; finally, add goat anti-rabbit IgG-HRP (SE134, Solarbio) as the secondary antibody, incubate; and develop by chemiluminescence.

[0122] According to the above steps, replace the rabbit anti-human p-SMAD3 antibody with mouse anti-human GAPDH antibody (K200057M, Solarbio), and replace goat anti-rabbit IgG-HRP with HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime), and keep other steps unchanged for detecting the expression of GAPDH protein.

[0123] The detection results are shown in Figure 3 Figure E. The results showed that compared with the HDF cells transfected with the control sequence (i.e., the control group), the intracellular TGFB1 protein level and the phosphorylation level of p-SMAD3 protein in the HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) were significantly downregulated.

[0124] Thus, it can be seen that when LTBP1 expression is inhibited, the TGF signaling pathway is inhibited, the synthesis of collagen and elastin is insufficient, and the reduction of fibronectin further weakens the cell-matrix connection ability, which may ultimately lead to the weakening of the peritoneal structural integrity and strength, and is more likely to produce scrotal hernia when facing increased abdominal pressure and mechanical stress.

[0125] V. Detect the migration and proliferation changes of the transfected HDF cells and the activity of the PI3K-AKT signaling pathway

[0126] TGF-β can signal through non-canonical pathways to activate PI3K-AKT signaling. The PI3K-AKT signaling pathway is a core signaling system in cells. It begins with the phosphorylation and activation of PI3K, which then activates downstream effector molecules to regulate cell survival, proliferation, migration, etc., in order to maintain the normal functions and homeostasis of cells. Therefore, this study further examined the changes in cell proliferation and migration activities of transfected HDF cells and the activity of the PI3K-AKT pathway.

[0127] 1. The cell proliferation of transfected HDF cells was detected by CCK8. Specifically, 100 μL of the resuspended transfected HDF cell suspension with a cell concentration of 1×10 5 cells / ml was evenly seeded into 96-well plates. At 0, 12, 24, 36, and 48 h after transfection, 10 μL of CCK8 reagent was added to each well, and the plates were incubated at 37 °C in the dark for 4 h. Subsequently, the absorbance was measured at 450 nm using a microplate reader.

[0128] The CCK-8 assay results showed ( Figure 4 as shown in A), compared with HDF cells transfected with the control sequence (i.e., the control group), the cell proliferation activity of HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) was significantly inhibited.

[0129] 2. The changes in the migration activity of transfected HDF cells were detected by the scratch assay. Specifically, after the cells were transfected, a scratch was made perpendicular to the horizontal line at the bottom of the well plate using a pipette tip. Subsequently, the cells were cultured in a medium with a serum concentration of 2%, and photographs were taken using a microscope at fixed observation points at 0, 24, and 48 h.

[0130] The scratch assay showed ( Figure 4 as shown in B), compared with HDF cells transfected with the control sequence (i.e., the control group), the migration speed of HDF cells transfected with the LTBP1-Homo interference sequence (i.e., the LTBP1 interference group) decreased significantly.

[0131] 3. Take the transfected HDF cells obtained in Step 1, gently rinse the 6-well plate twice with 1×PBS, add 200 μL of 1×RIPA lysis buffer to each well, and let it stand on ice for 10 min (for sufficient lysis); then centrifuge at 4°C and 12,000 rpm for 10 min, collect the supernatant, and the supernatant is the cell lysate. Add 5× reducing SDS polyacrylamide gel electrophoresis loading buffer to the cell lysate, incubate at 70°C for 10 min, and then perform SDS-PAGE electrophoresis (electrophoresis at 110 V for 10 min, stop electrophoresis when the bromophenol blue migrates to the bottom of the gel at 170 V). Transfer the gel protein to a PVDF membrane (transfer conditions: 300 mA, 1 h), block with 5% non-fat milk powder, and wash three times with 1×TBST; then add rabbit anti-human PI3K antibody (4257, CST) for detecting PI3K protein, rabbit anti-human p-PI3K antibody (T40116, Abmart) for detecting p-PI3K protein, rabbit anti-human AKT antibody (T55561, Abmart) for detecting AKT protein, or rabbit anti-human p-AKT antibody (T40067, Abmart) for detecting p-AKT protein as the primary antibody. After incubation, wash three times with 1×TBST; finally, add goat anti-rabbit IgG-HRP (SE134, Solarbio) as the secondary antibody, incubate; and develop by chemiluminescence.

