A molecular marker related to 2-acetyl-3-methylpyrazine content in pig muscle and application thereof
By detecting the polymorphism of specific SNP sites in the pig genome and determining the genotype, the problem of increasing the content of 2-acetyl-3-methylpyrazine in pork was solved, achieving efficient breeding and improving meat quality, which has significant economic and scientific research value.
Patent Information
- Application Number
- CN202510652833.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-05-21
AI Technical Summary
Existing technologies make it difficult to effectively increase the content of 2-acetyl-3-methylpyrazine in pork through breeding methods. The lack of relevant molecular markers leads to high breeding costs and slow progress.
Provided are substances for detecting the polymorphism or genotype of SNP sites in the pig genome, in particular the SNP site located at nucleotide 6328556 on chromosome 9 of the pig genome (nucleotide is A or G). The genotype is determined by PCR amplification and sequencing, and is used to assist in the detection and selection of pig individuals with high 2-acetyl-3-methylpyrazine content for breeding.
It realizes the early selection of pig individuals with high 2-acetyl-3-methylpyrazine content, saves breeding costs, improves meat quality and flavor, and accelerates genetic progress, which has important economic and scientific research value.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of enzyme, nucleic acid or microorganism determination or detection method, and particularly relates to a molecular marker related to the content of 2-acetyl-3-methylpyrazine in pig muscle and application thereof BACKGROUND
[0002] Meat is a food with high edible value. With the improvement of living standards, people's demand for meat products is not limited to quantity, and quality and flavor have become important factors affecting consumer demand. Some volatile compounds contained in meat products are highly related to meat quality and flavor, and are the basis for forming the original flavor of meat, which can impart unique aroma.
[0003] 2-acetyl-3-methylpyrazine belongs to pyrazines in volatile compounds, has the aroma of nuts and toasted bread, and is often used as a flavor additive in the food industry, especially in coffee, chocolate and nut-flavored products. Due to its unique aroma characteristics, it is also widely used in the synthesis of perfumes and spices. Pyrazine compounds have antioxidant properties and can scavenge free radicals, thereby protecting cells. In addition, studies have shown that aroma compounds have an impact on the nervous system and may affect mood and behavior through the olfactory pathway. As an important organic compound, 2-acetyl-3-methylpyrazine has broad application prospects in the food and spice industry, and its biological effects and mechanisms also have important research value.
[0004] It is difficult to increase the content of 2-acetyl-3-methylpyrazine in pork by traditional breeding methods, so there is still a lot of room for improvement in the content of 2-acetyl-3-methylpyrazine in pork. At present, molecular marker assisted breeding technology has been widely used in the cultivation of new breeds of livestock and poultry, and through whole genome association analysis, molecular markers closely related to target traits can be obtained. Early selection of target traits using molecular markers can greatly save breeding costs and accelerate genetic progress. However, there is no molecular marker related to the content of 2-acetyl-3-methylpyrazine in pork. SUMMARY
[0005] The technical problem to be solved by the present application is to provide a molecular marker related to the content of 2-acetyl-3-methylpyrazine in pig muscle. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.
[0006] To solve the above technical problems, the present application provides the following technical solutions:
[0007] The application provides application of a substance for detecting polymorphism or genotype of a SNP site in a pig genome, the SNP site being a nucleotide at position 134 of SEQ ID NO: 1, and the nucleotide being A or G, and the application is application of the substance in any one of the following,
[0008] A1) application of the substance in detecting or assisting in detecting content of 2-acetyl-3-methylpyrazine;
[0009] A2) application of the substance in detecting or assisting in detecting polymorphism or genotype of the SNP;
[0010] A3) application of the substance in pig breeding;
[0011] A4) application of the substance in preparing a product for detecting or assisting in detecting content of 2-acetyl-3-methylpyrazine;
[0012] A5) application of the substance in preparing a product for detecting or assisting in detecting polymorphism or genotype of the SNP;
[0013] A6) application of the substance in preparing a product for pig breeding.
