Application of variation site combination, application of molecular marker combination, primer combination and application thereof, detection product and method for identifying crassostrea gigas, Fujian oyster and hybrid crassostrea gigas and Fujian oyster

Abstract

The invention discloses application of a variation site combination, application of a molecular marker combination, a primer combination and application thereof, a detection product and a method for identifying crassostrea gigas, Fujian oyster and hybrid crassostrea gigas and Fujian oyster, and relates to the technical field of biology. The method comprises the following steps: extracting genome DNA of an individual to be detected; the method comprises the following steps: by taking genome DNA as a template, carrying out multiple PCR amplification by utilizing a primer combination, and sequencing a PCR product; judging the variety of the individual to be detected according to the basic group type of the SNV variation site; the primer combination comprises primer pairs (c1) and (c2): (c1) a primer pair with a nucleotide sequence as shown in SEQ ID NO.1-2 and / or a primer pair with a nucleotide sequence as shown in SEQ ID NO.3-4; and (c2) a primer pair with a nucleotide sequence as shown in SEQ ID NO.5-6. The method can effectively distinguish crassostrea gigas, Fujian oyster and hybrid crassostrea gigas and Fujian oyster.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of a combination of mutation sites, the application of a combination of molecular markers, a primer combination and its application, a detection product, and a method for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters. Background Art

[0002] Crassostrea gigas and Crassostrea angulata are important oyster farming varieties. These two oyster species are closely related species adapted to different environments, with a very high similarity in genomic sequences. They can hybridize and produce fertile offspring. Therefore, many scholars believe that Crassostrea gigas and Crassostrea angulata are two sister subspecies. Since the oysters produced by their hybridization show certain heterosis, especially in terms of high-temperature adaptation, the application of hybrid oysters in the oyster aquaculture industry has gradually increased in recent years. Crassostrea gigas, Crassostrea angulata and hybrid oysters are similar in appearance and it is very difficult to accurately identify them by the naked eye. Accurately distinguishing Crassostrea gigas, Crassostrea angulata, Crassostrea gigas♀×Crassostrea angulata♂ hybrid oysters and Crassostrea angulata♀×Crassostrea gigas♂ hybrid oysters is an urgent need in the fields of genetic breeding, aquaculture, etc. The existing oyster identification technologies mainly target different oyster species and identify species based on the differences in the mitochondrial COXI gene sequences of different oyster species. For example, Crassostrea gigas and Crassostrea rivularis are identified.

[0003] The existing species identification technologies based on oyster genetics or gene information mainly rely on the differences in mitochondrial COXI gene sequences and cannot accurately distinguish Crassostrea gigas, Crassostrea angulata and their hybrid oysters. Since the mitochondrial gene sequences of oysters show maternal inheritance characteristics, it is impossible to distinguish Crassostrea gigas and Crassostrea gigas♀×Crassostrea angulata♂ hybrid oysters (Crassostrea gigas♀×Crassostrea angulata♂ hybrid oysters, that is, hybrid oysters with Crassostrea gigas as the female parent and Crassostrea angulata as the male parent), and it is also impossible to distinguish Crassostrea angulata and Crassostrea angulata♀×Crassostrea gigas♂ hybrid oysters (Crassostrea angulata♀×Crassostrea gigas♂ hybrid oysters, that is, hybrid oysters with Crassostrea angulata as the female parent and Crassostrea gigas as the male parent); at the same time, due to the high similarity of the genomic sequences of Crassostrea gigas and Crassostrea angulata, the existing detection methods based on single-base sequence differences in the mitochondrial COXI sequence have a relatively high detection failure rate when distinguishing purebred Crassostrea gigas and purebred Crassostrea angulata. The maternal inheritance pattern of oyster mitochondria determines that the above-mentioned identification of purebred oysters and hybrid oysters cannot be achieved based on mitochondrial sequences. To determine whether it is a hybrid individual of Crassostrea gigas and Crassostrea angulata, it is necessary to rely on the specific base sequences of the nuclear genomes of Crassostrea gigas and Crassostrea angulata, while the mitochondrial specific base sequences can only be used as evidence for the maternal parent origin of oyster individuals.