[0132] According to the above steps, replace the rabbit anti-human PI3K antibody with mouse anti-human GAPDH antibody (K200057M, Solarbio), and replace goat anti-rabbit IgG-HRP (SE134, Solarbio) with HRP-labeled goat anti-mouse IgG (H+L) (A0216, Beyotime), and keep other steps unchanged for detecting the expression of GAPDH protein.

[0133] The results of Western blot detection show that ( Figure 4 as shown in C below), the phosphorylation levels of p-PI3K and p-AKT proteins in the cells are significantly downregulated.

[0134] The above results indicate that LTBP1 may reduce the motility and proliferation activity of fibroblasts by affecting the PI3K-AKT signaling pathway, which is not conducive to maintaining the normal peritoneal structure.

[0135] Example 4. Discovery of 3 SNP Loci in the Porcine Genome and Establishment of a Genotyping Method for Pigs Based on 3 SNP Loci

[0136] I. Discovery of 3 SNP Loci in the Porcine Genome

[0137] The present invention has discovered the LTBP1 gene that affects the occurrence of scrotal hernia in pigs, and 3 SNP sites have been discovered on the LTBP1 gene. The 3 SNP sites are respectively named SNP1 site (also known as C201T SNP site, which is the nucleotide at the 201st position from the 5'-end of SEQ ID NO: 1 in the pig genome, with a physical position at the 106679262nd position on pig chromosome 3, and the genotypes are CC homozygous, TT homozygous or CT heterozygous), SNP2 site (also known as C269T SNP site, which is the nucleotide at the 269th position from the 5'-end of SEQ ID NO: 1 in the pig genome, with a physical position at the 106679330th position on pig chromosome 3, and the genotypes are CC homozygous, TT homozygous or CT heterozygous) and SNP3 site (also known as T346A SNP site, which is the nucleotide at the 346th position from the 5'-end of SEQ ID NO: 1 in the pig genome, with a physical position at the 106679407th position on pig chromosome 3, and the genotypes are TT homozygous, AA homozygous or TA heterozygous).

[0138] SEQ ID NO:1:

[0139] TGGCAGTCTTCCACTAACACCTTTTTTTGAGAATTGACATTTTTATCACTGACAGTTTGGGGTTTTCACATTTCAATAGCTTTTATGTTACAGAATTCTTGCCATGATAGATGCTTTGTTTTATGTTGCCCTTCTGTTTTGAACGTTATTTATTTTGTGGCCATGCCCATAGCACGTGGAAGTTCCCGGAGGCCAGGGATYGAATCTACACCACATCAGTGAACCGAGCTGCTGCAGTGACAAGGCTGGGACAAGGCTGGATCCTTAAYCTGCTGTACCACAAGGGCACTCCTCATGTTTTTAAAAATTAAAAATCGTTTTCCACGTGACCATGCAAGAGAATTAWGGGTCCTTTCCAAAAGTATATATTGGTCACCATCTGCTTCACGACCAA (Y is C or T, W is T or A)

[0140] Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are reverse complementary to each other, generally the DNA molecule encoding a protein is named the sense DNA molecule; the DNA molecule that is reverse complementary to the sense DNA molecule is named the antisense DNA molecule. The genotypes of all sites are the genotypes of the sense DNA.

[0141] II. Obtaining primer pairs for identifying 3 SNP loci

[0142] According to the nucleotide sequences before and after the SNP1 locus, SNP2 locus, and SNP3 locus, primer pairs for identifying the SNP1 locus, SNP2 locus, and SNP3 locus are designed and synthesized. The primer pairs consist of an upstream primer F and a downstream primer R, and are used to amplify the target sequences including the SNP1 locus, SNP2 locus, and SNP3 locus.

