SNP (Single Nucleotide Polymorphism) site primer combination for identifying tomato variety authenticity and hybrid seed purity and application of SNP site primer combination

Abstract

The invention belongs to the field of molecular markers and detection thereof, and particularly relates to an SNP (Single Nucleotide Polymorphism) site primer combination for identifying the authenticity of tomato varieties and the purity of hybrids and application of the SNP site primer combination. The three SNP primer combinations provided by the invention can be respectively used for performing early identification on a common tomato variety, a cherry tomato variety and a taste tomato variety in a seed or seedling stage, so that the authenticity of the varieties and the purity of hybrids are ensured, and meanwhile, whether two or more unknown tomato varieties belong to the same variety or not can be identified; and the hybrid purity of the tomato variety to be detected. The rights and interests of producers and breeders can be practically protected, and technical support is provided for protection of tomato germplasm resources and new varieties.

Description

Technical Field

[0001] The present invention belongs to the field of molecular markers and their detection, and particularly relates to a primer combination of SNP loci for identifying the authenticity of tomato varieties and the purity of hybrid seeds and its application. Background Art

[0002] Tomato is an important vegetable crop, with an annual global total output of 170 million tons, ranking first among vegetable crops. In recent years, the tomato seed industry has developed rapidly, the breeding level has been significantly improved, and the proportion of self-bred varieties in production has been steadily increasing. However, with the increasing demand for varieties and seeds, phenomena such as "numerous, chaotic, and miscellaneous", "same species with different names", and "counterfeiting and brand copying" frequently occur in the seed market, seriously affecting the healthy development of the tomato industry. At the same time, as one of the important indicators to measure seed quality, the purity of hybrid seeds has also attracted more and more attention from seed production units and growers. Therefore, establishing a set of tomato variety and seed identification technologies that are efficient, accurate, easy to operate, and not affected by the environment can provide technical support for standardizing variety management and safeguarding the legitimate rights and interests of producers.

[0003] Compared with traditional field morphological identification, molecular marker identification technology has the advantages of short cycle, not being affected by environmental conditions, and enabling high-throughput testing, and is widely used in variety authenticity identification and hybrid seed purity identification. In recent years, with the completion of tomato genome sequencing and the accumulation of re-sequencing data, a large number of variant sites have been mined, providing convenient conditions for the development of molecular markers. SNP (single nucleotide polymorphism) markers, due to their characteristics such as rich quantity, wide distribution, and high stability, have more advantages compared with traditional markers such as RFLP, SSR, and InDel. Kompetitive Allele Specific PCR (KASP) is a fluorescence-based genotyping technology, which has the advantages of high marker conversion success rate, accurate genotyping, low cost, and flexible detection throughput. SNP markers genotyped by this technology are also called KASP markers. Currently, genome-wide KASP markers are widely used in the research of vegetable crops such as cabbage, broccoli, watermelon, pepper, melon, and legumes. In tomato research, most of the reported KASP markers are foreground markers linked to traits, while there are few reports on genome-wide background markers.

[0004] Based on tomato re-sequencing data, this study screened high-quality SNP loci by bioinformatics means, developed KASP markers covering the entire tomato genome, and verified their applicability using tomato varieties from different sources and types, in order to provide a scientific reference for tomato genetic diversity analysis, variety identification, and hybrid seed purity identification. Summary of the Invention

[0005] Modern cultivated tomatoes can be divided into processing tomatoes and fresh - eating tomatoes according to their uses. Processing tomatoes are mainly used for processing various condiments and extracting functional substances; fresh - eating tomatoes can be further divided into ordinary tomatoes, taste tomatoes and cherry tomatoes. Ordinary tomatoes are mainly used for stir - frying or cold dressing; taste tomatoes have medium - sized fruits, rich flavor, sweet and sour taste, and can be eaten directly as fruits; cherry tomatoes are small tomatoes with bright fruit colors and various shapes, which are a specific variety group significantly different from large - fruit fresh - eating tomatoes. Molecular biology research shows that cherry tomatoes are significantly different from large - fruit tomatoes on chromosomes 4, 5 and 12. Therefore, identifying different types of tomatoes can improve the accuracy and effectiveness of identification.

[0006] The tomato varieties "Tainan Xibei", "Taiwan Nongyou FS1698" and "Tainan Hongli No. 2" mentioned in this application refer to those with their origin in Taiwan Province, China, abbreviated as "Tainan Xibei", "Taiwan Nongyou FS1698" and "Tainan Hongli No. 2".

[0007] To solve the above problems, the present invention provides an SNP - site primer combination for identifying the authenticity of tomato varieties and the hybrid purity, and its application.

[0008] The present invention is achieved through the following technical solutions:

[0009] In the first aspect, the present invention provides an SNP - site primer combination for identifying the authenticity of ordinary tomato varieties and the hybrid purity, including the SNP sites and primers shown in the following table:

[0010]

[0011]

[0012] In the second aspect, the present invention provides a method for detecting whether two unknown ordinary tomato varieties to be tested belong to the same variety, including the following steps:

[0013] S1. Extract the genomic DNA of the ordinary tomato samples to be tested;

[0014] S2. Perform PCR amplification on the ordinary tomatoes to be tested using the primers described in the first aspect;

[0015] S3. Result analysis: If the number of different loci between the two ordinary tomato varieties to be tested is 1 or 0, then the two ordinary tomato varieties to be tested are suspected to be or are one ordinary tomato variety; if the number of different loci between the two ordinary tomato varieties to be tested is 2 or more, then the two ordinary tomato varieties to be tested belong to different ordinary tomato varieties.

[0016] In a third aspect, the present invention provides a method for identifying the purity of common tomato hybrids, comprising the following steps:

[0017] DNA extraction step: extracting genomic DNA of N tested hybrids of a tested tomato variety; N is a natural number greater than 12, preferably a natural number greater than or equal to 94;

[0018] Screening of target primer sets: For the purity identification of hybrids of known varieties, firstly, DNA of the parents of the hybrids is used as a template, and three replicates are set for each parental material. The primers described in the first aspect are used for PCR amplification and genotyping, and polymorphic primers with stable typing results between the parents are screened for the purity identification of hybrids; for the purity identification of hybrids of unknown varieties, DNA of 12 F1 hybrid individual plants is used as a template, and the primers described in the first aspect are used for PCR amplification and genotyping, and primers with heterozygous and stable and consistent typing results are screened for the purity identification of hybrids;

[0019] PCR amplification with target primer set: using the genomic DNA of the N common tomato hybrids to be tested as templates, respectively using the target primer set to perform competitive allele-specific PCR amplification reactions to obtain PCR reaction products of the target primer set;

[0020] Purity identification: testing the PCR reaction product of the target primer set, and calculating the purity of the tested common tomato hybrid according to the test result;

[0021] Preferably, in the step of screening the target primer set and the step of detecting purity, the detection method is selected from: fluorescence signal detection, direct sequencing;

[0022] Preferably, in the step of screening the target primer set, for the purity identification of hybrids of known varieties, when fluorescence signal detection is used, the primer set that is statistically shown as a stable and consistent homozygous polymorphism in the parental samples as described in the first aspect is the target primer set; when direct sequencing is used, the primer set that is statistically shown as a stable and consistent homozygous polymorphism in the parental samples as described in the first aspect is the target primer set;

[0023] For the purity identification of hybrids of unknown varieties, when fluorescence signal detection is used, the number of strains of fluorescence signals indicating the color of heterozygotes displayed by the primer set as described in the first aspect is counted; the primer set with the largest number of fluorescent strains indicating the color of heterozygotes is the target primer set; when direct sequencing is used, the number of strains of heterozygous genotypes at the SNP sites as described in the first aspect is counted; the primer set with the largest number of heterozygous strains is the target primer set;

[0024] Preferably, in the purity detection step, the purity of the tomato hybrid to be detected is calculated by:

[0025] When fluorescence signal detection is adopted, 1 to 3 groups of target primer sets are selected for purity calculation. The number of plants showing the color fluorescence indicating heterozygotes and the number of plants without fluorescence in the selected target primer sets are counted, and the purity is calculated respectively, and then the average value is obtained. This average value is the purity of the tomato hybrid to be tested;

[0026] The number of plants without fluorescence = N - the number of plants showing the color fluorescence indicating heterozygotes - the number of plants showing the color fluorescence indicating the first homozygote - the number of plants showing the color fluorescence indicating the second homozygote;

[0027] Purity = [the number of plants showing the color fluorescence indicating heterozygotes in the target primer set / (N - the number of plants without fluorescence in the target primer set)] × 100%;

[0028] When direct sequencing is adopted:

[0029] 1 to 3 groups of target primer sets are selected for purity calculation. The number of plants with heterozygous genotypes and the number of plants without PCR amplification products in the selected target primer sets are counted, and the purity is calculated respectively, and then the average value is obtained. This average value is the purity of the tomato hybrid to be tested;

[0030] Purity = [the number of plants with heterozygous genotypes based on SNP sites in the target primer set / (N - the number of plants without PCR amplification products in the target primer set)] × 100%;

[0031] Preferably, the common tomato hybrid is any one of Huachen 25, Huafeng 56, Huaguan 36, Jing'ao No. 2, Zhongyan 460, Tianfei Eleven, Zhuofen No. 1, Tianbao 326, Tianci 595, Tianci No. 3, Guanqun No. 7, Jili No. 2, Xiwang No. 2, Fankang No. 4, Pujin 901, Fengshou 128, Yibofen-5, Wofen No. 2, Kaideyali 87360, Fendel, Luola, Annecy, Dorothy, Saint Laurent, Rella, Qidali, Ruifei, Dongnuan, Kaili No. 3, Sibide, Antelais, SV4224TH, Audun, SVTH1366, Aoke, Jingfan 101, Jingfan 301, Jingfan 501, Jingfan 404, Jingfan 701, Qiangfeng, Zhongza No. 9, Zhongza 101, Zhongza 301, Zhongza 302, Xilaide No. 1, 7728, Jinpeng No. 8, Qiusheng, Tiansheng No. 1, Tianzhen No. 1, Ruiheng 118, Tianzheng 1567, Ouxiu 806, Zhuoqun No. 3, Daifei 260, Vienna No. 2, Hezuo 903, Wofen 1274, Ningfan 640, Xianke No. 8, Maofen 802, Zheza 506, Zhefen 21066, Yashu 2203, WH405, Jingfan 403, Tieqiu, Steak Tomato, Shengshi No. 2, Huaqin 119, Saixishi No. 5, Boya 82, Kairui 6172, Baoluota, Saintness 4018, Kakuchi, Ruifen, Kaster, Walter, Vienna, Hongmei 4044, Hongmei 3545, Qingling, Nongboshi, Dongfen 108, Ah2011, Ah2012, Nuofen 309, Xiakang, Ladock, Tianxing 1008, Dongfang Chunzao, Fengguan No. 3, Ouguan 400, 22-98 Dahong, Boyan 12, Guanxia 102, Boyan 109, Boyan 201, Beiying and Oubei.

