Preparation method and application of a braided DNA synthesis stationary phase

Abstract

The present invention discloses a preparation method and application of a braided DNA synthesis stationary phase, belonging to the technical field of molecular biology materials. The preparation method of the braided DNA synthesis stationary phase of the present invention comprises the following steps: (1) treating a braided fabric with plasma, and then reacting the braided fabric in a silane coupling agent solution to obtain a functionally modified braided fabric; the silane coupling agent is a silane coupling agent containing a functional group azide; (2) treating the functionally modified braided fabric in a hydrophobic reagent to obtain a hydrophobicized functional braided fabric; and (3) combining a single-chain oligo modified with dibenzocyclooctyne at the 5' end with the hydrophobicized functional braided fabric to obtain the braided DNA synthesis stationary phase. The present invention innovatively uses a braided fabric as a stationary phase, and its surface characteristics give the stationary phase excellent loading performance, which is significantly improved compared to traditional stationary phases.

Description

Technical Field

[0001] The present invention relates to the technical fields of bioengineering, biotechnology and molecular biology materials, and in particular to a preparation method and application of a braided DNA synthesis stationary phase. Background Art

[0002] In recent years, with the rapid development of genetic engineering technology, DNA synthesis technology has become the core driving force for breakthroughs in research and application in the field of bioengineering. As a cutting-edge third-generation DNA synthesis technology, enzymatic DNA synthesis, with its high efficiency, high accuracy and environmental protection characteristics, provides a revolutionary solution to break through the bottleneck of traditional chemical synthesis. This technology achieves precise control through engineered terminal deoxynucleotidyl transferase (TDT) and reversible terminator nucleotides, and completes the synthesis of target sequences through multiple rounds of precise addition of single bases at the end of the DNA chain (solid phase carrier is required to fix the DNA chain). It shows breakthrough potential in biocompatibility and process integration, and has opened up a new direction for the development of DNA synthesis technology.

[0003] As a key substrate for DNA synthesis, solid-phase supports fulfill multiple core functions during the synthesis process: they not only provide a physical platform for the reaction system but also ensure the orderly progress of the synthesis reaction by immobilizing reaction substrates (such as primers and nucleotides). DNA immobilization technology, a key foundation for enzymatic synthesis, relies primarily on covalently anchoring primer molecules to the support surface. This process is typically achieved by modifying the support surface with functional groups that specifically couple with reactive groups at the primer termini. However, currently available chip-based immobilization supports (such as glass substrates and polymer materials) suffer from significant drawbacks. Regarding stability, the functional groups on the support surface are susceptible to environmental degradation, resulting in a decrease in primer immobilization efficiency over time. Furthermore, the high-purity substrate treatment and precise surface modification processes drive up production costs. These issues directly impact the stability and sequence accuracy of DNA synthesis, thereby hindering the development of high-throughput synthesis. Of particular note, during the synthesis of long DNA chains, the degradation of support performance can lead to an exponential increase in the synthesis error rate, making the development of new, high-performance solid-phase supports a key breakthrough in improving synthesis quality. Summary of the Invention

[0004] The purpose of the present invention is to provide a preparation method and application of a braided DNA synthesis stationary phase.

[0005] The present invention first provides a method for preparing a braided DNA synthesis stationary phase, comprising the following steps:

[0006] (1) treating a woven fabric with plasma, and then reacting the woven fabric in a silane coupling agent solution to obtain a functionally modified woven fabric;

[0007] The silane coupling agent is a silane coupling agent containing a functional group azide;

[0008] (2) placing the functionally modified woven fabric in a hydrophobic reagent for hydrophobic treatment to obtain a hydrophobically treated functional woven fabric;

[0009] (3) The single-stranded oligo modified with dibenzocyclooctyne at the 5' end (hereinafter referred to as the base probe) is combined with the hydrophobic treated functional woven fabric to obtain the woven DNA synthesis stationary phase.

[0010] In the above-mentioned preparation method, the woven cloth is made of glass fiber;

[0011] The woven fabric has a thickness of at least one of 0.03 mm, 0.05 mm, and 0.1 mm;

[0012] The silane coupling agent is covalently bonded to the silanol groups on the surface of the woven fabric to obtain a functionally modified woven fabric.