[0004] Based on the above, the present invention intends to develop a method for identifying Crassostrea gigas, Crassostrea angulata and hybrid oysters, so as to effectively identify Crassostrea gigas, Crassostrea angulata and hybrid oysters. Summary of the Invention

[0005] The object of the present invention is to provide an application of a combination of mutation sites, an application of a combination of molecular markers, a primer combination and its application, a detection product, and a method for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters, so as to solve the problems existing in the above-mentioned prior art. This method can effectively distinguish purebred Crassostrea gigas, purebred Crassostrea angulata, Changfu hybrid oysters and Fuchang hybrid oysters.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of a combination of mutation sites, and the application is for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters; the combination of mutation sites is determined based on the alignment with the Crassostrea angulata reference genome with the version number GCA_025765675.3;

[0008] The combination of ectopic sites includes the SNV mutation sites described in the following (a1) and (a2):

[0009] (a1) at least one of canscf7:35341023, canscf7:35341084, canscf7:35341419, canscf7:35341500, canscf8:29552247 and canscf8:29552645;

[0010] (a2) at least one of COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621 and COX3:736.

[0011] The present invention also provides an application of a combination of molecular markers, and the application is for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters, and the combination of molecular markers includes the molecular markers described in (b1) and (b2):

[0012] (b1) a molecular marker with a nucleotide sequence as shown in SEQ ID NO.7 and / or SEQ ID NO.8;

[0013] (b2) a molecular marker with a nucleotide sequence as shown in SEQ ID NO.9.

[0014] The present invention also provides a primer combination, including the primer pairs described in (c1) and (c2):

[0015] (c1) a primer pair with a nucleotide sequence as shown in SEQ ID NO.1-2 and / or a primer pair with a nucleotide sequence as shown in SEQ ID NO.3-4;

[0016] The primer pair whose nucleotide sequence is shown in SEQ ID NO.5-6.

[0017] The present invention also provides the application of the above primer combination, and the application is for preparing a detection product for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters.

[0018] Furthermore, the detection product is a kit.

[0019] The present invention also provides a detection product for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters; the detection product includes the above primer combination.

[0020] Furthermore, the detection product is a kit.

[0021] The present invention also provides a method for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters, including the following steps:

[0022] Extract the genomic DNA of the individual to be detected;

[0023] Using the genomic DNA as a template, perform multiplex PCR amplification with the above primer combination, and sequence the PCR product;

[0024] Judge the variety of the individual to be detected according to the base type of the SNV mutation site:

[0025] Identify Crassostrea gigas and Crassostrea angulata according to the SNV mutation site described in the above (a1). When the individual to be detected is a homozygote with the same base type as Crassostrea gigas, it is determined that the individual to be detected is Crassostrea gigas; when the individual to be detected is a homozygote with the same base type as Crassostrea angulata, it is determined that the individual to be detected is Crassostrea angulata.

[0026] When the individual to be detected is a heterozygote carrying both the base types of Crassostrea gigas and Crassostrea angulata, select at least one SNV mutation site from the SNV mutation sites described in the above (a2) to identify the hybrid oysters of Crassostrea gigas♀×Crassostrea angulata♂ and Crassostrea angulata♀×Crassostrea gigas♂. When the individual to be detected is a homozygote with the same base type as Crassostrea gigas, it is determined that the individual to be detected is the hybrid oyster of Crassostrea gigas♀×Crassostrea angulata♂; when the individual to be detected is a homozygote with the same base type as Crassostrea angulata, it is determined that the individual to be detected is the hybrid oyster of Crassostrea angulata♀×Crassostrea gigas♂.

[0027] Furthermore, the reaction system of the multiplex PCR amplification is: 17 μL of ddH2O, 25 μL of 2 × Phanta Max Buffer, 1 μL of dNTP Mix, 2 μL of the upstream primer, 2 μL of the downstream primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 2 μL of the template DNA.

[0028] Furthermore, the reaction program of the multiplex PCR amplification is as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, for 35 cycles; final extension at 72°C for 5 min.

[0029] The present invention discloses the following technical effects:

[0030] The present invention utilizes the species-specific variation sites of the nuclear genome genes and mitochondrial genome genes of Crassostrea gigas and Crassostrea angulata, designs multiplex PCR amplification primers, and analyzes the distribution types of the species-specific variation sites through second-generation sequencing of the multiplex PCR amplification products, achieving the technical effect of effectively distinguishing purebred Crassostrea gigas, purebred Crassostrea angulata, C. gigas × C. angulata hybrids, and C. angulata × C. gigas hybrids, and solving the technical problem of being unable to effectively identify these four types of oysters in the fields of aquaculture and genetic breeding. Specific embodiments

[0031] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be construed as limiting the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0032] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0034] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.

