Nucleic acid composition, kit and detection method for detecting methylation of liver cancer related genes

Abstract

The invention discloses a nucleic acid composition, a kit and a detection method for detecting methylation of liver cancer related genes. The nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition or a combination of the first nucleic acid composition and the second nucleic acid composition, the first nucleic acid composition comprises a methylation specific primer and a probe of a target site of an EMX1 gene, a methylation specific primer and a probe of a target site of an OTX2 gene, and a methylation specific primer and a probe of a target site of a DAB2IP gene; the second nucleic acid composition comprises a methylation specific primer and a probe of a Septin9 gene target site, a methylation specific primer and a probe of a CDKL2 gene target site, and a methylation specific primer and a probe of a GSTP1 gene target site; according to the present invention, the kit prepared from the nucleic acid composition can determine whether the detected sample has canceration according to the DNA methylation degree of the detected sample, such that the simple and accurate liver cancer screening mode is provided for the clinical application, and the positive significance is provided for the liver cancer detection.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to a nucleic acid composition, a kit, and a detection method for detecting the methylation of liver cancer-related genes. Background Art

[0002] On February 2, 2024, the International Agency for Research on Cancer (IARC) of the World Health Organization reported that approximately 900,000 new cases of liver cancer and approximately 830,000 deaths due to liver cancer occurred globally. The five-year survival rate for patients with early-stage liver cancer is 34.2%, while that for patients with advanced-stage liver cancer is less than 1%. Normal liver tissue does not have pain nerves, which makes early-stage liver cancer usually have no typical symptoms. Even if symptoms such as loss of appetite and nausea and vomiting occur, they are easily confused with other digestive tract diseases. "Diagnosed at an advanced stage upon discovery" makes primary liver cancer (PLC) the third most common malignant tumor with the highest mortality rate globally. Compared with the general population, the incidence of liver cancer is significantly higher in some high-risk groups (such as those with liver cirrhosis (LC) or chronic hepatitis virus infection (CHVI)), and they have a higher need for early screening of liver cancer.

[0003] Currently, the main methods for liver cancer screening include hematological AFP (alpha-fetoprotein) detection and imaging examinations. From the current diagnosis and treatment path, liver cancer early screening usually combines AFP and liver ultrasound (US) to regularly screen high-risk groups for liver cancer. If abnormalities are found, further consideration is given to CT or magnetic resonance imaging examinations. Alpha-fetoprotein (AFP) is currently the most widely used serological marker for diagnosing liver cancer. However, nearly 40% of liver cancer patients still have normal or low levels of AFP. Moreover, the serum AFP levels also increase in populations such as pregnancy, active hepatitis, reproductive system tumors, and other digestive tract tumors such as gastrointestinal and pancreatic tumors. Although ultrasound (US) has simple equipment, low cost, and is easy to perform, and is widely used clinically, its diagnostic sensitivity for early-stage liver cancer is only 47%, and it is interfered by liver cirrhosis nodules and requires high operator experience. Even when AFP and ultrasound detections are combined, the sensitivity for early-stage liver cancer is only 63%, still unable to meet the needs of early liver cancer screening. CT plain scan is difficult to detect extremely early-stage liver cancer (<1 cm) or liver cancer with a density similar to normal liver parenchyma, and it has certain radioactivity. Although the performance of MRI has been significantly improved compared with ultrasound (US) and CT, there are still certain limitations in the detection sensitivity and specificity.

[0004] Cell-free DNA (cfDNA) is DNA fragments that exist freely in the body fluids of organisms and are not intracellular. These DNA fragments usually originate from apoptosis or necrosis (released after cell injury or death). Currently, multiple guidelines / consensuses have recommended gene methylation for the early screening and diagnosis of liver cancer, clearly indicating that the detection of epigenetic modifications of cfDNA has certain application potential and can be used as a supplement to individualized diagnosis. Plasma circulating free DNA can not only quantify tumor burden and evaluate prognosis, but also determine the nature of lesions by detecting gene mutations and epigenetic changes, with the advantages of simplicity and minimal invasiveness. Abnormal DNA methylation is an important factor in tumorigenesis and development. Different from individualized and diverse gene mutations, specific types of tumor cells usually show similar DNA methylation changes, and the methylation pattern of cfDNA can reflect its cell origin or tissue characteristics. Therefore, detecting these specific changes closely related to tumors helps in the early detection of tumors. Studies have shown that the incidence of hypermethylation of the TGR5 promoter in HCC patients is significantly higher (48.13%) compared with chronic hepatitis B (13.64%) and healthy control groups (4.44%).