[0143] The nucleotide sequences of the upstream primer F and the downstream primer R are shown in Table 4.

[0144] Table 4

[0145] Primer name Nucleotide sequence (5’-3’) and its position in the sequence listing Forward primer F TGGCAGTCTTCCACTAACACC (SEQ ID NO:2) Reverse primer R TTGGTCGTGAAGCAGATGGT (SEQ ID NO:3)

[0146] III. Establishment of a genotyping method for boars to be tested based on 3 SNP loci

[0147] The inventors of the present application have established a genotyping method for boars to be tested based on 3 SNP loci through a large number of experiments. The specific steps are as follows:

[0148] 1. Extract the genomic DNA of the ear tissue of the boar to be tested.

[0149] 2. Using the genomic DNA of the ear tissue of the boar to be tested as a template, perform PCR amplification with the primer pair consisting of the upstream primer F and the downstream primer R to obtain a PCR amplification product.

[0150] The reaction system is 25 μl, which consists of 1 μl of the genomic DNA of the ear tissue of the boar to be tested (concentration: 50 ng / μL), 1 μL of the aqueous solution of the upstream primer F (concentration: 10 pmol / μL), 1 μL of the aqueous solution of the downstream primer R (concentration: 10 pmol / μL), and 22 μL of the GoldMix (Green). GoldMix (Green) is a product of Tsingke Biotechnology Co., Ltd., and the product catalog number is TSE101.

[0151] The reaction conditions are: 94°C for 2 min; 94°C for 10 s, 61°C for 5 s, 72°C for 5 s, for 30 cycles; 72°C for 5 min.

[0152] 3. After completing step 2, sequence the PCR amplification product. According to the sequencing results, determine the genotypes of the boar to be tested based on the SNP1 locus, SNP2 locus, and SNP3 locus. The specific judgment principles are as follows:

[0153] If the 201st position of the PCR amplification product of the boar to be tested is only C, then the genotype of the boar to be tested based on the SNP1 locus is the CC homozygous type; if the 201st position of the PCR amplification product of the boar to be tested is only T, then the genotype of the boar to be tested based on the SNP1 locus is the TT homozygous type; if the 201st position of the PCR amplification product of the boar to be tested is T and C, then the genotype of the boar to be tested based on the SNP1 locus is the CT heterozygous type;

[0154] If the 269th position of the PCR amplification product of the boar to be tested is only C, then the genotype of the boar to be tested based on the SNP2 locus is the CC homozygous type; if the 269th position of the PCR amplification product of the boar to be tested is only T, then the genotype of the boar to be tested based on the SNP2 locus is the TT homozygous type; if the 269th position of the PCR amplification product of the boar to be tested is T and C, then the genotype of the boar to be tested based on the SNP2 locus is the CT heterozygous type;

[0155] If the 346th position of the PCR amplification product of the boar to be tested is only T, then the genotype of the boar to be tested based on the SNP3 locus is the TT homozygous type; if the 346th position of the PCR amplification product of the boar to be tested is only A, then the genotype of the boar to be tested based on the SNP3 locus is the AA homozygous type; if the 346th position of the PCR amplification product of the boar to be tested is A and T, then the genotype of the boar to be tested based on the SNP3 locus is the TA heterozygous type.

[0156] Example 5. Association analysis of the genotypes of 30 boars based on 3 SNP loci and scrotal hernia phenotypes

[0157] In this example, ear tissues of 30 boars (including two breeds of Yorkshire pigs and Landrace pigs) were collected through phenotypic observation. Among the 30 boar individuals, 15 individuals had scrotal hernia and 15 individuals were healthy.

[0158] I. Detecting the genotypes of 30 boars based on 3 SNP loci

[0159] According to the method in Item III of Example 4, the ear tissues of the boars to be tested were respectively replaced with the ear tissue samples of 30 boars, and other steps remained unchanged, obtaining the genotypes of 30 boars based on the SNP1 locus, SNP2 locus, and SNP3 locus.