[0035] The terms "comprising", "including", "having", "containing", etc. as used herein are all open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Collect 313 wild Pacific oysters (Crassostrea gigas) from 10 locations along the northern coast of China and 206 wild Fujian oysters (Crassostrea angulata) from 6 locations along the southern coast of China. Use a marine animal genomic DNA extraction kit to extract the genomic DNA of these 519 oysters.

[0038] 2. Use a next-generation sequencing platform to perform whole-genome resequencing on the extracted DNA samples, with the sequencing data volume of each sample not less than 8G. Then, use the bwa software to align the obtained reads to the Fujian oyster reference genome (GenBank accession number: GCA_025765675.3). Subsequently, use the samtools software and gatk software to identify single nucleotide variation (SNV) sites in the whole genome, and use the vcftools software to analyze the allele frequencies of each SNV.

[0039] 3. Identify species-specific SNV variation sites in the Pacific oyster and Fujian oyster. The screening criteria are as follows:

[0040] (1) Biallelic SNV;

[0041] (2) The distribution frequency of the first allele in the Pacific oyster > 97%;

[0042] (3) The distribution frequency of the second allele in the Fujian oyster > 97%.

[0043] 4. Further screen the obtained species-specific SNV variation sites. It is required that within 800bp, there are at least 2 species-specific SNVs, that is, a "specific site group" can be formed.

[0044] 5. Design multiplex PCR primers according to the species-specific SNV and the sequence regions within 500bp upstream and downstream of it. The specific requirements are as follows:

[0045] (1) Design 1 set of primers for each "specific site group";

[0046] (2) The expected size of the PCR amplification product is 600 - 800bp, and the GC content is 35% - 45%;

[0047] (3) The primer sequence does not contain SNVs with a minor allele frequency greater than 0.5%;

[0048] (4) The primer length is 19 - 25 bp, and the primer annealing temperature is 51°C - 53°C;

[0049] (5) Each primer does not contain a sequence that can form an obvious self - "hairpin" structure;

[0050] (6) Each primer does not contain a sequence that can form an obvious "dimer" structure with other primers;

[0051] (7) There is no other sequence with a similarity greater than 60% at other positions in the genome for each primer sequence.

[0052] 6. The above - obtained PCR primers are separately amplified and screened in 30 Pacific oysters (Crassostrea gigas) and 30 Fujian oysters (Crassostrea angulata), and primers that can be amplified in all Pacific oysters and Fujian oysters are selected; then the PCR products are sent to a biological company for second - generation sequencing. The sequencing reads are aligned and SNVs are identified according to the process in step 2, and primers with SNVs meeting the expectations are selected.

[0053] 7. The primers meeting the expectations are subjected to multiplex PCR combined amplification in 30 Pacific oysters and 30 Fujian oysters. PCR parameters such as annealing temperature and cycle number are optimized. The sequencing reads are aligned and SNVs are identified according to the process in step 2, and the optimal primer combination for multiplex PCR is identified. The screening criteria are as follows:

[0054] (1) The PCR multiplicity (i.e., the number of primer pairs) is between 2 and 5;

[0055] (2) At least 2 "specific site groups" can be amplified in the PCR products (i.e., at least 2 sets of PCR primers can be amplified);

[0056] (3) At least 3 species - specific SNVs can be detected.

[0057] 8. Through the above steps 3 - 5, the following 3 groups of "specific site groups" are obtained, specifically as follows:

[0058] (1) There are 4 species - specific variation sites (specific site group 1) in the AChRa gene:

[0059] At the position of canscf7:35341023, the base type of the Pacific oyster is A, and the base type of the Fujian oyster is G;

[0060] At the position of canscf7:35341084, the base type of the Pacific oyster is T, and the base type of the Fujian oyster is C;

[0061] At the position of canscf7:35341419, the base type of the Pacific oyster is G, and that of the Fujian oyster is A;

[0062] At the position of canscf7:35341500, the base type of the Pacific oyster is T, and that of the Fujian oyster is A.

[0063] (2) There are 2 species-specific variation sites (specific site group 2) in the TRHR gene:

[0064] At the position of canscf8:29552247, the base type of the Pacific oyster is T, and that of the Fujian oyster is G;

[0065] At the position of canscf8:29552645, the base type of the Pacific oyster is T, and that of the Fujian oyster is A.