[0005] Currently, for the early detection of liver cancer methylation, a nucleic acid composition and kit with accurate results, fast timeliness, high detection throughput, good specificity, and good sensitivity have not been found yet. The present invention solves such problems and can indirectly provide effective information for the early diagnosis of human liver cancer, providing a simple and feasible method for the early detection and treatment of liver cancer and the monitoring of treatment effects. Summary of the Invention

[0006] Aiming at the prior art, the object of the present invention is to provide a kit for detecting liver cancer methylation that can quickly and accurately diagnose the degree of DNA methylation in a test sample and a method for detecting liver cancer. It can determine whether the test sample has canceration according to the degree of DNA methylation in the test sample, providing a simple and accurate method for liver cancer screening in clinical practice.

[0007] In the first aspect, the present invention provides a nucleic acid composition for detecting the methylation of liver cancer-related genes, characterized in that the nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; the first nucleic acid composition includes: methylation-specific primers and probes for the target site of the EMX1 gene, methylation-specific primers and probes for the target site of the OTX2 gene, and methylation-specific primers and probes for the target site of the DAB2IP gene; the second nucleic acid composition includes: methylation-specific primers and probes for the target site of the Septin9 gene, methylation-specific primers and probes for the target site of the CDKL2 gene, and methylation-specific primers and probes for the target site of the GSTP1 gene; wherein, The methylation-specific primers and probes for the target site of the EMX1 gene include: Forward primer: SEQ ID NO:1, Reverse primer: SEQ ID NO:2, Probe: SEQ ID NO:3; The methylation-specific primers and probes for the target site of the OTX2 gene include: Forward primer: SEQ ID NO:4, Reverse primer: SEQ ID NO:5, Probe: SEQ ID NO:6; The methylation-specific primers and probes for the target site of the DAB2IP gene include: Forward primer: SEQ ID NO:7, Reverse primer: SEQ ID NO:8, Probe: SEQ ID NO:9; The methylation-specific primers and probes for the target site of the Septin9 gene include: Forward primer: SEQ ID NO:10, Reverse primer: SEQ ID NO:11, Probe: SEQ ID NO:12; The specific primers and probes for the CDKL2 internal reference gene include: Forward primer: SEQ ID NO:13, Reverse primer: SEQ ID NO:14, Probe: SEQ ID NO:15; The specific primers and probes for the GSTP1 gene include: Forward primer: SEQ ID NO:16, Reverse primer: SEQ ID NO:17, Probe: SEQ ID NO:18.

[0008] Optionally, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

[0009] Optionally, the 3' end of the probe contains a fluorescent quenching group, and the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0010] Optionally, it further includes ACTB internal reference gene specific primers and probes. The ACTB internal reference gene specific primers and probes include: Forward primer: SEQ ID NO:19, Reverse primer: SEQ ID NO:20, Probe: SEQ ID NO:21.

[0011] In a second aspect, the present invention provides a kit for detecting the methylation of liver cancer-related genes. The kit includes the nucleic acid composition described in the first aspect, and further includes a PCR reaction solution, a positive control product, and a negative control product.

[0012] Optionally, the positive control product is genomic DNA of the liver cancer HepG2 cell line.

[0013] Optionally, the negative control product is sterile water.

[0014] Optionally, the PCR reaction solution includes a PCR buffer, dNTP, MgCl2, BSA, and Taq enzyme.

[0015] Optionally, for the kit for detecting the methylation of liver cancer-related genes, the final concentrations of the components of the PCR reaction solution are: 1X PCR buffer, 0.2 - 0.5 mM dNTP nuclease-free water, 2 - 2.5 U / μL Taq enzyme.