[0032] Fourthly, the present invention provides a primer combination of SNP loci for identifying the authenticity of cherry tomato varieties and the purity of hybrids, including the SNP loci and primers shown in the following table:

[0033]

[0034]

[0035] Fifthly, the present invention provides a method for detecting whether two unknown cherry tomato varieties to be tested belong to the same variety, including the following steps:

[0036] S1. Extract the genomic DNA of the cherry tomato sample to be tested;

[0037] S2. Perform PCR amplification on the cherry tomato to be tested using the primers described in the fourth aspect;

[0038] S3. Result analysis: If the number of different loci between two cherry tomato varieties to be tested is 1 or 0, then these two cherry tomato varieties to be tested are suspected or the same cherry tomato variety; if the number of different loci between two cherry tomato varieties to be tested is 2 or more, then these two cherry tomato varieties to be tested belong to different cherry tomato varieties.

[0039] In the sixth aspect, the present invention provides a method for identifying the purity of a cherry tomato hybrid, comprising the following steps:

[0040] DNA extraction step: Extract the genomic DNA of N plants of the hybrid to be tested of a cherry tomato variety to be tested; N is a natural number greater than 12, preferably a natural number greater than or equal to 94;

[0041] Screening of the target primer set: For the identification of the purity of the hybrid of a known variety, first use the DNA of the hybrid parents as templates, set 3 replicates for each parent material, perform PCR amplification and genotyping using the primers described in the fourth aspect, and screen out polymorphic primers with stable genotyping results between the parents for the identification of the hybrid purity; for the identification of the purity of the hybrid of an unknown variety, use the DNA of 12 single plants of the F1 hybrid as templates, perform PCR amplification and genotyping using the primers described in the fourth aspect, and screen out primers with heterozygous and stable and consistent genotyping results for the identification of the hybrid purity;

[0042] PCR amplification of the target primer set: Using the genomic DNA of the N plants of the cherry tomato hybrid to be tested as templates, perform competitive allele-specific PCR amplification reactions with the target primer set respectively to obtain the PCR reaction products of the target primer set;

[0043] Purity identification: Detect the PCR reaction products of the target primer set, and calculate the purity of the cherry tomato hybrid to be tested according to the detection results;

[0044] Preferably, in the screening step of the target primer set and the purity detection step, the detection method is selected from: fluorescence signal detection, direct sequencing;

[0045] Preferably, in the screening step of the target primer set, for the identification of the purity of the hybrid of a known variety, when using fluorescence signal detection, count the primer sets that show stable and consistent homozygous polymorphism in the parent samples among the primer sets described in the fourth aspect as the target primer set; when using direct sequencing, count the primer sets that show stable and consistent homozygous polymorphism in the parent samples for the genotypes of the SNP loci described in the fourth aspect as the target primer set;

[0046] For the purity identification of hybrids of unknown varieties, when using fluorescence signal detection, count the number of plants with fluorescence signals of the color indicating heterozygotes shown by the primer set described in the fourth aspect; the primer set with the largest number of plants showing fluorescence of the color indicating heterozygotes is the target primer set; when using direct sequencing, count the number of plants with a heterozygous genotype at the SNP locus described in the fourth aspect; the primer set with the largest number of heterozygous plants is the target primer set;

[0047] Preferably, in the purity detection step, the calculation method for the purity of the hybrid cherry tomato to be tested is as follows:

[0048] When using fluorescence signal detection, select 1-3 groups of target primer sets for purity calculation, count the number of plants with fluorescence of the color indicating heterozygotes and the number of plants without fluorescence shown by the selected target primer sets, calculate the purity respectively, and then find the average value, which is the purity of the hybrid cherry tomato to be tested;

[0049] The number of plants without fluorescence = N - the number of plants with fluorescence of the color indicating heterozygotes - the number of plants with fluorescence of the color indicating the first homozygote - the number of plants with fluorescence of the color indicating the second homozygote;

[0050] Purity = [the number of plants with fluorescence of the color indicating heterozygotes shown by the target primer set / (N - the number of plants without fluorescence of the target primer set)] × 100%;

[0051] When using direct sequencing:

[0052] Select 1-3 groups of target primer sets for purity calculation, count the number of plants with a heterozygous genotype and the number of plants without PCR amplification products in the selected target primer sets, calculate the purity respectively, and then find the average value, which is the purity of the hybrid cherry tomato to be tested;

[0053] Purity = [the number of plants with a heterozygous genotype based on the SNP locus of the target primer set / (N - the number of plants without PCR amplification products of the target primer set)] × 100%;

[0054] Preferably, the cherry tomato hybrid is any one of Flame, Kumquat, White Arrow, Beiduofen, Yingfen 208, Yingfen 576, Yellow Agate 101, Xiaguang 1, Golden Beans, Red Beads, Hong Yun, Red Agate 2015, Hongyan, Shuangkang 728, Jingcai 6453, Zixia Fairy, Zibei, Jinyuan 216, Fengerge, Dongyun, Fendan, Jinshuo, Weitechuanhong 1, Qingtian, Yujinxiang 2, Cunmang, Cabernet Sauvignon, Tainan Xibei, Chuachuantian 2, Taiwan Nongyou FS1698, Jili, Israel 9521, Israel Gostina, Shouyan CT181, Weite 1701, Qianxi, Jinxia, Fenbeibei, Busan 88, sapolo, Vitalin, Hongyan, Jingfan Chuanhong 1, Jingfan Huangxing 1, Jingfan Rose Yellow, Yuekeda 102, Yuekeda 105, Ouxiu Huangying, Ouxiu Hongying, Venus, Xiazhixing 17, Zheyingfen 1, Zheyingfen 8, Xinbi, Huangjia No. 1, Bijiao, Lvying Baoyu, New Zealand 1, Jinyang Mizhu, Huangzhuan 1, Ningying 479, Tianzhu 1, Fenbei 2006, Shanghai Hongying 201, Qingxiangmi, Wangfei, Xiangfei 2, Ailong 2, Huaying 746, 2203-117, Wanxi, Orange Sunshine 44, Jinmihuasheng, Cuizhu, Golden Coast, Sweet Star-2, Chuanxiaofanqie 124, Fenle 18, Yingxia, C703, Sweet Pearl, Jingfan Fenxing 2, Jiaoyan 5, Aomei 2, Ningxiang, Fenbeiling 201, Zhenmei, Andeli, Tainan Hongli No. 2 and Qianfen 518.

[0055] In a seventh aspect, the present invention provides a primer combination for SNP loci for identifying the authenticity of a taste tomato variety and the purity of a hybrid, including the SNP loci and primers shown in the following table:

[0056]

[0057]

[0058] In an eighth aspect, the present invention provides a method for detecting whether two unknown taste tomato varieties to be tested belong to the same variety, including the following steps:

[0059] S1. Extract the genomic DNA of the taste tomato sample to be tested;

[0060] S2. Perform PCR amplification on the taste tomato to be tested using the primers described in the seventh aspect;

[0061] S3. Result analysis: If the number of different loci of the two taste tomato varieties to be tested is 1 or 0, then the two taste tomato varieties to be tested are suspected or the same tomato variety; if the number of different loci of the two taste tomato varieties to be tested is 2 or more, then the two taste tomato varieties belong to different tomato varieties.

[0062] In a ninth aspect, the present invention provides a method for identifying the purity of a taste tomato hybrid, including the following steps:

[0063] DNA extraction steps: Genomic DNA of N test crossbreeds of a tomato variety with a taste to be measured is extracted; N is a natural number greater than 12, preferably a natural number greater than or equal to 94;

[0064] Screening of the target primer set: For the purity identification of crossbreeds of known varieties, first, using the DNA of the parental materials of the crossbreeds as templates, with 3 replicates for each parental material, PCR amplification and genotyping are performed using the primers described in the seventh aspect to screen for polymorphic primers with stable genotyping results between the parents for crossbreed purity identification; for the purity identification of crossbreeds of unknown varieties, using the DNA of 12 single plants of F1 crossbreeds as templates, PCR amplification and genotyping are performed using the primers described in the seventh aspect to screen for primers with heterozygous and stable and consistent genotyping results for crossbreed purity identification;

[0065] PCR amplification of the target primer set: Using the genomic DNA of the N test tomato crossbreeds with a taste as templates, competitive allele-specific PCR amplification reactions are respectively performed with the target primer set to obtain the PCR reaction products of the target primer set;

[0066] Purity identification: The PCR reaction products of the target primer set are detected, and the purity of the test tomato crossbreeds with a taste is calculated based on the detection results;

[0067] Preferably, in the screening step of the target primer set and the purity detection step, the detection methods are selected from: fluorescence signal detection, direct sequencing;

[0068] Preferably, in the screening step of the target primer set, for the purity identification of crossbreeds of known varieties, when fluorescence signal detection is used, the primer set that shows stable and consistent homozygous polymorphism in the parental samples as described in the seventh aspect is the target primer set; when direct sequencing is used, the primer set that shows stable and consistent homozygous polymorphism in the parental samples for the genotypes of the SNP sites as described in the seventh aspect is the target primer set;

[0069] For the purity identification of crossbreeds of unknown varieties, when fluorescence signal detection is used, the number of fluorescence signals of the color indicating heterozygotes shown by the primer set as described in the seventh aspect is counted; the primer set with the largest number of fluorescence signals of the color indicating heterozygotes is the target primer set; when direct sequencing is used, the number of plants with heterozygous genotypes at the SNP sites as described in the seventh aspect is counted; the primer set with the largest number of heterozygous genotypes is the target primer set;