[0160] Partial sequencing peak maps are shown in Figure 5 (where A is the sequencing peak map of the SNP1 locus, B is the sequencing peak map of the SNP2 locus, and C is the sequencing peak map of the SNP3 locus).

[0161] The quantity statistics results of the genotypes of 30 boars based on 3 SNP loci are shown in Table 5.

[0162] Table 5

[0163]

[0164]

[0165] Note: The P value is the significance level of the chi-square test. P < 0.01 indicates a significant difference.

[0166] II. Association analysis of genotypes at three SNP loci with scrotal hernia phenotype in 30 boars

[0167] Using SPSS 27 software, an association analysis was performed on the genotypes at three SNP loci and the scrotal hernia phenotype of the 30 boars obtained in Step 1, specifically the chi-square test. The test results are shown in Table 5.

[0168] The results showed that SNP1 locus, SNP2 locus, and SNP3 locus were all significantly associated with the scrotal hernia phenotype in boars; specifically as follows:

[0169] For SNP1 locus, the genotype frequency of the CC homozygous type was the highest in the scrotal hernia population; while in the healthy population, the genotype frequency of the CT heterozygous type was the highest, and the frequency of the T allele was much greater than its frequency in the scrotal hernia population. Thus, the polymorphism of SNP1 locus was significantly associated with the scrotal hernia phenotype, and the CC homozygous type had an obvious advantage in the occurrence of scrotal hernia and was a potential susceptible genotype.

[0170] For SNP2 locus, the genotype frequency of the CC homozygous type was the highest in the scrotal hernia population; while in the healthy population, the genotype frequency of the CT heterozygous type was the highest, and the frequency of the T allele was much greater than its frequency in the scrotal hernia population. Thus, the polymorphism of SNP2 locus was significantly associated with the scrotal hernia phenotype, and the CC homozygous type had an obvious advantage in the occurrence of scrotal hernia and was a potential susceptible genotype.

[0171] For SNP3 locus, the genotype frequency of the TT homozygous type was the highest in the scrotal hernia population; while in the healthy population, the genotype frequency of the TA heterozygous type was the highest, and the frequency of the A allele was much greater than its frequency in the scrotal hernia population. Thus, the polymorphism of SNP3 locus was significantly associated with the scrotal hernia phenotype, and the TT homozygous type had an obvious advantage in the occurrence of scrotal hernia and was a potential susceptible genotype.

[0172] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. A method for assessing the risk of scrotal hernia in boars, comprising the following steps: detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III, wherein the risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II or genotype III; The boar of genotype I is a boar whose genotype based on the C201T SNP site is CC homozygous, whose genotype based on the C269T SNP site is CC homozygous, and / or whose genotype based on the T346A SNP site is TT homozygous; The boar of genotype II is a boar whose genotype based on the C201T SNP site is CT heterozygous, whose genotype based on the C269T SNP site is CT heterozygous, and / or whose genotype based on the T346A SNP site is TA heterozygous; The boar of genotype III is a boar with a genotype of TT homozygous based on the C201T SNP site, a genotype of TT homozygous based on the C269T SNP site, and / or a genotype of AA homozygous based on the T346A SNP site; The C201T SNP site is the nucleotide at position 201 from the 5' end of SEQ ID NO: 1 in the pig genome; The C269T SNP site is the 269th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome; The T346A SNP site is the nucleotide at position 346 from the 5' end of SEQ ID NO: 1 in the pig genome.