[0016] Optionally, the nucleic acid composition comprises 0.2 μM to 0.5 μM EMX1 forward primer, 0.2 μM to 0.5 μM EMX1 reverse primer, 0.15 μM to 0.4 μM EMX1 detection probe, 0.2 μM to 0.5 μM OTX2 forward primer, 0.2 μM to 0.5 μM OTX2 reverse primer, 0.15 μM to 0.4 μM OTX2 detection probe, 0.2 μM to 0.5 μM DAB2IP forward primer, 0.2 μM to 0.5 μM DAB2IP reverse primer, 0.15 μM to 0.4 μM DAB2IP detection probe, 0.2 μM to 0.5 μM Septin9 forward primer, 0.2 μM to 0.5 μM Septin9 reverse primer, 0.15 μM to 0.4 μM Septin9 detection probe, 0.2 μM to 0.5 μM CDKL2 forward primer, 0.2 μM to 0.5 μM CDKL2 reverse primer, 0.15 μM to 0.4 μM CDKL2 detection probe, 0.2 μM to 0.5 μM GSTP1 forward primer, 0.2 μM to 0.5 μM GSTP1 reverse primer, 0.15 μM to 0.4 μM GSTP1 detection probe, 0.2 μM to 0.5 μM ACTB forward primer, 0.2 μM to 0.5 μM ACTB reverse primer, 0.15 to 0.4 μM ACTB detection probe.

[0017] In a third aspect, the present invention provides a method for detecting methylation of liver cancer-related genes, comprising the following steps: (1) Extracting plasma CfDNA; (2) Transforming CfDNA to obtain purified BisDNA; (3) PCR detection: Using the nucleic acid composition described in the first aspect in combination with methylation fluorescence quantitative PCR amplification technology to detect the methylation status of the Bis-DNA obtained in step (2).

[0018] Optionally, the reaction program for the PCR amplification is: 95 °C, 5 min, 45 cycles of 95 °C for 15 sec and 60 °C for 30 sec (fluorescence collection).

[0019] The beneficial effects of the present invention are as follows: The present invention discovers that the nucleic acid composition of specific forward primers, specific reverse primers and specific probes of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1 has a synergistic effect on the sensitivity and specificity of detecting methylation of liver cancer-related genes; The present invention uses the gene ACTB as an internal reference gene to control the quality of samples. Considering the possible methylation of housekeeping genes, positions without CpG sites are selected when designing internal reference primers and probes, and the sequences after bisulfite treatment are designed to ensure the quality control of samples by housekeeping genes; The present invention has the characteristics of being fast, high-throughput, sensitive and highly specific by designing primers and probes with high specificity, configuring them into a kit that is convenient to use and has reliable detection results, and combining with a scientific and reasonable PCR reaction system; When using the kit of the present invention for liver cancer screening, the positive detection rate (sensitivity) is 85%, and the negative detection rate (specificity) is 90%, realizing the rapid and accurate measurement of the methylation degree of liver cancer-related genes, so as to indirectly diagnose and treat liver cancer in a timely and effective manner, reduce medical costs, save social resources and improve the quality of life. Description of the Drawings

[0020] Figure 1 : Positive result diagrams of hypomethylation of three genes, EMX1, OTX2, and DAB2IP; Figure 2 : Positive result diagrams of hypermethylation of three genes, EMX1, OTX2, and DAB2IP; Figure 3 : Positive result diagram of methylation of EMX1 gene; Figure 4 : Positive result diagram of methylation of OTX2 gene; Figure 5 : Positive result diagram of methylation of DAB2IP gene; Figure 6 : Negative result diagrams of methylation of three genes, EMX1, OTX2, and DAB2IP; Figure 7 : Positive result diagrams of hypomethylation of three genes, Septin9, CDKL2, and GSTP1; Figure 8 : Positive result diagrams of hypermethylation of three genes, Septin9, CDKL2, and GSTP1; Figure 9 : Positive result diagram of methylation of Septin9 gene; Figure 10 : Positive result diagram of methylation of CDKL2 gene; Figure 11 : Positive result diagram of methylation of GSTP1 gene; Figure 12 : Negative result diagrams of methylation of three genes, Septin9, CDKL2, and GSTP1; Figure 13 : Receiver operating characteristic curve established by the method for detecting liver cancer of the present invention. Detailed implementation manners

[0021] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0022] Example 1 A nucleic acid composition for detecting methylation of liver cancer-related genes This example provides a nucleic acid composition for detecting methylation of liver cancer-related genes. The nucleic acid composition targets the methylation sequences of genes EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1, and is primers and probes designed for the target genes EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1, and is used to detect the methylation degree in at least one target region in the promoter regions of genes EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 in a test sample. The promoter region is not strictly limited to the region within the promoter fragment, but is a gene fragment in the region near the promoter.