[0070] Preferably, in the purity detection step, the calculation method for the purity of the test tomato crossbreeds with a taste is:

[0071] When fluorescence signal detection is adopted, count the number of plants showing the color fluorescence indicating heterozygotes and the number of plants without fluorescence in each of the target primer sets, calculate the purity respectively, and then find the average value, which is the purity of the to-be-detected taste tomato hybrid;

[0072] The number of plants without fluorescence = N - the number of plants showing the color fluorescence indicating heterozygotes - the number of plants showing the color fluorescence indicating the first homozygote - the number of plants showing the color fluorescence indicating the second homozygote;

[0073] Purity = [the number of plants showing the color fluorescence indicating heterozygotes in the target primer set / (N - the number of plants without fluorescence in the target primer set)] × 100%;

[0074] When direct sequencing is adopted:

[0075] Count the number of plants with a heterozygous genotype based on the SNP locus and the number of plants without obtaining PCR amplification products in each target primer set, calculate the purity respectively, and then find the average value, which is the purity of the to-be-detected taste tomato hybrid;

[0076] Purity = [the number of plants with a heterozygous genotype based on the SNP locus in the target primer set / (N - the number of plants without obtaining PCR amplification products in the target primer set)] × 100%;

[0077] Preferably, the taste tomato hybrid is any one of 56FE, Variety No. 2045, Variety No. 4027, Variety No. 4031, Variety No. 20311, Anlida, Xiuqing, Fuxing, Youkang SS28, Jiawen No. 1, Shengfan No. 2, Qingdai Yulang No. 3, Fanyu 2099, Xiantao No. 5, Tiancuicui - 2, Zhewei No. 3, Marumi, Strawberry No. 5, Yuanwei 128, Cuiyu No. 2, Chudai No. 6, Fengtian 126, Strawberry No. 15, Tianmei, Jingfan 309, XX45, Taomengqian, Diana, Xianmei No. 5, Provence, Strawberry No. 2, Beiweimei, Zhewei No. 2, Tiemei No. 6, Zhenyoumei, Fengyun, Hongxiu, Huiwei 99, Fengtian A8, 23G666, Fantailang No. 8, Yashu No. 11, Yuxi, Zhongza 315, Lianji, Hepan No. 1, JPCQ6, Yifanza, Tianzhuo Natie, Gala Fruit, Beishi No. 3, S22022, JSH46, Feini, Guanghui 101, Youyouguo, Boyan 68, Boyan 366, Jingfan H2205, Jingfan H2302, Jingfan H2305, Jingfan 308, Strawberry Tomato, Huangyu, Xiangbalang, Weimeijia, Maidiven, Shatian No. 2 and Tianmimi.

[0078] In the tenth aspect, the present invention provides any of the following applications:

[0079] (1) The application of the SNP locus primer combination described in the first aspect in the preparation of products for identifying or assisting in identifying the authenticity of common tomato varieties;

[0080] (2) Use of the SNP locus primer combination described in the first aspect in the preparation of products for identifying or assisting in identifying the seed purity of common tomato varieties;

[0081] (3) Use of the SNP locus primer combination described in the first aspect in identifying or assisting in identifying the authenticity of common tomato varieties;

[0082] (4) Use of the SNP locus primer combination described in the first aspect in identifying or assisting in identifying the seed purity of common tomato varieties;

[0083] (5) Use of the SNP locus primer combination described in the first aspect in tomato breeding;

[0084] (6) Use of the method described in the second aspect or the third aspect in identifying or assisting in identifying the authenticity of common tomato varieties;

[0085] (7) Use of the method described in the second aspect or the third aspect in identifying or assisting in identifying the seed purity of common tomato varieties;

[0086] (8) Use of the method described in the second aspect or the third aspect in tomato breeding;

[0087] (9) Use of the SNP locus primer combination described in the fourth aspect in the preparation of products for identifying or assisting in identifying the authenticity of cherry tomato varieties;

[0088] (10) Use of the SNP locus primer combination described in the fourth aspect in the preparation of products for identifying or assisting in identifying the seed purity of cherry tomato varieties;

[0089] (11) Use of the SNP locus primer combination described in the fourth aspect in identifying or assisting in identifying the authenticity of cherry tomato varieties;

[0090] (12) Use of the SNP locus primer combination described in the fourth aspect in identifying or assisting in identifying the seed purity of cherry tomato varieties;

[0091] (13) Use of the SNP locus primer combination described in the fourth aspect in tomato breeding;

[0092] (14) Use of the method described in the fifth aspect or the sixth aspect in identifying or assisting in identifying the authenticity of cherry tomato varieties;

[0093] (15) Use of the method described in the fifth aspect or the sixth aspect in identifying or assisting in identifying the seed purity of cherry tomato varieties;

[0094] (16) Use of the method described in the fifth aspect or the sixth aspect in tomato breeding;

[0095] (17) Use of the SNP locus primer combination described in the seventh aspect in the preparation of products for identifying or assisting in identifying the authenticity of taste tomato varieties;

[0096] (18) Use of the SNP site primer combination described in the seventh aspect in the preparation of a product for identifying or assisting in identifying the purity of tomato variety seeds;

[0097] (19) Use of the SNP site primer combination described in the seventh aspect in identifying or assisting in identifying the authenticity of a tomato variety;

[0098] (20) Use of the SNP site primer combination described in the seventh aspect in identifying or assisting in identifying the seed purity of a tomato variety with good taste;

[0099] (21) Application of the SNP site primer combination described in the seventh aspect in tomato breeding;

[0100] (22) Application of the method of the eighth aspect or the ninth aspect in identifying or assisting in identifying the authenticity of a tomato variety by taste;

[0101] (23) Application of the method of the eighth aspect or the ninth aspect in identifying or assisting in identifying the purity of seeds of tomato varieties having good taste;

[0102] (24) Application of the method described in the eighth aspect or the ninth aspect in tomato breeding.

[0103] The beneficial effects of the technical solution of the present invention are mainly reflected in:

[0104] (1) The SNP primer combination provided in the first aspect of the present invention can be used for early identification of common tomato varieties at the seed or seedling stage to ensure the authenticity of the common varieties and the purity of the hybrids. At the same time, it can also be used to identify whether two or more unknown common tomato varieties belong to the same variety, and the purity of the hybrids of the common tomato varieties to be tested. This method can identify both unknown common tomato varieties and known varieties. It effectively protects the rights and interests of producers and breeders, and provides technical support for the protection of common tomato germplasm resources and new varieties.

[0105] (2) The SNP primer combination described in the fourth aspect of the present invention can be used to identify cherry tomato varieties at an early stage in the seed or seedling stage to ensure the authenticity of the cherry varieties and the purity of the hybrids. At the same time, it can also be used to identify whether two or more unknown cherry tomato varieties belong to the same variety, and the purity of the hybrids of the cherry tomato varieties to be tested. This method can identify both unknown cherry tomato varieties and the authenticity of known varieties. It effectively protects the rights and interests of producers and breeders, and provides technical support for the protection of cherry tomato germplasm resources and new varieties.

[0106] (3) The SNP primer combination provided in the seventh aspect of the present invention can be used for early identification of taste tomato varieties at the seed or seedling stage, ensuring the authenticity of taste varieties and the purity of hybrid seeds. At the same time, it can also identify whether two or more unknown taste tomato varieties belong to the same variety, as well as the hybrid purity of the tested taste tomato variety. This method can be used to identify both unknown and known taste tomato varieties, effectively protecting the rights and interests of producers and breeders, and providing technical support for the protection of taste tomato germplasm resources and new varieties.

[0107] (4) The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, saving manpower and material resources, etc., and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0108] The accompanying drawings forming a part of this specification are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention.

[0109] Figure 1 It shows the SNP genotyping results of 48 primer sets in 112 tested common tomato varieties in Example 1 of the present invention;

[0110] Figure 2 It is the clustering diagram of 112 tested common tomato varieties based on 48 primer sets in Example 1 of the present invention;

[0111] Figure 3 It shows the genotyping results of using primer 2-7 to identify the seed purity of 94 plants of the common tomato variety "Hongmei 3545" in Example 1 of the present invention; among them, the points close to the Y-axis (male parent) and the points close to the X-axis (female parent) represent two different homozygous genotypes. The points on the diagonal of the coordinate axis represent heterozygous genotypes, that is, F1 hybrids;

[0112] Figure 4 It shows the SNP genotyping results of 36 primer sets in 90 tested cherry tomato varieties in Example 2 of the present invention;

[0113] Figure 5 It is the clustering diagram of 90 tested cherry tomato varieties based on 36 primer sets in Example 2 of the present invention;

[0114] Figure 6 It shows the genotyping results of using primer 6-2 to identify the seed purity of 94 plants of the cherry tomato variety "Xiaguang" in Example 2 of the present invention; among them, the points close to the Y-axis (male parent) and the points close to the X-axis (female parent) represent two different homozygous genotypes. The points on the diagonal of the coordinate axis represent heterozygous genotypes, that is, F1 hybrids;

[0115] Figure 7The SNP genotyping results of 32 primer sets in some tested taste tomato varieties in Example 3 of the present invention;

[0116] Figure 8 The clustering diagram of 70 tested taste tomato varieties based on 32 primer sets in Example 3 of the present invention;

[0117] Figure 9 The genotyping results of using primer 7-2 to identify the seed purity of 94 plants of the taste tomato variety "Pin Fan 4031" in Example 3 of the present invention. Among them, the points close to the Y-axis (male parent) and the points close to the X-axis (female parent) represent two different homozygous genotypes. The points on the diagonal of the coordinate axis represent heterozygous genotypes, that is, F1 hybrids. Detailed implementation manners

[0118] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0119] For those not specifying specific experimental steps or conditions in the examples, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. The raw materials or instruments used are all conventional products that can be obtained through commercial purchase, including but not limited to the raw materials or instruments used in the examples of the present application.

[0120] In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. If the experimental methods without specifying specific conditions in the following detailed implementation manners, they are usually carried out according to the conventional methods and conditions of molecular biology in this field, and such techniques and conditions are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., "Molecular Cloning: A Laboratory Manual", or according to the conditions recommended by the manufacturer.