2. A method for assessing the risk of scrotal hernia in boars, comprising the following steps: (1) Using the genomic DNA of the boar to be tested as a template, a primer pair consisting of an upstream primer F and a downstream primer R is used for PCR amplification to obtain a PCR amplification product; the PCR amplification product is detected and then evaluated as follows: If the 201st position of the PCR amplification product is only C, the genotype of the boar to be tested based on the C201T SNP site is CC homozygous; if the 201st position of the PCR amplification product is only T, the genotype of the boar to be tested based on the C201T SNP site is TT homozygous; if the 201st position of the PCR amplification product is T and C, the genotype of the boar to be tested based on the C201T SNP site is CT heterozygous; If the 269th position of the PCR amplification product is only C, the genotype of the boar to be tested based on the C269T SNP site is CC homozygous; if the 269th position of the PCR amplification product is only T, the genotype of the boar to be tested based on the C269T SNP site is TT homozygous; if the 269th position of the PCR amplification product is T and C, the genotype of the boar to be tested based on the C269T SNP site is CT heterozygous; If the 346th position of the PCR amplification product is only T, the genotype of the boar to be tested based on the T346A SNP site is TT homozygous; if the 346th position of the PCR amplification product is only A, the genotype of the boar to be tested based on the T346A SNP site is AA homozygous; if the 346th position of the PCR amplification product is A and T, the genotype of the boar to be tested based on the T346A SNP site is TA heterozygous; The C201T SNP site is the nucleotide at position 201 from the 5' end of SEQ ID NO: 1 in the pig genome; The C269T SNP site is the 269th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome; The T346A SNP site is the nucleotide at position 346 from the 5' end of SEQ ID NO: 1 in the pig genome; The upstream primer F is a single-stranded DNA molecule shown in SEQ ID NO: 2; The downstream primer R is a single-stranded DNA molecule shown in SEQ ID NO: 3; (2) Based on the result of (1), determine whether the genotype of the boar to be tested is genotype I, genotype II, or genotype III. The risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II or genotype III. The boar of genotype I is a boar whose genotype based on the C201T SNP site is CC homozygous, whose genotype based on the C269T SNP site is CC homozygous, and / or whose genotype based on the T346A SNP site is TT homozygous; The boar of genotype II is a boar whose genotype based on the C201T SNP site is CT heterozygous, whose genotype based on the C269T SNP site is CT heterozygous, and / or whose genotype based on the T346A SNP site is TA heterozygous; The boar of genotype III is a boar whose genotype based on the C201T SNP site is TT homozygous, whose genotype based on the C269T SNP site is TT homozygous, and / or whose genotype based on the T346A SNP site is AA homozygous.

3. A kit for assessing the risk of scrotal hernia in boars, comprising a substance for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III; The genotype I is a CC homozygous genotype based on the C201T SNP site, a CC homozygous genotype based on the C269T SNP site, and / or a TT homozygous genotype based on the T346A SNP site; The genotype II is a CT heterozygous genotype based on the C201T SNP site, a CT heterozygous genotype based on the C269T SNP site, and / or a TA heterozygous genotype based on the T346A SNP site; The genotype III is a genotype based on the C201T SNP site that is a TT homozygous type, a genotype based on the C269T SNP site that is a TT homozygous type, and / or a genotype based on the T346A SNP site that is an AA homozygous type; The C201T SNP site is the nucleotide at position 201 from the 5' end of SEQ ID NO: 1 in the pig genome; The C269T SNP site is the 269th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome; The T346A SNP site is the nucleotide at position 346 from the 5' end of SEQ ID NO: 1 in the pig genome.

4. The kit according to claim 3, characterized in that: The "substance for detecting whether the genotype of the boar to be tested is genotype I, genotype II or genotype III" is a primer pair consisting of the upstream primer F and the downstream primer R in claim 2.

5. The molecular marker shown in SEQ ID NO:

1.

6. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in assessing the risk of scrotal hernia in boars.

7. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in screening boars with a low risk of scrotal hernia.

8. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in boar breeding; the purpose of the boar breeding is to cultivate boar breeds with a low risk of scrotal hernia or a low risk of scrotal hernia.

9. The method according to claim 1 or 2, the kit according to claim 3 or 4, or the use according to any one of claims 6 to 8, characterized in that: The breed of the boar is Large White or Landrace.

Images