[0023] The methylation regions to be detected of the genes EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 all contain multiple CpGs. The nucleotide sequences (bisulfite conversion sequences of each gene) of the methylation regions to be detected of each gene are shown in Table 1.

[0024] Table 1 gene sequence information EMX1 AGTATAAATAGTTGGATTTTTTTTTTAAGAATCGAGTTTGGACGCGGAGATGGAGTTAAGTGTGGTTGTATTTTCGGATTCGGAAATTCGTTGGGTATTGAAGGATTTTTCGAATTTTGTAGCGTTGTTGTTTCGCGGTTTATCGTCGTCGTTGTAGACGGATGCGTTTTTCGGCGGTTTTACGTTTTTTAGTTTCGGTTAGGTTTTTGGGTTGGGAGTCGAGTCGTTTCGGGTTTTTCG (SEQ ID NO:22) OTX2 GGCGTTTAGTTTTTTCGTTAATTTAGCGGTTGTAGCGGTTGCGGGATTAGGTGGGAATTCGGTGGCGGTCGCGTCGTCGTTGAGTATATTAGTTGTTTTATTTATTTGGAGTTCGGTTTTTATTTCGTTAGGTTTAGCGTTCGCGTTCGTGTCGGTGTCGGAGTTATTGGTCGCGTTTAGTAATATTTCGTGTATGTAGCGTTTCGTAGTTGTAGGCGTCGTTATCGTAGTAGTTTTTTATTTTATGTTTTACGGTTAGGGCGGTAGTTACGGTTAAGGTTATTTTACGTTTTTTTTTTTTTATTTTGGCGGCGTGGAT (SEQ ID NO:23) DAB2IP TTTTAGTTGTTAGTATTTGATTAGAATTATATTTTTCGTCGGGAGTGGTCGCGCGGTTTCGAAGTTTTCGGTCGGCGGTTATTTAAGCGAGGTTCGTCGTATTCGTTGCGTTGTAGTTTGGAGGTTTCGGGCGCGGGGAAGTTATGTTCGTTTTACGGAGGTAATAGTTAGTCGGTGAGTAGTTTCGAAATTTTTTTTTTTTTTGGTTTTATTTTTTTTTTAAAGATTTTTTTTTTTTTTTTG (SEQ ID NO:24) Septin9 TTGATTTTTTGTTCGGTTTTGAGTTATGTGATTCGGTGGGCGGGTCGCGGTTTTCGGCGCGTTTAGCGTAGTTCGACGTTTCGTTGTTGGGGTGAGTTTTGTTTTTTTGTTTTTTTTAGTTTTGTATTATTGGTTCGGGGGTTTTTAGGTGGCGCGGTCGC (SEQ ID NO:25) CDKL2 TGGGGACGTAGGGTTTTTGCGTGTTAGGGAGTAGAATTTGGGTCGAGTTTTAGGTGAAGGGGCGGGGTGGTTGGTTTTGAGTTAATTATGGTTCGTGACGATTCGGTTCGGTTAATTAGAAGAAGGGAGGTTTGGCGTTTTCGGGGCGGGTGAGAAATCGTTTTTTTTTGTAGTTTCGCGGTTAACGTTTTCGTTTAGGGGTAGTTGGAGCGGTGTAGGTTTTTAGGTTTTAGGTAT (SEQ ID NO:26) GSTP1 CGGGGATTTTAGGGCGTTTTTTTGCGGTCGACGTTCGGGGTGTAGCGGTCGTCGGGGTTGGGGTCGGCGGGAGTTCGCGGGATTTTTTAGAAGAGCGGTCGGCGTCGTGATTTAGTATTGGGGCGGAGCGGGGCGGGATTATTTTTATAAGGTTCGGAGGTCGCGAGGTTTTCGTTGGAGTTTCGTCGTCGTAGTTTTCGTTATTAGTGAGTACGCGCGGTTCGCGTTTTCG (SEQ ID NO:27)

[0025] The primers and probes designed for the genes EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB are shown in Table 2. Among them, the 5' end of the probe sequence is modified with a fluorescent group, selected from any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5, and the 3' end is labeled with a fluorescent quenching group, selected from any one of MGB, BHQ-1, BHQ-2, and BHQ-3.