[0014] The SNP is also located at a nucleotide at position 6328556 on chromosome 9 of a pig genome (Sscrofa11.1, GCF_000003025.6), corresponding to a nucleotide at position 134 of the nucleotide sequence of SEQ ID NO: 1.
[0015] It is known to those skilled in the art that the nucleotide sequence of the SNP site (a nucleotide at position 134 of SEQ ID NO: 1) and the nucleotide sequence near the SNP site are composed of SEQ ID NO: 1, and the number of the nucleotide sequence near the SNP site should not be a limiting factor of the protection scope of the application, which can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other value, which is used to assist in locating the position of the SNP on chromosome 6 of the pig genome.
[0016] The foregoing and the following should be defined as before or after in the direction recognized by those skilled in the art, such as the 5'-3' direction.
[0017] The application also provides a method for detecting or assisting in detecting content of 2-acetyl-3-methylpyrazine, comprising the following steps: detecting genotype of the aforementioned SNP site in a pig to be detected, and detecting or assisting in detecting content of 2-acetyl-3-methylpyrazine according to the genotype.
[0018] The relative content of 2-acetyl-3-methylpyrazine of the pig to be detected with AA genotype of the SNP is significantly higher than that of the pig to be detected with AG and GG genotype, and the relative content of 2-acetyl-3-methylpyrazine of the pig to be detected with AG genotype is significantly higher than that of the pig to be detected with GG genotype. The AA is a homozygote of A at the SNP site, the GA is a heterozygote of G and A at the SNP site, and the GG is a homozygote of G at the SNP site.
[0019] In the above application or method, the detection or auxiliary detection of the content of 2-acetyl-3-methylpyrazine can be specifically the detection of the content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle of the pig.
[0020] In the above method, the part of the pig genome containing the aforementioned SNP can be amplified by PCR. For example, the PCR product containing SEQ ID NO: 1 is sequenced to detect the type of deoxyribonucleotide at position 134 of SEQ ID NO: 1, so as to detect the genotype of the SNP site in the genome of the pig to be detected.
[0021] The application also provides a method for pig breeding, which comprises detecting the genotype of the aforementioned SNP site in the genome of the pig to be detected, and selecting the pig to be detected with AA genotype of the SNP site as the parent for breeding, wherein the AA is a homozygote of A at the SNP site.
[0022] The application also provides a product containing a substance for detecting the polymorphism or genotype of the SNP site in the genome of the pig, wherein the SNP site is the 134th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; and the product is any one of the following:
[0023] B1) a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine;
[0024] B2) a product for detecting or assisting in detecting the polymorphism or genotype of the SNP;
[0025] B3) a product for pig breeding.
[0026] In the above application or product, the substance is any one of the following:
[0027] C1) the substance is a primer composition for amplifying the DNA fragment of the pig genome containing the SNP site;
[0028] C2) the substance is a PCR reagent containing the primer composition of C1);
[0029] C3) the substance is a kit containing the primer composition of C1) or the PCR reagent of C2).
[0030] The kit can further comprise conventional reagents for PCR amplification. The kit can further comprise conventional reagents for sequencing.
[0031] In the above-mentioned use or product, the primer composition is any one of F1) - F3):
[0032] F1), a primer set consisting of a single-stranded DNA represented by SEQ ID NO: 2 in the sequence listing and a single-stranded DNA represented by SEQ ID NO: 3 in the sequence listing;
[0033] F2), a primer set consisting of a single-stranded DNA whose nucleotide sequence is 1-20 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA whose nucleotide sequence is 220-239 of SEQ ID NO: 1 in the sequence listing;
[0034] F3), a primer set consisting of a single-stranded DNA obtained by substitution and / or deletion and / or addition of one or several nucleotides to SEQ ID NO: 2 and having the same function as SEQ ID NO: 2 and a single-stranded DNA obtained by substitution and / or deletion and / or addition of one or several nucleotides to SEQ ID NO: 3 and having the same function as SEQ ID NO: 3.
[0035] The present application also provides the use of the aforementioned product in pig breeding.