[0121] Example 1: Obtaining of SNP primer combinations for identifying the authenticity of common tomato varieties and the purity of hybrids

[0122] 1. Obtaining and screening of SNP loci

[0123] The present invention is based on the re-sequencing data of 120 tomato varieties, covering fresh tomato, common tomato and cherry tomato, basically including the main ecological types and agronomic traits of existing tomatoes in the market, reflecting the germplasm representativeness as much as possible and having high genetic diversity.

[0124] Specifically, the screening criteria for SNP loci are as follows: (1) Minor allele frequency (MAF) > 0.1; (2) Polymorphism information content (PIC) > 0.3; (3) Uniform distribution on chromosomes; (4) No other variations within 100 bp before and after the locus.

[0125] 2. Obtaining preferred SNP primer combinations

[0126] For each chromosome, 10 - 12 high-quality SNP loci are preferentially selected for primer design, and a total of 140 SNP primer combinations are designed for the whole genome. Each primer group consists of 3 primer sequences and is used to amplify one SNP locus.

[0127] 3. Obtaining genomic DNA of the tested common tomato varieties

[0128] The genomic DNA of the leaves (true leaves mixed from 5 seeds) of 112 tested common tomato varieties is extracted respectively by the CTAB method to obtain the genomic DNA of the tested tomato varieties. The basic information of the 112 tested common tomato varieties in this example is shown in Table 1. The 112 tested tomato varieties are all common excellent varieties or some introduced varieties.

[0129] Table 1 Information of 112 tested tomato varieties

[0130]

[0131]

[0132] 4. Validation and screening of SNP primer combinations

[0133] Using the genomic DNA of 112 tested tomato varieties as templates respectively, PCR amplification is carried out on them using 140 SNP primer groups respectively, and the typing results are statistically analyzed. According to the principles that the marker PIC value > 0.40, the markers are relatively evenly distributed on each chromosome and there is no linkage, etc., SNP core primer groups suitable for authenticity identification and hybrid purity identification of common tomato varieties are screened. Finally, 48 SNP primer groups are obtained, and their information is shown in Table 2. Among them, the previous number in the primer name represents the chromosome number, and the following number represents the primer number on that chromosome. The 5' end of the forward primer F1 needs to add the FAM fluorescent label sequence GAAGGTGACCAAGTTCATGCT, and the 5' end of the forward primer F2 needs to add the HEX fluorescent label sequence GAAGGTCGGAGTCAACGGATT. The position of the SNP locus on the chromosome is determined based on the alignment with the tomato reference genome SL4.0 sequence (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome).

[0134] Table 2 Information of 48 SNP primer sets for identifying the authenticity of common tomato varieties and the purity of hybrids

[0135]

[0136]

[0137]

[0138]

[0139] 5. Cluster analysis

[0140] As Figure 1 shown, the fluorescence signals of the PCR amplification products of 48 SNP loci in 112 tested common tomato varieties clearly presented in three forms: 1) Samples aggregated near the X-axis showed orange, and the genotype was the allele type linked to the FAM fluorescent tag sequence; 2) Samples aggregated near the Y-axis showed blue, and the genotype was the allele type linked to the HEX fluorescent tag sequence; 3) Samples located on the diagonal of the X-axis and Y-axis showed green, and the genotype was the heterozygous type of two alleles. Thus, it can be seen that the tested common tomato varieties can achieve good genotyping results with 48 SNP primer sets.

[0141] Based on the genotyping results of 112 tested tomato varieties at 48 SNP loci, the 112 tested tomato varieties were subjected to cluster analysis using NTSYS-pc 2.11 software.

[0142] The cluster diagram of 112 tested tomato varieties based on 48 SNP primer sets is as Figure 2 shown. The results showed that 48 SNP primer sets could completely distinguish the 112 tested tomato varieties in Table 1. Thus, it can be seen that the 48 SNP primer combinations developed in Example 1 can be applied to the construction of the DNA fingerprint database of common tomato varieties and the identification of variety authenticity.

[0143] Experimental Example 1

[0144] I. Application of the KASP marker primer set of Example 1 in detecting the authenticity of common tomato varieties (i.e., the method for detecting whether two unknown tested common tomato varieties belong to the same variety), the specific operation is as follows:

[0145] 1. Extract the genomic DNA of the tested tomato samples

[0146] The genomic DNA of the tested samples was extracted by the CTAB method. DNA quality detection and concentration determination were carried out using NanoDrop, and the DNA concentration was adjusted to 30 - 50 ng / μL for standby.

[0147] Perform PCR amplification on the test samples using the 48 SNP primer sets obtained by screening in Example 1, and set three replicates for each test sample.

[0148] 2. Configuration of the PCR reaction system and setting of the reaction program

[0149] The PCR amplification system is as follows: The reaction system is 10 μL, including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0150] PCR amplification program: Pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing at 65 °C - 57 °C for 60 s, a total of 10 TouchDown cycles (the temperature drops by 0.8 °C in each cycle); in the second round of PCR reaction, denaturation at 94 °C for 20 s, annealing and extension at 57 °C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0151] It should be noted that if the fluorescence signal is weak after PCR amplification, affecting data analysis, cycles can be added (denaturation at 94 °C for 20 s, renaturation and extension at 55 °C for 1 min, 5 cycles) until the result is satisfactory.

[0152] 3. Result analysis

[0153] If the number of different loci between two test tomato varieties is 1 or 0, then these two test tomato varieties are suspected or the same tomato variety. If the number of different loci between two test tomato varieties is 2 or more, then these two test tomato varieties belong to different tomato varieties; the more the number of different loci, the farther the genetic relationship.

[0154] II. Application of the KASP marker primer set in Example 1 in detecting the purity of common tomato varieties

[0155] This example scheme is a method for identifying the purity of common tomato hybrids with known parents, and the specific operation is as follows:

[0156] 1. Samples: Select 100 - 200 tomato seeds from the seeds of the submitted common tomato variety "Hongmei 3545" for cultivation to obtain no less than 94 tomato individual plants, together with the plants of the male and female parents of this variety (the male and female parents are used as control samples), a total of 96 samples are obtained.

[0157] 2. Extract the genomic DNA of the above-mentioned common tomato test samples using the 96 - deep well plate rapid extraction method, and the specific operation is as follows:

[0158] (1) When the tomato grows to two leaves and one heart, take 1 true leaf and place it in a 96-well deep plate, and add 1 stainless steel bead;

[0159] (2) Use a multi-channel pipette to add 500 μL of extraction solution (formula: 12.1 g Tris, 28.1 g NaCl, 18.6 g EDTA, volume made up to 1 L) to each well. After covering with a silica gel pad, use an automatic grinder to grind for 2 min, and then place it in a centrifuge and centrifuge at 4000 rpm for 15 minutes to separate the tissue from the extraction solution;

[0160] (3) Pipette 200 μL of the supernatant into a new 96-well deep plate, add 2 volumes of ice ethanol for precipitation, place it at -20 °C for 30 minutes, centrifuge at 4000 rpm for 15 minutes, discard the supernatant, add 500 μL of 75% ethanol to wash and pour out the ethanol. After drying, add 100 μL of ddH2O to dissolve;

[0161] (4) Finally, dilute the DNA concentration uniformly by 5 times for standby.

[0162] 3. PCR amplification

[0163] The PCR amplification system is as follows: The reaction system is 10 μL: including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0164] The PCR amplification program: Pre-denaturation at 94 °C for 15 min; Denaturation at 94 °C for 20 s, annealing at 65 °C - 57 °C for 60 s, a total of 10 TouchDown cycles (the temperature drops by 0.8 °C in each cycle); In the second round of PCR reaction, denaturation at 94 °C for 20 s, annealing and extension at 57 °C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0165] 4. Screening of identification markers

[0166] First, use the DNA of the parents of the common tomato variety "Hongmei 3545" as the template. Set 3 replicates for each parental material. Use 48 SNP primer sets and divide them into 3 batches (or 3 groups) according to the arrangement order in Table 2 for PCR amplification experiments. Randomly select the primer sets in the first batch for PCR amplification and genotyping, and screen the polymorphic markers with stable genotyping results between the parents for hybrid purity identification. Among the primer sets in the first batch, the genotyping results of primers 2 - 7 are stable and polymorphic, and can be used for subsequent experiments.

[0167] It should be noted that, in combination with the actual experimental process in this embodiment, to save the identification time and reagent cost, for other batches of primers as alternatives, the screening process can be stopped after screening out polymorphic markers with stable genotyping results.

[0168] 5. Identification of Hybrid Seed Purity

[0169] Select 2-7 pairs of primers screened in "Step 4" to perform PCR amplification and genotyping on the DNA of F1 hybrid seeds, and statistically analyze the results. The points on the diagonal of the coordinate axis represent heterozygous genotypes, which are the true F1 hybrid seeds.

[0170] The purity calculation method is as follows: The number of non-fluorescent plants = N - the number of plants showing the color fluorescence indicating heterozygotes - the number of plants showing the color fluorescence indicating the first homozygote - the number of plants showing the color fluorescence indicating the second homozygote;

[0171] Purity = [the number of plants showing the color fluorescence indicating heterozygotes in the target primer group / (N - the number of non-fluorescent plants in the target primer group)] × 100%;

[0172] Among them, in this example, the number of non-fluorescent plants is 0, the number of plants showing the color fluorescence indicating heterozygotes in the target primer group is 94, N is 94, and the measured purity is 100%.

[0173] The genotyping detection results are as Figure 3 shown. All F1 showed heterozygous types, indicating that the seed purity was 100%. When further performing field identification, all F1 single plants showed traits different from those of the parents and were stable and consistent, which was consistent with the molecular marker identification results. This shows that the purity identification method based on the above-screened primer group for KASP markers has high accuracy and can be used for the efficient detection of the purity of tomato hybrid seeds.

[0174] It should be noted that the present invention is only applicable to the purity identification of first-generation hybrid seeds with only parental mixing, and is not applicable to the identification of the mixing of several varieties caused by mechanical mixing.