[0026] Table 2

[0027] Example 2 A detection kit for detecting methylation of liver cancer-related genes

[0028] This embodiment provides a detection kit for detecting the methylation of liver cancer-related genes. The kit contains a first nucleic acid composition, a second nucleic acid composition, a PCR reaction solution, a positive control, and a negative control. The specific ratios are shown in Table 3. Among them, the methylation PCR reaction solution consists of the following components: the use concentrations of EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference primers are 0.4 μM, the use concentration of the probe is 0.2 μM, the use concentration of the PCR buffer is 10 nM Tris pH 8.3, 500 mM KCl, 15 mM ammonium sulfate, the use concentration of MgCl2 is 4 mmol / L, the use concentration of dNTP is 0.4 mmol / L, and the use concentration of Taq enzyme is 200 U / mL.

[0029] Table 3: Ratio Table of the Liver Cancer Gene Methylation Detection Kit

[0030] Example 3 Method for Detecting Liver Cancer by a Liver Cancer Methylation Detection Kit

[0031] This embodiment provides a method for detecting liver cancer by a liver cancer methylation detection kit, including the following steps: 1. Extract the DNA of the sample to be detected, extract CfDNA from the human plasma sample, and the usage amount of the plasma sample is 1 - 4 mL; 2. Bisulfite conversion treatment: Perform bisulfite conversion on the extracted DNA. The unmethylated cytosine C in the DNA is converted into uracil (U), while the methylated cytosine (C) remains unchanged, and purified BisDNA is obtained; the DNA after the conversion treatment is used as the genomic DNA sample for PCR; the reagent used for the conversion treatment is bisulfite or sodium bisulfite. Designing according to the sequence after treatment with sodium bisulfite can ensure the quality control of the sample by the housekeeping gene; 3. Prepare the PCR reaction system: Dispense 15 μL / tube of the methylation PCR reaction solutions 1 and 2 in the liver cancer methylation detection kit into an eight-connected tube, and then add 10 μL of the purified BisDNA to the methylation PCR reaction solutions 1 and 2 respectively; 4. PCR fluorescence detection: Tighten the tube caps of the eight-connected tubes after loading and place them in a qPCR instrument. Select the fluorescence detection channel and set the amplification cycle parameters for the qPCR instrument. The reaction program for PCR amplification is: denaturation at 95 °C for 5 min; 45 cycles, 95 °C for 15 sec, 60 °C for 30 sec; simultaneously detect EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB according to the fluorescence probe labeling of multiple channels of the qPCR instrument, and obtain the Δ Ct values (target Ct value - internal reference Ct value) of 6 target genes; 5. Interpretation of test results: Calculate the difference in CT values of EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB respectively, substitute them into the fitting formula in Table 4 to calculate the P value. If the P value of any tube is greater than 0.6, the methylation test result can be judged as positive.

[0032] Table 4 Reagent Fitting formula Cutoff value PCR reaction solution 1 1 / (1 + EXP(-(9.637 - 0.321*(ΔCt - EMX1)-0.343*(ΔCt - OTX2)-0.353*(ΔCt - DAB2IP)))) 0.6189 PCR reaction solution 2 1 / (1 + EXP(-(9.637 - 0.334*(ΔCt - Septin9)-0.315*(ΔCt - CDKL2)-0.321*(ΔCt - GSTP1)))) 0.6205

[0033] The logistic regression analysis of the present invention is as follows:

[0034] Through experiments, in normal samples and liver cancer samples, a logistic regression was established. By analyzing the combined detection of methylation fitting regression of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1, the sensitivity and specificity are much higher than the detection and analysis results of individual genes of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1. The statistical results are shown in Table 5.

[0035] Table 5 Target Sensitivity (%) Specificity (%) EMX1 75.0 100.0 OTX2 65.0 90.0 DAB2IP 75.0 90.0 Septin9 75.0 90.0 CDKL2 80.0 90.0 GSTP1 65.0 100.0 The detection reagent of the present invention 90.00 95.0

[0036] The receiver operating characteristic curve established in the verification experiment of the present invention is as Figure 13 shown, Figure 13 indicating that the methylation detection using the detection reagent of the present invention can significantly distinguish liver cancer patients from normal people. The area under the ROC curve (AUC) is 0.936 (95% CI 0.916 - 0.956; P < 0.001).