[0036] The present application also provides a DNA molecule, one strand of which is SEQ ID NO: 1.
[0037] The present application also provides the use of a DNA molecule, one strand of which has the nucleotide sequence of SEQ ID NO: 1, for any one of the following purposes:
[0038] D1) the DNA molecule is used for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine;
[0039] D2) the DNA molecule is used for detecting or assisting in detecting the polymorphism or genotype of SNP;
[0040] D3) the DNA molecule is used for pig breeding;
[0041] D4) the DNA molecule is used for preparing a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine;
[0042] D5) the DNA molecule is used for preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNP;
[0043] D6) the DNA molecule for use in the production of a product for swine breeding.
[0044] The present application also protects the use of any of the above-mentioned methods in breeding.
[0045] The present application also protects the use of the specific primers in breeding.
[0046] The present application also protects the use of the kit in breeding.
[0047] The present application also protects the primer composition.
[0048] Any of the above-mentioned breeding is breeding of swine.
[0049] The purpose of the breeding is to select individuals with high content of 2-acetyl-3-methylpyrazine in longissimus dorsi.
[0050] The purpose of the breeding is to select a population with high content of 2-acetyl-3-methylpyrazine in longissimus dorsi.
[0051] The purpose of the breeding is to select a breed with high content of 2-acetyl-3-methylpyrazine in longissimus dorsi.
[0052] In the breeding, individuals with AG genotype and GG genotype are eliminated.
[0053] In the breeding, individuals with AA genotype are retained.
[0054] Any of the above-mentioned swine is all swine breeds.
[0055] The beneficial effects of the present application are: the SNP molecular marker of the present application is related to the content of 2-acetyl-3-methylpyrazine in longissimus dorsi of pigs, and is a new molecular marker. By determining the genotype of the SNP site of the test pig, early selection of the content of 2-acetyl-3-methylpyrazine in longissimus dorsi of pigs can save production costs, improve meat quality and flavor, and accelerate genetic progress, better serve the breeding of pigs, and has great economic application value and scientific research value. DETAILED DESCRIPTION
[0056] The present application will be further described in detail below with specific embodiments. The examples provided below are only intended to illustrate the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.
[0057] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0058] The following examples use GraphPad Prism 8 statistical software to process data, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, and P<0.05 (*) indicates significant difference.
[0059] Example 1, determination of the correlation between specific SNP and 2-acetyl-3-methylpyrazine content in longissimus dorsi muscle
[0060] Test animals: Landrace, Large White, and Three-way pigs, all from COFCO Jiajiakang (Chifeng) Co., Ltd.
[0061] I. Determination of 2-acetyl-3-methylpyrazine content in longissimus dorsi muscle
[0062] Under the same feeding conditions, 521 healthy pigs were randomly selected at 180 days of age, and 10 g of longissimus dorsi muscle samples were collected and stored in liquid nitrogen for frozen preservation.
[0063] Pre-treatment of samples: uniformly sample the sample, accurately weigh 3.0 g into a headspace bottle, add 10 μL of internal standard 2-methyl-3-heptanone solution (containing 2-methyl-3-heptanone at a concentration of 10 ug / mL), tighten the bottle cap, and test. The internal standard 2-methyl-3-heptanone solution is prepared by weighing 1 mg of 2-methyl-3-heptanone (item number: 103128-5g; CAS number: 13019-20-0), adding methanol to make up to 100 mL, and ultrasonicating for 30 min to ensure complete dissolution.
[0064] Instrument equipment: automatic sampler, gas chromatograph, mass spectrometer, olfactometer, headspace solid-phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm × 0.25 µm).
[0065] 2-acetyl-3-methylpyrazine relative content Ca = (Sa / Sis) × (Cis × Vis / m) × 1000.