[0175] Example 2: Obtaining SNP Primer Combinations for Identifying the Authenticity of Cherry Tomato Varieties and the Purity of Hybrid Seeds

[0176] 1. Obtaining and Screening of SNP Loci

[0177] Based on the re-sequencing data of 120 tomato samples in the present invention, covering fresh tomatoes, cherry tomatoes, and cherry tomatoes, it basically includes the main ecological types and agronomic traits of existing tomatoes on the market, reflects the germplasm representativeness as much as possible, and has high genetic diversity.

[0178] Specifically, the screening criteria for SNP sites are as follows: (1) Minor allele frequency (MAF) > 0.1; (2) Polymorphism information content (PIC) > 0.3; (3) Uniform distribution in the chromosome; (4) No other variations within 100 bp before and after the site.

[0179] 2. Obtaining the preferred SNP primer combinations

[0180] For each chromosome, 10 - 12 high-quality SNP sites are preferentially selected for primer design, and a total of 140 SNP primer combinations are designed for the whole genome. Each primer group consists of 3 primer sequences and is used to amplify one SNP site.

[0181] 3. Obtaining the genomic DNA of the tested cherry tomato varieties

[0182] The genomic DNA of the leaves (true leaves mixed from 5 seeds) of 90 tested cherry tomato varieties is extracted respectively by the CTAB method to obtain the genomic DNA of the tested tomato varieties. The basic information of the 90 tested cherry tomato varieties in this example is shown in Table 3. The 90 tested tomato varieties are all common excellent varieties or some introduced varieties.

[0183] Table 3 Information of 90 tested cherry tomato varieties

[0184]

[0185]

[0186] 4. Validation and screening of the SNP primer combinations

[0187] Using the genomic DNA of 90 tested tomato varieties as templates respectively, 140 SNP primer groups are used for PCR amplification respectively, and the typing results are statistically analyzed. According to the principles that the marker PIC value > 0.33, the markers are relatively evenly distributed on each chromosome and there is no linkage, etc., the SNP core primer groups suitable for the authenticity identification and hybrid purity identification of cherry tomato varieties are screened. Finally, 36 SNP primer groups are obtained, and their information is shown in Table 4. Among them, the number in front of the primer name represents the chromosome number, and the number behind represents the primer number on that chromosome. The 5' end of the forward primer F1 needs to add the FAM fluorescent label sequence GAAGGTGACCAAGTTCATGCT, and the 5' end of the forward primer F2 needs to add the HEX fluorescent label sequence GAAGGTCGGAGTCAACGGATT. The position of the SNP site on the chromosome is determined based on the alignment with the tomato reference genome SL4.0 sequence (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome).

[0188] Table 4 Information of 36 SNP primer sets for identifying the purity of cherry tomato varieties and hybrids

[0189]

[0190]

[0191]

[0192] 5. Cluster analysis

[0193] As Figure 3 shown, the fluorescence signals of the PCR amplification products of 36 SNP loci in 90 tested cherry tomato hybrids clearly presented in three forms: 1) Samples aggregated near the X-axis showed orange, and the genotype was the allele type linked to the FAM fluorescent tag sequence; 2) Samples aggregated near the Y-axis showed blue, and the genotype was the allele type linked to the HEX fluorescent tag sequence; 3) Samples located on the diagonal of the X-axis and Y-axis showed green, and the genotype was the heterozygous type of two alleles. Thus, it can be seen that the tested cherry tomato varieties can achieve good genotyping results with 36 SNP primer sets.

[0194] Based on the genotyping results of 90 tested tomato varieties at 36 SNP loci, the 90 tested tomato varieties were subjected to cluster analysis using NTSYS-pc2.11 software. The cluster diagram of 90 tested cherry tomato varieties based on 36 SNP primer sets is as Figure 5 shown. The results showed that 36 SNP primer sets could completely distinguish the 90 tested cherry tomato varieties in Table 3. Thus, it can be seen that the 36 SNP primer combinations developed in Example 2 can be applied to the construction of the DNA fingerprint database of cherry tomato varieties and the identification of variety authenticity.

[0195] Experimental Example 2

[0196] I. Application of the KASP marker primer set in Example 2 in detecting the authenticity of cherry tomato varieties (i.e., a method for detecting whether two unknown cherry tomato varieties to be tested belong to the same variety), and the specific operation is as follows:

[0197] 1. Extract the total DNA of the tomato sample to be tested

[0198] The genomic DNA of the sample to be tested was extracted by the CTAB method. The ratio of A260 / A280 was detected to be about 1.8 using a UV spectrophotometer Nanodrop2000 (Thermo), and the ratio of A260 / A230 was greater than 1.8; the concentration of the genomic DNA of the tested tomato varieties was adjusted to 40 - 50 ng / μL.

[0199] Perform PCR amplification on the test samples using the 36 SNP primer sets obtained by screening in Example 1, and set three replicates for each test sample.

[0200] 2. Configuration of the PCR reaction system and setting of the reaction program

[0201] The PCR amplification system is as follows: The reaction system is 10 μL: including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0202] PCR amplification program: Pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing at 65 °C - 57 °C for 60 s, a total of 10 TouchDown cycles (the temperature drops by 0.8 °C in each cycle); in the second round of PCR reaction, denaturation at 94 °C for 20 s, annealing and extension at 57 °C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0203] It should be noted that if the fluorescence signal is weak after PCR amplification and affects data analysis, cycles can be added (denaturation at 94 °C for 20 s, renaturation and extension at 55 °C for 1 min, 5 cycles) until the result is satisfactory.

[0204] 3. Result analysis

[0205] If the number of different loci between two test tomato varieties is 1 or 0, then these two test tomato varieties are suspected or the same tomato variety. If the number of different loci between two test tomato varieties is 2 or more, then these two test tomato varieties belong to different tomato varieties; the more the number of different loci, the farther the genetic relationship.

[0206] II. Application of the KASP marker primer set in Example 2 in detecting the purity of cherry tomato varieties

[0207] This example scheme is a method for identifying the purity of a known-parent cherry tomato hybrid, and the specific operation is as follows:

[0208] 1. Samples: Select 100 - 200 tomato seeds from the seeds of the cherry tomato variety "Xiaguang" submitted for inspection for cultivation to obtain no less than 94 tomato single plants, together with the plants of the male and female parents of this variety (the male and female parents are used as control samples), a total of 96 samples are obtained.

[0209] 2. Extract the genomic DNA of the above-mentioned cherry tomato test samples using the 96-deep-well plate rapid extraction method

[0210] (1) When the tomato grows to two leaves and one heart, take 1 true leaf and place it in a 96-deep-well plate, and add 1 stainless steel bead;

[0211] (2) Add 500 μL of extraction solution (formula: 12.1 g Tris, 28.1 g NaCl, 18.6 g EDTA, made up to 1 L) to each well using a multi-channel pipette. After covering with a silica gel pad, grind for 2 min using an automatic grinder, and then centrifuge at 4000 rpm for 15 minutes in a centrifuge to separate the tissue and the extraction solution;

[0212] (3) Pipette 200 μL of the supernatant into a new 96-well deep plate, add 2 volumes of ice-cold ethanol for precipitation, place at -20 °C for 30 minutes, centrifuge at 4000 rpm for 15 minutes, discard the supernatant, add 500 μL of 75% ethanol for washing and then pour out the ethanol. After drying, add 100 μL of ddH2O to dissolve;

[0213] (4) Finally, dilute the DNA concentration uniformly by 5 times for standby.

[0214] 3. PCR Amplification

[0215] The PCR amplification system is as follows: The reaction system is 10 μL: including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0216] The PCR amplification program: Pre-denaturation at 94 °C for 15 min; Denaturation at 94 °C for 20 s, annealing at 65 °C - 57 °C for 60 s, a total of 10 TouchDown cycles (the temperature drops by 0.8 °C in each cycle); In the second round of PCR reaction, denaturation at 94 °C for 20 s, annealing and extension at 57 °C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0217] 4. Screening of Identification Markers

[0218] First, use the DNA of the parental materials of the cherry tomato variety "Xiaguang" as templates. Set 3 replicates for each parental material. Divide the 36 SNP primer sets into 3 batches (or 3 groups) according to the arrangement order in Table 4. Randomly select the primer sets in the second batch for PCR amplification and genotyping, and screen for polymorphic markers with stable genotyping results between the parents for hybrid seed purity identification. Among the primer sets in the second batch, the genotyping result of primer 6-2 is stable and polymorphic, which can be used for subsequent experiments.

[0219] It should be noted that in this example, combined with the actual experimental process, to save the identification time and reagent cost, the primers in other batches can be used as alternatives and the continuous screening process can be stopped after screening out the polymorphic markers with stable genotyping results.

[0220] 5. Hybrid Seed Purity Identification

[0221] Select the primer 6-2 screened in "Step 4" to perform PCR amplification and genotyping on the DNA of the F1 hybrid, and statistically analyze the results. The points located on the diagonal of the coordinate axis represent the heterozygous genotype and are the true F1 hybrids.

[0222] The purity calculation method is as follows: The number of non-fluorescent plants = N - the number of plants showing the color fluorescence indicating heterozygotes - the number of plants showing the color fluorescence indicating the first homozygote - the number of plants showing the color fluorescence indicating the second homozygote;

[0223] Purity = [the number of plants showing the color fluorescence indicating heterozygotes in the target primer group / (N - the number of non-fluorescent plants in the target primer group)] × 100%;

[0224] Among them, in this example, the number of non-fluorescent plants is 0, the number of plants showing the color fluorescence indicating heterozygotes in the target primer group is 94, N is 94, and the measured purity is 100%.

[0225] The genotyping detection results are as Figure 6 shown. All F1s showed a heterozygous type, indicating that the seed purity was 100%. When further performing field identification, all F1 individual plants showed traits different from those of the parents and were stable and consistent, which was consistent with the molecular marker identification results. This shows that the purity identification method based on the above-screened primer group for KASP markers has high accuracy and can be used for the efficient detection of the purity of cherry tomato hybrids.

[0226] It should be noted that the present invention is only applicable to the purity identification of the first-generation hybrid seeds with only parental admixture, and is not applicable to the identification of the admixture of several varieties caused by mechanical admixture.