[0066] (3) There are 9 species-specific variation sites (specific site group 3) in the mitochondrial COX3 gene:

[0067] At the position of COX3:351, the base type of the Pacific oyster is A, and that of the Fujian oyster is T;

[0068] At the position of COX3:381, the base type of the Pacific oyster is T, and that of the Fujian oyster is C;

[0069] At the position of COX3:441, the base type of the Pacific oyster is A, and that of the Fujian oyster is G;

[0070] At the position of COX3:465, the base type of the Pacific oyster is C, and that of the Fujian oyster is T;

[0071] At the position of COX3:568, the base type of the Pacific oyster is A, and that of the Fujian oyster is G;

[0072] At the position of COX3:576, the base type of the Pacific oyster is G, and that of the Fujian oyster is A;

[0073] At the position of COX3:609, the base type of the Pacific oyster is T, and that of the Fujian oyster is C;

[0074] At the position of COX3:621, the base type of the Pacific oyster is A, and that of the Fujian oyster is G;

[0075] At the position of COX3:736, the base type of the Pacific oyster is C, and that of the Fujian oyster is G.

[0076] 9. The optimal primer sequences for multiplex PCR amplification of the above 8 specific site groups 1 - 3 are shown in Table 1.

[0077] Table 1 Optimal primer sequences

[0078]

[0079] The reaction system for PCR amplification was as follows: 17 μL of ddH2O, 25 μL of 2 × Phanta Max Buffer, 1 μL of dNTP Mix (10 mM each), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 2 μL of template DNA.

[0080] The reaction program for PCR amplification was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, for 35 cycles; final extension at 72°C for 5 min.

[0081] Using primers F1 and R1 in Table 1, a molecular marker containing specific site group 1 can be amplified:

[0082] CCGACCGAGTTTTTACTCTTTTTAGAA[A / G]GAGCGACACCACTTCTTGAATTTTTCAAAATTCAGGAAAGAAACCACGTGTCTGAGCCAC[T / C]TCGGGACAACTGTGTCCTCGTCTTGGTGATAAACTCTGAGCGTCATGATCGTAATAACACAGGACAGGGCACTCAAAACCAACATCAGCGTCAGAAAGTAGCACAGGAGGGACATGGGCTCGGCAGCCCGCGGTAAGTTCGCAGACACCATAGTCAGAAACACGGCAAAAGTAAGGAAAGCTGTAATCGCGAACCCGACCCTTTCCCCGGAATCCACAGGCAATATAAAAACCATGCCGTTGAGAAGCCCGAGAATTAGAATAGGGATTACGATATTGATAACAAAGTAGCCAGGCCGCCTCTTCATAACGATTGTAAAATGTAAGAAAGACGT[G / A]CTGCTGACGGATTTTGTTTCGATTGTAGAATTGGAAAGTTCCCATTGGACGTTCTCCATGTAATGCGTCAGGTCGATTGA[T / A]TCTTGATTAGACGTCAGGTAAATCTAAAACAAAAATAACCAAATAAGGGAAGAATGTCTTAGTTTTAGTCGTTCGTTTACAAGTATTACCACTCTCAAATGTTCCATACAAACATATACAAACTACTGTTAAGATAAGAAAGATGAAAGGATGCAATTCCTATAAAGCTACATGTAACAACTGATTTAAATGCATCTATGTAATCTAGTAGAATTATTACATGTAAATATACTTCTTGGGTATAT CTCAAAAGTTATTATTGCACAGAA (SEQ ID NO.7), the underlined parts are primer design sites.

[0083] Using primers F2 and R2 in Table 1, a molecular marker containing the above specific site group 2 can be amplified:

[0084] CAGAATGAGATTGCCAGTAGAATGATTGTGAATTCAAGTCGAATGATGCTTTCCTCGGTGATGATTTTACATTCCCGTTTGCGTTTGTTGCGAATAATTAGTCTTCGCATGATTAAAATGTTCAACACCGTGATAATTACGAATGGTACCAGCGTGATGAGAACGGCATAAATACTATCCAAAACAAAAGACGCAAAGTCGTAATCTCTATCTGTCGTACAGTAATGTTTCCCGTCGGTTCCCACGTATATAGCACTGAGTATTGGCTTATAAAGAGCAATCACAATGGAGATTACGAAGATAGACCCCACAATCCGCCGCGTACCACTTTT[T / G]GTGCATATATCCCTCCTCCTTAATGGATGACACACACCGATGTATCTCTCCCCTGTGAATGCCACCACAAGCCAAGCTGAGAGGAATCTGGACACATAGGACATATAAAGCTGAAACTGACATAATCCCTCCACATCAATAAACGTTAACTTTAGGTCAGGTCTGACGTAAACTAGTCCTCGCCTGATCCATTCCACCGTTACGTAGAATATCAACGTCAAAAGATCTGATGTCGACAGGGAGGCTAAGTAGGTGCTGGCAGATATACCACGCATGTTTCTGGATAAGAAGACGTACAGGGATAACAGGTTCCCAAGAAATCCCACCACGAGAATCACGGGGGTAAAGTAAGCGTAAAATATCCGTGCGCTTTTCAGAAACGAAGCTTCTGTCCCGA[T / A]GTCACCAATCCATTCGTTAATACTCGAATTTTGACT GCTGTTTATGGAGTCTTTTCG (SEQ ID NO.8), the underlined part is the primer design site.

[0085] The molecular marker containing the above specific site group 3 can be amplified using primers F3 and R3 in Table 1:

[0086] ATTATGGGTGCAAACTTATGGGGAGTTGCAGCGATGTTCATTTGCTGAGTTAATGAGATTAGGCTTGATAGCTTATATTGAGGTATTCCTCTTTTTGTACTAACTTTTTATAGTTGAGTACGTGACATTATTAATGAAGCAACATTTCAGGGGTTTCATACTGAAAAAGTTCAGTCAGGGCTTACTTTGGGTTTTATTCTGTTCCT[A / T]ATTTCTGAGTTAATATTATTTTTTTCATT[T / C]TTTTGAGCATTTTTCCATAGGGCTTTGTCATCTTCTGTTGAGATTGGGTGCTGCTGACC[A / G]CCAGTCGGGCTAGAGTGTTTAGA[C / T]TGAAGAAAAGTGCCATTACATAATACAGCATTATTAGTAGCATCTTCTGCAAGTATTACTTTAAGACATAACTACCTGCAATGGGGGGACATTTGGGTAGCA[A / G]CAGCAAC[G / A]TATATTGCTACTTTAGGCTTGTCGGTAATATT[T / C]ATTAAGAATCA[A / G]TACGAAGAGTATGCCTGATCTAGGTTTTCTATTTCTGATGGTGTATATGGCAGATGTTTTTTTATGTTAACAGGCCTTCATGGTTTACATGTAATTGGAGGAACTTGTGGTCTT[C / G]TGTTTTGTTTTGTTCGTATAATGCTTTTGCAATTTTCTTCTGAGCATCATGTTGCATTGACTTTGGCTATTTGGTACTGACATTTTGTTGATATTGTATGGCTTGGATTGTTTTTTATTATCTACATCTGAGGCTCTTAGAGTATTGTGCCAGAGTTTTAATGGGCTT TGTTGATGTCAAAGAATACGAG (SEQ ID NO.9); The underlined part is the primer design site.

[0087] 10. Criteria for identifying Crassostrea gigas, Ostrea angulata, Crassostrea gigas×Ostrea angulata hybrids and Ostrea angulata×Crassostrea gigas hybrids:

[0088] Select at least one specific locus from a total of 6 specific loci in specific locus groups 1 and 2 for identifying Crassostrea gigas and Ostrea angulata:

[0089] When the individual to be tested is a homozygote with the same base type as the Pacific oyster, the individual to be tested is identified as the Pacific oyster.

[0090] When the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster.

[0091] When the individual to be tested is a heterozygote carrying both the base types of the Pacific oyster and the Fujian oyster, at least one specific locus is randomly selected from the 9 specific loci of the specific locus group 3 for identifying the Pacific oyster × Fujian oyster hybrid and the Fujian oyster × Pacific oyster hybrid: when the individual to be tested is a homozygote with the same base type as the Pacific oyster, the individual to be tested is identified as the Pacific oyster × Fujian oyster hybrid; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster × Pacific oyster hybrid.

[0092] Example 2

[0093] In addition, the Pacific oyster, the Fujian oyster, the Pacific oyster × Fujian oyster hybrid, and the Fujian oyster × Pacific oyster hybrid were collected, and the specific SNV loci of Example 1 were used for variety identification.