[0066] In the above formula:
[0067] Ca is the relative content of volatile compound 2-acetyl-3-methylpyrazine in the sample, with units of micrograms per kilogram (μg / kg);
[0068] Sa is the peak area of volatile compound 2-acetyl-3-methylpyrazine in the sample;
[0069] Sis is the peak area of internal standard 2-methyl-3-heptanone in the sample;
[0070] Cis is the concentration of the internal standard 2-methyl-3-heptanone, in micrograms per milliliter (pg / mL);
[0071] Vis is the volume of the internal standard 2-methyl-3-heptanone, in milliliters (mL);
[0072] m is the mass of the sample, in grams (g);
[0073] 1000: coefficient for converting pg / g to pg / kg;
[0074] 2-acetyl-3-methylpyrazine has a retention time of 29.779 ± 0.1 min.
[0075]
[0076]
[0077] II. Detection of SNP molecular markers
[0078] 1. Blood sample collection: Collect the vena wing of the pig to be tested in a heparin sodium anticoagulant blood collection tube, and store at -20°C for standby.
[0079] 2. Whole blood genomic DNA extraction: The specific operation method is carried out according to the instruction manual of the blood genomic DNA extraction kit (Tiangen, DP319).
[0080] 3. Genotyping: Take the genomic DNA of each pig to be tested, and use the Hiseq X-Ten sequencing platform of Illumina Company to perform whole genome individual resequencing, and the sequencing depth of each individual is about 5x, and the specific method is carried out according to the standard operation process provided by Illumina Company. After the data is controlled, the sequence alignment and genotype extraction are carried out by using BWA and GATK two bioinformatics software.
[0081] III. Whole genome association analysis of 2-acetyl-3-methylpyrazine in longissimus dorsi muscle
[0082] The whole genome association analysis of 2-acetyl-3-methylpyrazine and genotype in longissimus dorsi muscle is statistically analyzed by using the compressed mixed linear model of EMMAX software. It is found that a SNP at the 6328556th nucleotide of chromosome 9 is significantly related to the 2-acetyl-3-methylpyrazine trait, so the SNP is named as "Chr9: 6328556th site SNP", that is, the 6328556th nucleotide on chromosome 9 of pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to the 134th nucleotide of nucleotide sequence SEQ ID NO: 1), and the multiple nucleotide species of the SNP are A / G. In order to be simple, it is called specific SNP hereinafter.
[0083] A pair of primers was designed based on the specific SNP, which consisted of F and R. The target sequence of F and R in the pig genomic DNA was 239 bp, and the specific SNP was located at the 134th nucleotide of the target sequence.
[0084] F (SEQ ID NO: 2): 5'- GGACTCCAGACTCGAGCGTA -3';
[0085] R (SEQ ID NO: 3): 5'- CTGGCCCCAAATGAAACCCT -3'.
[0086] It can be seen that the genotype of the pig to be tested can be defined according to the following rules:
[0087] AA genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is A, and does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is G, then the aforementioned SNP genotype of the pig to be tested is AA.
[0088] GG genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is A, and only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is G, then the aforementioned SNP genotype of the pig to be tested is GG.
[0089] AG genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is A, and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 134th nucleotide of SEQ ID NO: 1 is G, then the aforementioned SNP genotype of the pig to be tested is AG.
[0090] Example 2, Application of Specific SNP in Genetic Improvement of 2-Acetyl-3-methylpyrazine Content in Longissimus Dorsi Muscle of Pigs
[0091] Test animals: 493 long white pigs, large white pigs, and three-way pigs from COFCO Jiajiakang (Chifeng) Co., Ltd.
[0092] I. Detection based on genotype of specific SNP site
[0093] 1. Blood sample collection
[0094] The wing vein blood of the test animals was collected in a heparin sodium anticoagulation blood collection tube and stored at -20℃ for standby.
[0095] 2. Extraction of genomic DNA
[0096] The venous blood obtained in step 1 was used to extract genomic DNA.
[0097] 3. Genotype detection
[0098] The genomic DNA obtained in step 2 was used as a template, and PCR amplification was performed using a primer pair composed of F and R, and then the PCR amplification product was sequenced.
[0099] The results showed that 493 test animals all obtained a PCR amplification product with a size of 239 bp.