[0227] Example 3: Obtaining of SNP primer combinations for identifying the authenticity of taste tomato varieties and the purity of hybrids

[0228] 1. Obtaining and screening of SNP loci

[0229] The present invention is based on the re-sequencing data of 120 tomato varieties, covering fresh-eating tomatoes, taste tomatoes and cherry tomatoes, basically including the main ecological types and agronomic traits of the existing tomatoes in the market, reflecting the germplasm representativeness as much as possible, and having high genetic diversity.

[0230] Specifically, the screening criteria for SNP loci are as follows: (1) Minor allele frequency (MAF) > 0.1; (2) Polymorphism information content (PIC) > 0.3; (3) Uniform distribution in the chromosome; (4) No other variations within 100 bp before and after the locus.

[0231] 2. Obtaining of preferred SNP primer combinations

[0232] For each chromosome, 10 - 12 high-quality SNP loci were preferentially designed, and a total of 140 SNP primer combinations were designed for the whole genome. Each primer group consists of 3 primer sequences and is used to amplify one SNP locus.

[0233] 3. Obtaining genomic DNA of the tested tomato varieties with good taste

[0234] The genomic DNA of the leaves (true leaves of 5 mixed seeds) of 70 tested tomato varieties with good taste was extracted respectively by the CTAB method to obtain the genomic DNA of the tested tomato varieties. The basic information of the 70 tested tomato varieties in this example is shown in Table 5. The 70 tested tomato varieties are all common excellent varieties or some introduced varieties.

[0235] Table 5 Information of the tested tomato varieties

[0236]

[0237]

[0238] 4. Validation and screening of the effectiveness of SNP primer combinations

[0239] Using the genomic DNA of 70 tested tomato varieties as templates respectively, PCR amplification was carried out with 140 SNP primer groups respectively, and the genotyping results were statistically analyzed. According to the principles that the marker PIC value > 0.40, the markers are relatively evenly distributed on each chromosome and there is no linkage, etc., SNP core primer groups suitable for the authenticity identification of tomato varieties with good taste and the purity identification of hybrid seeds were screened. Finally, 32 SNP primer groups were obtained, and their information is shown in Table 6. Among them, the number in front of the primer name represents the chromosome number, and the number behind represents the primer number on that chromosome. The FAM fluorescent label sequence GAAGGTGACCAAGTTCATGCT needs to be added to the 5' end of the forward primer F1, and the HEX fluorescent label sequence GAAGGTCGGAGTCAACGGATT needs to be added to the 5' end of the forward primer F2. The position of the SNP locus on the chromosome is determined based on the alignment with the tomato reference genome SL4.0 sequence (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome).

[0240] Table 6 Information of 32 SNP primer groups for identifying tomato varieties with good taste and the purity of hybrid seeds

[0241]

[0242]

[0243]

[0244] 5. Cluster Analysis

[0245] As Figure 7 shown, the fluorescence signals of the PCR amplification products of 32 SNP loci in 70 tested taste tomato hybrids clearly presented in three forms: 1) Samples aggregated near the X-axis showed orange, and the genotype was the allele type linked to the FAM fluorescent tag sequence; 2) Samples aggregated near the Y-axis showed blue, and the genotype was the allele type linked to the HEX fluorescent tag sequence; 3) Samples located on the diagonal of the X-axis and Y-axis showed green, and the genotype was the heterozygous type of two alleles. Thus, it can be seen that the 32 SNP primer sets can achieve good genotyping effects in the tested taste tomato hybrids.

[0246] Based on the genotyping results of 70 tested tomato varieties at 32 SNP loci, the 70 tested tomato varieties were subjected to cluster analysis using NTSYS-pc2.11 software. The cluster diagram of 70 tested taste tomato varieties based on 32 SNP primer sets is as Figure 8 shown. The results showed that the 32 SNP primer sets could completely distinguish the 70 tested taste tomato varieties in Table 5. Thus, it can be seen that the 32 SNP primer combinations developed in Example 3 can be applied to the construction of the DNA fingerprint database of taste tomato varieties and the identification of variety authenticity.

[0247] Experimental Example 3

[0248] I. Application of the KASP marker primer set of Example 3 in detecting the authenticity of taste tomato varieties (i.e., the method for detecting whether two unknown tested taste tomato varieties belong to the same variety), and the specific operation is as follows:

[0249] 1. Extract the genomic DNA of the tested tomato samples

[0250] The genomic DNA of the tested samples was extracted by the CTAB method. DNA quality detection and concentration determination were carried out using NanoDrop, and the DNA concentration was adjusted to 30 - 50 ng / μL for standby.

[0251] The 32 SNP primer sets screened in Example 1 were used to perform PCR amplification on the tested samples, and three replicates were set for each tested sample.

[0252] 2. Configuration of the PCR reaction system and setting of the reaction program

[0253] The PCR amplification system is as follows: The reaction system is 10 μL, including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0254] PCR amplification program: Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C - 57°C for 60 s, a total of 10 TouchDown cycles (the temperature decreases by 0.8°C in each cycle); in the second round of PCR reaction, denaturation at 94°C for 20 s, annealing and extension at 57°C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0255] It should be noted that if the fluorescence signal is weak after PCR amplification, affecting data analysis, cycles can be added (denaturation at 94°C for 20 s, renaturation and extension at 55°C for 1 min, 5 cycles) until the result is satisfactory.

[0256] 3. Result analysis

[0257] If the number of polymorphic loci between two tomato varieties to be tested is 1 or 0, then these two tomato varieties to be tested are suspected or the same tomato variety. If the number of polymorphic loci between two tomato varieties to be tested is 2 or more, then these two tomato varieties belong to different tomato varieties; the more the number of polymorphic loci, the farther the genetic relationship.

[0258] II. Application of the KASP marker primer set in Example 3 in detecting the purity of taste tomato varieties

[0259] This example scheme is a method for identifying the purity of a taste tomato hybrid with known parents, and the specific operation is as follows:

[0260] 1. Samples: Select 100 - 200 tomato seeds from the seeds of the submitted taste tomato variety "Pin Fan 4031" for cultivation to obtain no less than 94 tomato single plants, together with the plants of the male and female parents of this variety (the male and female parents are used as control samples), a total of 96 samples are obtained.

[0261] 2. Extract the genomic DNA of the above-mentioned common tomato samples to be tested by the 96-well deep plate rapid extraction method, and the specific operation is as follows:

[0262] (1) When the tomato grows to two leaves and one heart, take 1 true leaf and place it in a 96-well deep plate, and add 1 stainless steel bead;

[0263] (2) Add 500 μL of extraction solution (formula: 12.1 g Tris, 28.1 g NaCl, 18.6 g EDTA, made up to 1 L) to each well using a multi-channel pipette. After covering with a silica gel pad, grind for 2 min using an automatic grinder, and then centrifuge at 4000 rpm for 15 minutes in a centrifuge to separate the tissue from the extraction solution;

[0264] (3) Pipette 200 μL of the supernatant into a new 96-well deep plate, add 2 volumes of ice-cold ethanol for precipitation, place at -20 °C for 30 minutes, centrifuge at 4000 rpm for 15 minutes, discard the supernatant, add 500 μL of 75% ethanol for washing and then pour out the ethanol. After air-drying, add 100 μL of ddH2O to dissolve;

[0265] (4) Finally, dilute the DNA concentration uniformly by 5 times for standby.

[0266] 3. PCR Amplification

[0267] The PCR amplification system is as follows: The reaction system is 10 μL, including 1.5 μL of template DNA, 5 μL of KASP Master mix, 0.7 μL of KASP Primer mix (0.15 μL each of upstream primers F1 and F2, 0.4 μL of universal primer R), and 2.8 μL of ddH2O.

[0268] The PCR amplification program: Pre-denaturation at 94 °C for 15 min; Denaturation at 94 °C for 20 s, annealing at 65 °C - 57 °C for 60 s, a total of 10 TouchDown cycles (the temperature drops by 0.8 °C in each cycle); In the second round of PCR reaction, denaturation at 94 °C for 20 s, annealing and extension at 57 °C for 60 s, a total of 32 cycles. Finally, read the fluorescence signal.

[0269] 4. Screening of Identification Markers

[0270] First, use the DNA of the parental materials of the taste tomato variety "Pin Fan 4031" as templates. Set 3 replicates for each parental material. Divide 32 SNP primer sets into 2 batches (or two groups) according to the arrangement order in Table 6. Randomly select the primer sets in the second batch for PCR amplification and genotyping, and screen for polymorphic markers with stable genotyping results between the parents for hybrid seed purity identification. Among the primer sets in the second batch, the genotyping result of primer 7-2 is stable and polymorphic, which can be used for subsequent experiments.

[0271] It should be noted that in this example, combined with the actual experimental process, to save the identification time and reagent cost, the primers in other batches can be used as alternatives and the screening process can be stopped after screening out polymorphic markers with stable genotyping results.

[0272] 5. Hybrid Seed Purity Identification

[0273] Select the primer 7-2 screened in "Step 4" to perform PCR amplification and genotyping on the DNA of the F1 hybrid, and statistically analyze the results. The points located on the diagonal of the coordinate axis represent the heterozygous genotype and are the true F1 hybrids.

[0274] The purity calculation method is as follows: The number of non-fluorescent plants = N - the number of plants showing the color fluorescence indicating heterozygotes - the number of plants showing the color fluorescence indicating the first homozygote - the number of plants showing the color fluorescence indicating the second homozygote;

[0275] Purity = [the number of plants showing the color fluorescence indicating heterozygotes in the target primer group / (N - the number of non-fluorescent plants in the target primer group)] × 100%;

[0276] Among them, in this example, the number of non-fluorescent plants is 0, the number of plants showing the color fluorescence indicating heterozygotes in the target primer group is 94, N is 94, and the measured purity is 100%.

[0277] The genotyping test results are as Figure 6 shown. All F1s showed a heterozygous type, indicating that the seed purity was 100%. When further field identification was carried out, all F1 individual plants showed traits different from those of the parents and were stable and consistent, which was consistent with the molecular marker identification results. This shows that the purity identification method based on the above-screened primer group for KASP markers has high accuracy and can be used for the efficient detection of the purity of cherry tomato hybrids.