[0013] In the above-mentioned preparation method, in step (1), the power of the plasma treatment is 50-500 W;

[0014] Preferably, the power of the plasma treatment is 100-200 W;

[0015] The plasma treatment time is 1-500 s;

[0016] Preferably, the plasma treatment time is 30-200 s;

[0017] The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air;

[0018] The flow rate of the working gas for the plasma treatment is 100-500 m / s;

[0019] Preferably, the flow rate of the working gas for the plasma treatment is 150-250 m / s;

[0020] In the above-mentioned preparation method, in step (1), the silane coupling agent containing a functional group azide is at least one selected from 3-(azidopropyl)triethoxysilane, azidotrimethylsilane and 6-azidosulfonylhexyltriethoxysilane;

[0021] The mass percentage concentration of the silane coupling agent solution is 0.1%-20%;

[0022] Preferably, the mass percentage concentration of the silane coupling agent solution is 0.2%-1%;

[0023] The solvent of the silane coupling agent solution is acetonitrile;

[0024] The reaction temperature is 25-100°C;

[0025] Preferably, the reaction temperature is 25-50°C;

[0026] The reaction time is 2-24 h;

[0027] Preferably, the reaction time is 2-15 h;

[0028] The reaction was carried out under light-protection conditions.

[0029] In the above-mentioned preparation method, in step (2), the hydrophobic reagent is at least one of n-octyltrichlorosilane, isooctyltrichlorosilane, butyltrichlorosilane, octadecyltrichlorosilane and trimethylchlorosilane;

[0030] The hydrophobic reagent is a solution with a mass percentage concentration of 1%-10%;

[0031] Preferably, the hydrophobic agent is a solution with a mass percentage concentration of 1%-5%;

[0032] The solvent of the hydrophobic reagent is at least one of acetonitrile, ethanol and isopropanol;

[0033] The temperature of the hydrophobic treatment is 25-100°C;

[0034] Preferably, the temperature of the hydrophobic treatment is 25-50°C;

[0035] The hydrophobic treatment time is 1-30 min;

[0036] Preferably, the hydrophobic treatment time is 1-10 min.

[0037] In the above preparation method, in step (3), the nucleotide sequence of the base probe is as follows: 5'-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'.

[0038] In the above-mentioned preparation method, step (3) specifically comprises the following steps: soaking the hydrophobically treated functionalized woven fabric in a base probe solution to combine the fabrics and obtain the woven DNA synthesis stationary phase.

[0039] In the above preparation method, the concentration of the base probe solution is 0.5-10 μM;

[0040] Preferably, the concentration of the base probe solution is 1-5 μM;

[0041] The volume of the base probe solution is 1-200 μL;

[0042] Preferably, the volume of the base probe solution is 100-200 μL;

[0043] The soaking temperature is 25-100°C;

[0044] Preferably, the soaking temperature is 25-50°C;

[0045] The soaking time is 0.5-5 h.

[0046] Preferably, the soaking time is 0.5-1 h;

[0047] In the above preparation method, there is a step of cleaning and drying the woven fabric before the plasma treatment; specifically, the cleaning is first performed with an organic solvent to remove oil and impurities on the surface; then ultrasonic cleaning is performed with a glass detergent, and finally cleaning is performed with water.

[0048] The organic solvent is selected from at least one of acetone, chloroform, ethyl chloride and xylene;

[0049] After the hydrophobic treatment in step (2), there are steps of washing with water and drying.

[0050] In the above preparation method, the drying temperature is 25-100° C., specifically 90° C.; the drying time is 5-60 min, specifically 10 min.

[0051] Furthermore, the present invention provides a braided DNA synthesis stationary phase prepared by the above preparation method.

[0052] The application of the braided DNA synthesis stationary phase in enzymatic DNA synthesis also falls within the scope of protection of the present invention.

[0053] Compared with the prior art, the present invention has the following advantages:

[0054] This invention innovatively uses woven fabric as the stationary phase. This low-cost material is suitable for large-scale production and application. Its surface properties give the stationary phase excellent loading performance, significantly improving upon traditional stationary phases. This stationary phase exhibits broad application prospects in biotechnology fields such as enzymatic DNA synthesis, providing important material support for the innovative development of related technologies.

[0055] Woven fabrics are highly hydrophilic, so they easily retain DNA synthesis solution, resulting in decreased synthesis efficiency. Therefore, the present invention adopts a unique hydrophobic treatment scheme to improve the hydrophobicity of the woven fabric without affecting probe inoculation, thereby improving DNA synthesis efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The figure is a flow chart for the preparation of the braided DNA synthesis stationary phase of the present invention. DETAILED DESCRIPTION

[0057] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0058] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0059] Example 1. Preparation of Braided DNA Synthesis Stationary Phase and Enzymatic DNA Synthesis

[0060] (1) Material preparation: Select a clean 5 mm × 5 mm glass fiber cloth (Green Chemical, thickness 0.03 mm) for subsequent experimental operations.