[0100] According to the genotype definition rules in Example 1, the 493 test animals were divided into three genotypes, AA genotype (237 test animals), AG genotype (205 test animals), and GG genotype (51 test animals).
[0101] II. Determination of 2-acetyl-3-methylpyrazine content in longissimus dorsi muscle
[0102] 2-methyl-3-heptanone: purchased from Sigma-Aldrich, with the item number 103128-5g.
[0103] 10 ug / mL 2-methyl-3-heptanone solution preparation method: weigh 1 mg of 2-methyl-3-heptanone, add methanol to 100 mL, and ultrasonic for 30 min to ensure complete dissolution.
[0104] Feeding under the same feeding conditions until 180 days. 493 healthy pigs were randomly selected, and 10 g of longissimus dorsi muscle samples were collected and stored in liquid nitrogen for frozen preservation.
[0105] Sample pretreatment: uniformly sample the sample, accurately weigh 3.0 g into a headspace bottle, add 10 uL of prepared 10 ug / mL internal standard 2-methyl-3-heptanone solution, tighten the bottle cap, and test.
[0106] Instrument equipment: automatic sampler, gas chromatograph, mass spectrometer, olfactometer, headspace solid-phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm × 0.25 µm).
[0107] The solid phase microextraction conditions and gas chromatography-mass spectrometry conditions are shown in Table 1 and Table 2. The results in Table 3 show that the relative content of 2-acetyl-3-methylpyrazine in the three genotypes of pigs is extremely significantly different (P<0.001). P The relative content of 2-acetyl-3-methylpyrazine in the test pigs with genotype AA is higher than that in the test pigs with genotype AG (P<0.001) and AA (P<0.001). P The relative content of 2-acetyl-3-methylpyrazine in the test pigs with genotype AG is higher than that in the test pigs with genotype GG. P
[0108] Table 4: Genotype and relative content of 2-acetyl-3-methylpyrazine of 493 test pigs
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122] SEQ ID NO: 1
[0123] 5'-GGACTCCAGACTCGAGCGTAATCTCGAGAGTCCATAGTAACTTTGTGATCTTGGTCATGTTACTTCAGTCTCAATTTCACCATTTGTGAAATAGGGATAAAAATACTTACCTCATTGGATTCTTGGGAGGTTTRTATGAGATAATTCATAAAAAGCACTTAAAACAGTGGTTGGGACAAAATAAGAACTCAAATGTTAGCTAGTATTATTTACTCTAGGAGGGTTTCATTTGGGGCCAG-3'.
[0124] The R is A or G.
[0125] The application has been described in detail. Those skilled in the art who are familiar with the principles of the application will be able to implement the application without departing from the spirit and scope thereof, and without unnecessary experiments. Although specific examples have been given, it should be understood that further modifications of the application can be made. In general, the application is intended to include any variations, uses, or improvements of the application that come within the scope of the application disclosed herein, including changes made by those skilled in the art with the knowledge of the conventional techniques in the art.
Claims
1. Application of a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 134th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G. The application is any of the following: A1) Use of the substance in detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine in pig muscle; A2) Use of the substance in pig breeding; A3) Use of the substance in the preparation of a product for detecting or assisting in the detection of 2-acetyl-3-methylpyrazine content in pig muscle.
2. The use according to claim 1, characterized in that The substance is any of the following: C1) a primer combination for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit containing the primer composition described in C1) or the PCR reagent described in C2).
3. The use according to claim 2, characterized in that The primer composition is F1) or F2): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 20 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 220 to 239 of SEQ ID NO: 1 in the sequence listing.
4. A method for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine in pig muscle, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the pig to be tested, and detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine in the pig muscle according to the genotype.
5. A method for pig breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is AA as a parent for breeding, wherein AA is the homozygous type of the SNP site being A.
6. Use of a product containing a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 134th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; the application is the application of the product in pig breeding.
Citation Information
Patent Citations
SNP molecular marker related to intramuscular fat content characters of pigs and application of SNP molecular marker
CN103966209A
Molecular marker related to acetoin content in pig muscle and application of molecular marker
CN119955956A