[0094] The genomic DNA of the individual to be tested was extracted; multiplex PCR amplification was performed using the primers designed in Example 1 (the PCR amplification system and amplification program were the same as those in Example 1), the PCR products were sent to a biological company for second-generation sequencing, the sequencing reads were analyzed, and the variety of the oyster was judged according to the base types of the specific SNVs. The results are shown in Table 2 (30 Pacific oysters, 30 Fujian oysters, 30 Pacific oyster × Fujian oyster hybrids, and 30 Fujian oyster × Pacific oyster hybrids were used in each group of experiments). The results showed that the Pacific oyster, the Fujian oyster, the Pacific oyster × Fujian oyster hybrid, and the Fujian oyster × Pacific oyster hybrid could be accurately identified according to the method of the present invention.

[0095] Table 2 Statistical table of the accuracy rate of variety identification based on different specific loci

[0096]

[0097] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a combination of mutation sites, characterized in that, The application is for the identification of Crassostrea gigas, Crassostrea angulata, and their hybrid oysters; The combination of variant sites was determined based on alignment with the Crassostrea angulata reference genome with the version number GCA_025765675.3; The combination of variant sites includes the SNV variant sites described in the following (a1) and (a2): (a1) at least one of canscf7:35341023, canscf7:35341084, canscf7:35341419, canscf7:35341500, canscf8:29552247, and canscf8:29552645; (a2) at least one of COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621, and COX3:

736.

2. Use of a combination of molecular markers, characterized in that, The application is for the identification of Crassostrea gigas, Crassostrea angulata, and their hybrid oysters; The combination of molecular markers includes the molecular markers described in (b1) and (b2): (b1) molecular markers with nucleotide sequences as shown in SEQ ID NO.7 and / or SEQ ID NO.8; (b2) molecular markers with nucleotide sequences as shown in SEQ ID NO.

9.

3. A primer combination, characterized in that, It includes the primer pairs described in (c1) and (c2): (c1) primer pairs with nucleotide sequences as shown in SEQ ID NO.1-2 and / or primer pairs with nucleotide sequences as shown in SEQ ID NO.3-4; (c2) primer pairs with nucleotide sequences as shown in SEQ ID NO.5-6.

4. Use of a primer combination as described in claim 3, characterized in that, The application is for the preparation of a detection product for the identification of Crassostrea gigas, Crassostrea angulata, and their hybrid oysters.

5. The use according to claim 4, characterized in that, The detection product is a kit.

6. A detection product, characterized in that, The detection product is used for the identification of Crassostrea gigas, Crassostrea angulata, and their hybrid oysters; the detection product includes the primer combination described in claim 3.

7. The detection product according to claim 6, characterized in that, The detection product is a kit.

8. A method for identifying Crassostrea gigas, Crassostrea angulata and their hybrid oysters, characterized in that, It includes the following steps: Extract the genomic DNA of the individual to be tested; Using the genomic DNA as a template, perform multiplex PCR amplification with the primer combination described in claim 3, and sequence the PCR product; Judge the variety of the individual to be tested according to the base types of the SNV variant sites: Identify Crassostrea gigas and Crassostrea angulata according to the SNV variant sites described in (a1) of claim 1. When the individual to be tested is a homozygote with the same base type as Crassostrea gigas, the individual to be tested is identified as Crassostrea gigas; when the individual to be tested is a homozygote with the same base type as Crassostrea angulata, the individual to be tested is identified as Crassostrea angulata; When the individual to be tested is a heterozygote carrying both the base types of Crassostrea gigas and Crassostrea angulata, select at least one SNV variant site from the SNV variant sites described in (a2) of claim 1 for the identification of Crassostrea gigas × Crassostrea angulata and Crassostrea angulata × Crassostrea gigas. When the individual to be tested is a homozygote with the same base type as Crassostrea gigas, the individual to be tested is identified as Crassostrea gigas × Crassostrea angulata; when the individual to be tested is a homozygote with the same base type as Crassostrea angulata, the individual to be tested is identified as Crassostrea angulata × Crassostrea gigas.

9. The method according to claim 8, characterized in that, The reaction system for the multiplex PCR amplification is as follows: 17 μL of ddH2O, 25 μL of 2 × Phanta Max Buffer, 1 μL of dNTP Mix, 2 μL of the upstream primer, 2 μL of the downstream primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 2 μL of template DNA.

10. The method according to claim 8, characterized in that, The reaction program for the multiplex PCR amplification is as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, for 35 cycles; final extension at 72°C for 5 min.

Images