[0061] (2) Surface cleaning: First, the glass fibers were placed in acetone for cleaning to remove surface oil and impurities. Subsequently, they were ultrasonically cleaned for 5 min using a 1% by mass glass cleaning agent (Alnocox solution), and then rinsed twice with water. Finally, they were dried at 90°C for 10 min.

[0062] (3) Plasma cleaning: Turn on the gas cylinder and the power of the equipment in sequence, and place the glass fiber cloth prepared in step (2) in a vacuum plasma cleaning machine (Nan Technology, NE-PE05F) (the gas is oxygen and the flow rate is 200 m / s). Turn on the radio frequency and vacuum system, and perform plasma treatment on the glass fiber cloth for 180 s at a power of 130 W to further clean the surface of the glass fiber cloth and improve its activity.

[0063] (4) Functional modification: First, prepare a 1% mass concentration of 3-(azidopropyl)triethoxysilane acetonitrile solution, immerse the glass fiber cloth treated as above, and react in the dark at 50 °C for 15 h to obtain functionalized glass fiber cloth.

[0064] (5) Prepare a 1% octyltrichlorosilane acetonitrile solution, immerse the modified glass fiber cloth in it, and hydrophobize it at 25℃ for 10 min; wash it twice with pure water, and dry it at 90℃ for 10 min (the functional modification process is as follows Figure 1 As shown), a hydrophobic treated functional glass fiber cloth was obtained.

[0065] (6) Coupling base probe: The hydrophobically treated functionalized glass fiber cloth was placed into 200 μL of a 2 μM initiator chain solution (the nucleotide sequence of the initiator chain is sequence I in the sequence table, i.e., 5'-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3', and the solvent is 20×SSC), and the reaction was carried out at 25°C for 1 h. After the reaction was completed, a braided DNA synthesis stationary phase was obtained.

[0066] (7) The concentration of the DNA base probe before and after binding was determined using the Qubit kit, and the binding amount was calculated by the difference method (see Table 1).

[0067]

[0068] (8) The braided DNA synthesis stationary phase prepared above is used to carry out DNA synthesis reaction and deprotection reaction cycles to synthesize the target sequence. The nucleotide sequence of the synthesized DNA is shown below (Sequence II); specifically, TdT enzyme and dNTP with protected bases can be used for enzymatic reaction, and the protected bases can be eluted using deprotection solution. Multiple cycles can be used to achieve enzymatic synthesis of the target DNA sequence. The synthesis steps are as follows:

[0069] (a) Prepare the reaction system required for enzymatic DNA synthesis, including a reaction solution, a deprotection solution, and a washing solution. The composition of the reaction solution is shown in Table 2 below.

[0070]

[0071] The deprotection solution was 700 mM sodium nitrite solution at pH 5; the washing solution was 50 mM potassium phosphate buffer containing 100 mM NaCl.

[0072] (b) The braided DNA synthesis stationary phase is placed in the system, and a reaction solution containing nucleotides (including TdT enzyme) is added to react. After the reaction is completed, a deprotection solution is added to remove the protecting group at the 3' end of the synthesis to facilitate the connection of the next nucleotide.

[0073] (c) Wash with a cleaning solution for 2-3 times. After washing, continue to add the reaction solution containing the next nucleotide to react, and repeat the reaction-deprotection group-washing steps in the order of TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCT (sequence II) to achieve enzymatic synthesis of the target DNA sequence and synthesize the required DNA chain.

[0074] (d) The synthesized products were subjected to second-generation sequencing analysis. As shown in Table 3, the sequencing results showed that the average yield could reach 75.44% and the average accuracy could reach 99.44% (accuracy calculation formula: Accuracy = ).

[0075]

[0076] Comparative Example 1

[0077] (1) Material preparation: Select a clean 5 mm × 5 mm glass fiber cloth (Green Chemical, thickness 0.03 mm) for subsequent experimental operations.

[0078] (2) Surface cleaning: First, the glass fibers were placed in acetone for cleaning to remove surface oil and impurities. Subsequently, they were ultrasonically cleaned for 5 min using a 1% by mass glass cleaning agent (Alnocox solution), and then rinsed twice with water. Finally, they were dried at 90°C for 10 min.

[0079] (3) Plasma cleaning: Turn on the gas cylinder and the power of the equipment in sequence, and place the glass fiber cloth prepared in step (2) in a vacuum plasma cleaning machine (Nan Technology, NE-PE05F) (the gas is oxygen and the flow rate is 200 m / s). Turn on the radio frequency and vacuum system, and perform plasma treatment on the glass fiber cloth for 180 s at a power of 130 W to further clean the surface of the glass fiber cloth and improve its activity.