[0037] Example 4 Accuracy Verification This example is the accuracy verification of the liver cancer methylation detection kit of the present invention and its method for detecting liver cancer. The specific experimental operations and results are as follows: Extract plasma CfDNA from 147 human plasma samples. The nucleic acid is converted into BisDNA by bisulfite, and then the methylation combined detection is carried out using the liver cancer methylation detection kit of Example 2. The qPCR detection results and clinical diagnosis information table are shown in Table 6.

[0038] Table 6

[0039] Figures 1 - 12 are the PCR amplification curves of the target genes (EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1) in typical human plasma samples.

[0040] The above experimental data indicate that when the detection kit of the present invention is used for liver cancer screening and compared with the clinical diagnosis results, the detection sensitivity and specificity of the liver cancer methylation detection reagent provided by the present invention are 86.4% and 92.2% respectively. The detection reagent provided by the present invention has high sensitivity and specificity, and comprehensively judges whether the tested sample has canceration by detecting the methylation of six target genes, effectively supplementing the differences that may be caused by site selection and reaction systems, and improving the accuracy of liver cancer detection.

[0041] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and all technical solutions obtained by using equivalent replacements or equivalent transformations fall within the protection scope of the present invention.

Claims

1. A nucleic acid composition for detecting methylation of liver cancer-related genes, characterized in that, The nucleic acid composition is the first nucleic acid composition, the second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; The first nucleic acid composition includes: methylation-specific primers and probes for the target site of the EMX1 gene, methylation-specific primers and probes for the target site of the OTX2 gene, and methylation-specific primers and probes for the target site of the DAB2IP gene; the second nucleic acid composition includes: methylation-specific primers and probes for the target site of the Septin9 gene, methylation-specific primers and probes for the target site of the CDKL2 gene, and methylation-specific primers and probes for the target site of the GSTP1 gene; wherein, The methylation-specific primers and probes for the target site of the EMX1 gene include: Forward primer: SEQ ID NO:1, Reverse primer: SEQ ID NO:2, Probe: SEQ ID NO:3; The methylation-specific primers and probes for the target site of the OTX2 gene include: Forward primer: SEQ ID NO:4, Reverse primer: SEQ ID NO:5, Probe: SEQ ID NO:6; The methylation-specific primers and probes for the target site of the DAB2IP gene include: Forward primer: SEQ ID NO:7, Reverse primer: SEQ ID NO:8, Probe: SEQ ID NO:9; The methylation-specific primers and probes for the target site of the Septin9 gene include: Forward primer: SEQ ID NO:10, Reverse primer: SEQ ID NO:11, Probe: SEQ ID NO:12; The CDKL2 internal reference gene-specific primers and probes include: Forward primer: SEQ ID NO:13, Reverse primer: SEQ ID NO:14, Probe: SEQ ID NO:15; The GSTP1 gene-specific primers and probes include: Forward primer: SEQ ID NO:16, Reverse primer: SEQ ID NO:17, Probe: SEQ ID NO:

18.

2. The nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that, The 5'-end of the probe contains a fluorescent reporter group, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

3. The nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that, The 3'-end of the probe contains a fluorescent quenching group, and the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

4. The nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that, The nucleic acid composition further includes ACTB internal reference gene-specific primers and probes, The ACTB internal reference gene-specific primers and probes include: Forward primer: SEQ ID NO:19, Reverse primer: SEQ ID NO:20, Probe: SEQ ID NO:

21.

5. A kit for detecting the methylation of liver cancer-related genes, characterized in that, The kit includes the nucleic acid composition according to any one of claims 1-4, and further includes a PCR reaction solution, a positive control product, and a negative control product.

6. The kit for detecting the methylation of liver cancer-related genes according to claim 5, characterized in that, The positive control product is the genomic DNA of the liver cancer HepG2 cell line.

7. The kit for detecting the methylation of liver cancer-related genes according to claim 5, characterized in that, The negative control product is sterile water.

8. The kit for detecting the methylation of liver cancer-related genes according to claim 5, characterized in that, The PCR reaction solution includes a PCR buffer, dNTP, MgCl2, BSA, and Taq enzyme.

9. A method for detecting the methylation of liver cancer-related genes, characterized in that, It includes the following steps: (1) Plasma CfDNA extraction; (2) CfDNA is transformed to obtain purified BisDNA; (3) PCR detection: Using a nucleic acid composition for detecting the methylation of liver cancer-related genes according to any one of claims 1-4 in combination with the methylation fluorescence quantitative PCR amplification technique to detect the methylation status of the Bis-DNA obtained in step 2).

Images