[0278] It should be noted that the present invention is only applicable to the purity identification of first-generation hybrid seeds with only parental admixture and is not applicable to the identification of the admixture of several varieties caused by mechanical admixture.

[0279] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A SNP site primer combination for identifying the authenticity of common tomato varieties and the purity of hybrids, characterized in that: The following table contains the SNP sites and primers:

2. A method for detecting whether two unknown common tomato varieties to be tested are of the same variety, characterized in that: The following steps are involved: S1. Extracting genomic DNA of common tomato samples to be tested; S2. Using the primers described in claim 1 to perform PCR amplification on the common tomato to be tested; S3. Result analysis: If the number of difference sites between the two tested common tomato varieties is 1 or 0, then the two tested common tomato varieties are suspected or the same tomato varieties; if the number of difference sites between the two tested common tomato varieties is 2 or more, then the two tested common tomato varieties belong to different tomato varieties.

3. A method for identifying the purity of common tomato hybrids, characterized in that: The following steps are involved: DNA extraction step: extracting genomic DNA of N hybrids of a common tomato variety to be tested; N is a natural number greater than 12, preferably a natural number greater than or equal to 94; Screening of target primer sets: For the purity identification of hybrids of known varieties, firstly, DNA of the parental materials of the hybrids is used as a template, and each parental material is repeated three times, and the primers described in claim 1 are used for PCR amplification and genotyping, and polymorphic primers with stable typing results between parents are screened for the purity identification of hybrids; for the purity identification of hybrids of unknown varieties, DNA of 12 F1 hybrid single plants is used as a template, and the primers described in claim 1 are used for PCR amplification and genotyping, and primers with heterozygous and stable and consistent typing results are screened for the purity identification of hybrids; PCR amplification with target primer set: using the genomic DNA of the N common tomato hybrids to be tested as templates, respectively using the target primer set to perform competitive allele-specific PCR amplification reactions to obtain PCR reaction products of the target primer set; Purity identification: testing the PCR reaction product of the target primer set, and calculating the purity of the tested common tomato hybrid according to the test result; Preferably, in the step of screening the target primer set and the step of detecting purity, the detection method is selected from: fluorescence signal detection, direct sequencing; Preferably, in the step of screening the target primer set, for the purity identification of hybrids of known varieties, when fluorescence signal detection is used, the primer set of the primer set as claimed in claim 1 that is statistically stable and consistent in the parental sample is the target primer set; when direct sequencing is used, the primer set of the primer set of the SNP site as claimed in claim 1 that is statistically stable and consistent in the parental sample is the target primer set; For the purity identification of hybrids of unknown varieties, when fluorescence signal detection is used, the number of strains with fluorescence signals of the color of heterozygotes indicated by the primer set as claimed in claim 1 is counted; the primer set with the largest number of fluorescent strains indicating the color of heterozygotes is the target primer set; when direct sequencing is used, the number of strains with heterozygous genotypes at the SNP site as claimed in claim 1 is counted; the primer set with the largest number of heterozygous strains is the target primer set; Preferably, in the purity detection step, the purity of the tomato hybrid to be detected is calculated by: When fluorescence signal detection is adopted, 1 to 3 target primer sets are selected for purity calculation, and the number of plants with color fluorescence indicating heterozygotes and the number of plants without fluorescence in the selected target primer sets are counted, and the purity is calculated respectively, and then the average value is calculated, and the average value is the purity of the tomato hybrid to be tested; The number of strains without fluorescence = N - the number of strains showing fluorescence of the color indicating heterozygotes - the number of strains showing fluorescence of the color indicating the first homozygote - the number of strains showing fluorescence of the color indicating the second homozygote; Purity = [the number of strains showing fluorescence of the color indicating heterozygotes with the target primer set / (N-the number of strains without fluorescence with the target primer set)] × 100%; When using direct sequencing: Select 1 to 3 target primer sets for purity calculation, count the number of plants with heterozygous genotypes and the number of plants without PCR amplification products in the selected target primer sets, calculate the purity respectively, and then calculate the average value, which is the purity of the tomato hybrid to be tested; Purity = [the number of strains with heterozygous genotypes based on the SNP site of the target primer set / (N-the number of strains without PCR amplification products obtained by the target primer set)] × 100%; Preferably, the common tomato hybrids are Huachen 25, Huafeng 56, Huaguan 36, Jingao 2, Zhongyan 460, Tianfei 11, Zhuofen 1, Tianbao 326, Tianci 595, Tianci 3, Guanqun 7, Jili 2, Xiwang 2, Fenkang 4, Pujin 901, Fengshou 128, Yibaifen-5, Wofen 2, Kaide Yali 87360, Fendeli, Lola, Annecy, Dorothy, Saint Laurent, Rui La, Zidali, Ruifei, Dongnuan, Kelly No. 3, Sibei, Antles, SV4224TH, Oudun, SVTH1366, Ouke, Beijing Fan 101, Beijing Fan 301, Beijing Fan 501, Beijing Fan 404, Beijing Fan 701, Qiangfeng, Zhongza No. 9, Zhongza 101, Zhongza 301, Zhongza 302, Xilaid No. 1, 7728, Jinpeng No. 8, Qiusheng, Tiansheng No. 1, Tianzhen No. 1, Ruiheng 118, Tianzheng 1567, Ouxiu 806, Zhuoqun No. 3, Princess Dai 260, Vienna No. 2, Hezuo 903, Wofen 1274, Ningfan 640, Xianke No. 8, Maofen 802, Zheza 506, Zhefen 21066, Yashu 2203, WH405, Jingfan 403, Tieqiu, Beefsteak Tomato, Shengshi No. 2, Huaqin 119, Saixishi No. 5, Boya 82, Kairui 6172, Paul Tower, Seminis 401 8. Any of Kakuchi, Ruifen, Custer, Walter, Vienna, Hongmei 4044, Hongmei 3545, Qingling, Nongboshi, Dongfen 108, Ah2011, Ah2012, Nuofen 309, Xiakang, Ladoke, Tianxing 1008, Oriental Chunzao, Fenguan No. 3, Champions League 400, 22-98 Dahong, Bofen No. 12, Guanxia 102, Boyan 109, Boyan 201, Beiying and Oubei.

4. A SNP site primer combination for identifying the authenticity of cherry tomato varieties and the purity of hybrids, characterized in that: The following table contains the SNP sites and primers:

5. A method for detecting whether two unknown cherry tomato varieties are of the same variety, characterized in that: The following steps are involved: S1. Extracting genomic DNA of the cherry tomato sample to be tested; S2. Using the primers described in claim 4 to perform PCR amplification on the cherry tomato to be tested; S3. Result analysis: If the number of difference sites between the two tomato varieties to be tested is 1 or 0, then the two cherry tomato varieties to be tested are suspected or the same cherry tomato varieties; if the number of difference sites between the two cherry tomato varieties to be tested is 2 or more, then the two cherry tomato varieties to be tested belong to different cherry tomato varieties.

6. A method for identifying the purity of cherry tomato hybrids, characterized in that: The following steps are involved: DNA extraction step: extracting genomic DNA of N tested hybrids of a tested cherry tomato variety; N is a natural number greater than 12, preferably a natural number greater than or equal to 94; Screening of target primer sets: For the purity identification of hybrids of known varieties, firstly, DNA of the parental materials of the hybrids is used as a template, and each parental material is repeated three times, and the primers described in claim 4 are used for PCR amplification and genotyping, and polymorphic primers with stable typing results between parents are screened for the purity identification of hybrids; for the purity identification of hybrids of unknown varieties, DNA of 12 F1 hybrid individual plants is used as a template, and the primers described in claim 4 are used for PCR amplification and genotyping, and primers with heterozygous and stable and consistent typing results are screened for the purity identification of hybrids; PCR amplification with the target primer set: using the genomic DNA of the N strains of cherry tomato hybrids to be tested as templates, respectively using the target primer set to perform competitive allele-specific PCR amplification reactions to obtain PCR reaction products of the target primer set; Purity identification: testing the PCR reaction product of the target primer set, and calculating the purity of the cherry tomato hybrid to be tested according to the test result; Preferably, in the step of screening the target primer set and the step of detecting purity, the detection method is selected from: fluorescence signal detection, direct sequencing; Preferably, in the step of screening the target primer set, for the purity identification of hybrids of known varieties, when fluorescence signal detection is used, the primer set of the primer set as claimed in claim 4 that is stably and consistently homozygous polymorphic in the parent sample is counted as the target primer set; when direct sequencing is used, the number of plants whose genotypes of the SNP loci as claimed in claim 4 are homozygous in the parent sample is counted; the primer set that is stably and consistently homozygous polymorphic in the parent sample is the target primer set; For the purity identification of hybrids of unknown varieties, when fluorescence signal detection is used, the number of strains with fluorescence signals of the color of heterozygotes indicated by the primer set as described in claim 4 is counted; the primer set with the largest number of fluorescent strains indicating the color of heterozygotes is the target primer set; when direct sequencing is used, the number of strains with heterozygous genotypes at the SNP site as described in claim 4 is counted; the primer set with the largest number of heterozygous strains is the target primer set; Preferably, in the purity detection step, the purity of the cherry tomato hybrid to be tested is calculated by: When fluorescence signal detection is adopted, 1 to 3 target primer sets are selected for purity calculation, and the number of plants with color fluorescence indicating heterozygotes and the number of plants without fluorescence in the selected target primer sets are counted, and the purity is calculated respectively, and then the average value is calculated, and the average value is the purity of the cherry tomato hybrid to be tested; The number of strains without fluorescence = N - the number of strains showing fluorescence of the color indicating heterozygotes - the number of strains showing fluorescence of the color indicating the first homozygote - the number of strains showing fluorescence of the color indicating the second homozygote; Purity = [the number of strains showing fluorescence of the color indicating heterozygotes with the target primer set / (N-the number of strains without fluorescence with the target primer set)] × 100%; When using direct sequencing: Select 1 to 3 target primer sets for purity calculation, count the number of plants with heterozygous genotypes and the number of plants without PCR amplification products in the selected target primer sets, calculate the purity respectively, and then calculate the average value, which is the purity of the cherry tomato hybrid to be tested; Purity = [the number of strains with heterozygous genotypes based on the SNP site of the target primer set / (N-the number of strains without PCR amplification products obtained by the target primer set)] × 100%; Preferably, the cherry tomato hybrids are flame, kumquat, white arrow, beiduofen, cherry powder 208, cherry powder 576, yellow agate 101, rosy light 1, golden beans, red beads, red clouds, red agate 2015, red beauty, double resistance 728, wonderful 6453, purple rosy fairy, purple bei, golden garden 216, pink princess, winter rhyme, pink dan, golden so, Witt red 1, sweet, jade gold fragrance 2, inch mango, cabernet sauvignon, Tainan Xibei, string sweet 2, Taiwan Nongyou FS1698, Geely, Israel 9521, Israel Gostina, Shouyan CT181, Witt 1701, millennium, golden summer, pink baby, Busan 88, sapolo, Vitalin, Hongyan, Beijing Fan red 1, Beijing Fan Huangxing 1, Beijing Fan rose yellow, Any of Yue Ke Da 102, Yue Ke Da 105, Ou Xiu Yellow Cherry, Ou Xiu Red Cherry, Venus, Summer Star No. 17, Zhejiang Cherry Pink No. 1, Zhejiang Cherry Pink No. 8, Xin Coin, Huang Jia No. 1, Bi Jiao, Green Cherry Gem, New Zealand No. 1, Jin Yang Honey Pearl, Yellow Diamond No. 1, Ning Ying 479, Tian Zhu No. 1, Pink Shell 2006, Shanghai Red Cherry 201, Qing Xiang Mi, Princess, Xiang Fei No. 2, Ai Long No. 2, Hua Ying 746, 2203-117, Wan Xi, Orange Sunshine 44, Golden Honey Peanut, Cui Zhu, Golden Coast, Sweet Star-2, String of Cherry Tomatoes 124, Pink Music 18, Ying Xia, C703, Sweet Pearl, Jing Fan Pink Star No. 2, Jiao Yan No. 5, Australia and America No. 2, Ning Xiang, Pink Shell 201, Zhen Mei, Andeli, Tainan Hong Li No. 2 and Qianfen 518.