[0080] (4) Functional modification: First, prepare a 1% mass concentration of 3-azidopropyltriethoxysilane acetonitrile solution, immerse the glass fiber cloth treated as above, and react in the dark at 50 ° C for 15 h to obtain functionalized glass fiber cloth.

[0081] (5) Coupling base probe: The functionalized glass fiber cloth was placed into 200 μL of 2 μM initiator chain solution (the nucleotide sequence of the initiator chain is sequence I in the sequence table, i.e., 5'-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3', and the solvent is 20×SSC), and the reaction was carried out at 25°C for 1 h. After the reaction was completed, a braided DNA synthesis stationary phase was obtained.

[0082] (6) The concentration of the DNA base probe before and after binding was determined using the Qubit kit, and the binding amount was calculated using the difference method (see Table 4).

[0083]

[0084] (7) The braided DNA synthesis stationary phase prepared above was used to perform DNA synthesis and deprotection reaction cycles to synthesize the target sequence. The steps and conditions were the same as those in Example 1. The results are shown in Table 5.

[0085]

[0086] The braided DNA synthesis stationary phase proposed in this invention uses a woven fabric as a substrate and possesses excellent physical and chemical properties. By grafting functional groups onto the surface of the woven fabric substrate and then hydrophobically modifying it, the resulting woven DNA synthesis stationary phase is low-cost and highly stable. The stationary phase carrier of this invention enables enzymatic DNA synthesis reactions with high synthesis accuracy and yield.

Claims

1. A method for preparing a braided enzymatic DNA synthesis stationary phase, comprising the following steps: (1) treating a woven fabric with plasma, and then reacting the woven fabric in a silane coupling agent solution to obtain a functionally modified woven fabric; The silane coupling agent is a silane coupling agent containing a functional group azide; The woven cloth is made of glass fiber; The thickness of the woven cloth is 0.03 mm; (2) placing the functionally modified woven fabric in a hydrophobic reagent for hydrophobic treatment to obtain a hydrophobically treated functional woven fabric; (3) combining the single-stranded oligo modified with dibenzocyclooctyne at the 5' end with the hydrophobically treated functionalized woven fabric to obtain the woven enzymatic DNA synthesis stationary phase; In step (3), the nucleotide sequence of the single-stranded oligo modified with dibenzocyclooctyne at the 5' end is as follows: 5'-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'.

2. The preparation method according to claim 1, wherein: In step (1), the power of the plasma treatment is 50-500 W; The plasma treatment time is 1-500 s; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas in the plasma treatment is 100-500 m / s.

3. The preparation method according to claim 1, wherein: In step (1), the silane coupling agent containing a functional group azide is selected from at least one of 3-(azidopropyl)triethoxysilane, azidotrimethylsilane and 6-azidosulfonylhexyltriethoxysilane; The mass percentage concentration of the silane coupling agent solution is 0.1%-20%; The reaction temperature is 25-100°C; The reaction time is 2-24 h; The reaction was carried out under light-protection conditions.

4. The preparation method according to claim 1, wherein: In step (2), the hydrophobic agent is at least one of n-octyltrichlorosilane, isooctyltrichlorosilane, butyltrichlorosilane, octadecyltrichlorosilane and trimethylchlorosilane; The hydrophobic reagent is a solution with a mass percentage concentration of 1%-10%; The solvent of the hydrophobic reagent is at least one of acetonitrile, ethanol and isopropanol; The temperature of the hydrophobic treatment is 25-100°C; The time of the hydrophobic treatment is 1-30 min.

5. The preparation method according to claim 1, wherein: Step (3) specifically includes the following steps: soaking the hydrophobically treated functionalized woven fabric in a single-stranded oligo solution modified with dibenzocyclooctyne at the 5' end to combine the two, thereby obtaining the woven enzymatic DNA synthesis stationary phase.

6. The preparation method according to claim 5, wherein: The concentration of the single-chain oligo solution modified with dibenzocyclooctyne at the 5' end is 1-10 μM; The volume of the single-chain oligo solution with 5'-end modified dibenzocyclooctyne is 1-200 μL; The soaking temperature is 25-100° C.; The soaking time is 0.5-5 h.

7. The preparation method according to claim 1, wherein: Before the plasma treatment of the woven fabric, the woven fabric is cleaned and dried; After the hydrophobic treatment in step (2), there are steps of washing with water and drying.

8. The braided enzymatic DNA synthesis stationary phase prepared by the preparation method according to any one of claims 1 to 7.

9. Use of the braided enzymatic DNA synthesis stationary phase according to claim 8 in enzymatic DNA synthesis.

Images