7. A SNP site primer combination for identifying the authenticity of tomato varieties and the purity of hybrids, characterized in that: The following table contains the SNP sites and primers:

8. A method for detecting whether two unknown tomato varieties to be tested are of the same variety, characterized in that: The following steps are involved: S1, extracting genomic DNA of tomato samples to be tested; S2. Using the primers described in claim 7 to perform PCR amplification on the tomato to be tested for taste; S3. Result analysis: If the number of difference sites between the two tested tomato varieties is 1 or 0, then the two tested tomato varieties are suspected or the same tomato varieties; if the number of difference sites between the two tested tomato varieties is 2 or more, then the two tested tomato varieties are different tomato varieties.

9. A method for identifying the purity of tomato hybrids by taste, characterized in that: The following steps are involved: DNA extraction step: extracting genomic DNA of N tested hybrids of a tested tomato variety; N is a natural number greater than 12, preferably a natural number greater than or equal to 94; Screening of target primer sets: For the purity identification of hybrids of known varieties, firstly, DNA of the parents of the hybrids is used as a template, and three replicates are set for each parental material. The primers described in claim 7 are used for PCR amplification and genotyping, and polymorphic primers with stable typing results between parents are screened for the purity identification of hybrids; for the purity identification of hybrids of unknown varieties, DNA of 12 F1 hybrid single plants is used as a template, and the primers described in claim 7 are used for PCR amplification and genotyping, and primers with heterozygous and stable and consistent typing results are screened for the purity identification of hybrids; PCR amplification with target primer set: using the genomic DNA of the N strains of tomato hybrids to be tested as templates, respectively using the target primer set to perform competitive allele-specific PCR amplification reactions to obtain PCR reaction products of the target primer set; Purity identification: testing the PCR reaction product of the target primer set, and calculating the purity of the tomato hybrid to be tested based on the test result; Preferably, in the step of screening the target primer set and the step of detecting purity, the detection method is selected from: fluorescence signal detection, direct sequencing; Preferably, in the step of screening the target primer set, for the purity identification of hybrids of known varieties, when fluorescence signal detection is used, the primer set of the primer set as claimed in claim 7 that is statistically stable and consistent in the parental sample is the target primer set; when direct sequencing is used, the primer set of the primer set of the SNP site as claimed in claim 7 that is statistically stable and consistent in the parental sample is the target primer set; For the purity identification of hybrids of unknown varieties, when fluorescence signal detection is used, the number of strains with fluorescence signals of the color of heterozygotes indicated by the primer set as claimed in claim 7 is counted; the primer set with the largest number of fluorescent strains indicating the color of heterozygotes is the target primer set; when direct sequencing is used, the number of strains with heterozygous genotypes at the SNP site as claimed in claim 7 is counted; the primer set with the largest number of heterozygous strains is the target primer set; Preferably, in the purity detection step, the purity of the tomato hybrid to be tested is calculated by: When fluorescence signal detection is adopted, 1 to 3 target primer groups are selected for purity calculation, and the number of plants with color fluorescence indicating heterozygotes and the number of plants without fluorescence in the selected target primer groups are counted, and the purity is calculated respectively, and then the average value is calculated, and the average value is the purity of the tomato hybrid with the taste to be tested; The number of strains without fluorescence = N - the number of strains showing fluorescence of the color indicating heterozygotes - the number of strains showing fluorescence of the color indicating the first homozygote - the number of strains showing fluorescence of the color indicating the second homozygote; Purity = [the number of strains showing fluorescence of the color indicating heterozygotes with the target primer set / (N-the number of strains without fluorescence with the target primer set)] × 100%; When using direct sequencing: Select 1 to 3 target primer groups for purity calculation, count the number of plants with heterozygous genotypes and the number of plants without PCR amplification products in the selected target primer groups, calculate the purity respectively, and then calculate the average value, which is the purity of the tomato hybrid with the desired taste; Purity = [the number of strains with heterozygous genotypes based on the SNP site of the target primer set / (N-the number of strains without PCR amplification products obtained by the target primer set)] × 100%; Preferably, the tomato hybrids with good taste are 56FE, Pinfan 2045, Pinfan 4027, Pinfan 4031, Pinfan 20311, Anlida, Xiuqing, Fuxing, Youkang SS28, Jiawen No. 1, Shengfan No. 2, Qingdai Yulang No. 3, Fanyu 2099, Xiantao No. 5, Tiancuicui-2, Zhejiang Flavor No. 3, Wanmei, Strawberry No. 5, Yuanwei 128, Cuiyu No. 2, Chudai No. 6, Fengtian 126, Strawberry No. 15, Tianmei, Jingfan 309, XX45, Taomengqian, Diana, Xianmei No. 5, Provence, Strawberry No. 2, Beiweimei, Zhejiang Flavor No. 2 , Tiemei No. 6, Zhenyoumei, Fengyun, Hongxiu, Huiwei 99, Fengtian A8, 23G666, Fantaro No. 8, Yasu No. 11, Yuxi, Zhongza 315, Koihi, Hefan No. 1, JPCQ6, Ichibanzha, Tianzhu Latte, Gala Fruit, Beishi No. 3, S22022, JSH46, Fini, Guanghui 101, Youyouguo, Boyan 68, Boyan 366, Beijing Fan H2205, Beijing Fan H2302, Beijing Fan H2305, Beijing Fan 308, Strawberry Tomato, Huangyu, Xiangbalang, Weimeijia, Medivh, Sandy No. 2 and Sweet Honey.

10. Any of the following applications: (1) Use of the SNP site primer combination of claim 1 in the preparation of products for identifying or assisting in identifying the authenticity of common tomato varieties; (2) Use of the SNP site primer combination of claim 1 in the preparation of a product for identifying or assisting in identifying the purity of seeds of common tomato varieties; (3) Use of the SNP site primer combination of claim 1 in identifying or assisting in identifying the authenticity of common tomato varieties; (4) Use of the SNP site primer combination of claim 1 in identifying or assisting in identifying the purity of seeds of common tomato varieties; (5) Use of the SNP site primer combination of claim 1 in tomato breeding; (6) Use of the method of claim 2 or 3 in identifying or assisting in identifying the authenticity of common tomato varieties; (7) Use of the method of claim 2 or 3 in identifying or assisting in identifying the purity of seeds of common tomato varieties; (8) Application of the method of claim 2 or 3 in tomato breeding; (9) Use of the SNP site primer combination of claim 4 in the preparation of a product for identifying or assisting in identifying the authenticity of a cherry tomato variety; (10) Use of the SNP site primer combination of claim 4 in the preparation of a product for identifying or assisting in identifying the purity of cherry tomato variety seeds; (11) Use of the SNP site primer combination of claim 4 in identifying or assisting in identifying the authenticity of cherry tomato varieties; (12) Use of the SNP site primer combination of claim 4 in identifying or assisting in identifying the purity of cherry tomato variety seeds; (13) Use of the SNP site primer combination of claim 4 in tomato breeding; (14) Use of the method of claim 5 or 6 in identifying or assisting in identifying the authenticity of cherry tomato varieties; (15) Use of the method of claim 5 or 6 in identifying or assisting in identifying the purity of cherry tomato varieties seeds; (16) Application of the method of claim 5 or 6 in tomato breeding; (17) Use of the SNP site primer combination of claim 7 in the preparation of a product for identifying or assisting in identifying the authenticity of a tomato variety; (18) Use of the SNP site primer combination of claim 7 in the preparation of a product for identifying or assisting in identifying the purity of tomato variety seeds; (19) Use of the SNP site primer combination of claim 7 in identifying or assisting in identifying the authenticity of tomato varieties; (20) Use of the SNP site primer combination of claim 7 in identifying or assisting in identifying the purity of seeds of tomato varieties with good taste; (21) Use of the SNP site primer combination of claim 7 in tomato breeding; (22) Use of the method of claim 8 or 9 in identifying or assisting in identifying the authenticity of tomato varieties; (23) Use of the method of claim 8 or 9 in identifying or assisting in identifying the purity of seeds of tomato varieties with good taste; (24) Application of the method of claim 8 or 9 in tomato breeding.

Images