Plant immune memory regulation protein, gene and application thereof
The plant immune memory regulatory protein IMM1 and its genes discovered through BTH induction solved the problem of insufficient disease resistance in rice, achieved efficient resistance to rice blast, and maintained the agronomic traits of rice.
Patent Information
- Application Number
- CN202510356246.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-06-24
AI Technical Summary
Rice planting faces many disease threats. Traditional chemical pesticide prevention and control measures have high costs, environmental pollution and resistance problems, and the resistance of existing disease-resistant varieties is prone to failure with the changes in pathogens.
Through BTH induction, a plant immune memory regulatory protein IMM1 and its encoding gene were discovered and provided to improve the disease resistance of rice.
The IMM1 gene is induced by BTH and pathogenic bacteria in rice. After introduction into rice, it significantly improves its resistance to rice blast, and overexpression of IMM1 does not affect the important agronomic traits of rice.
Smart Images

Figure CN120192389A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and more specifically, particularly relates to a plant immune memory regulatory protein, gene and its application. Background Art
[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world, feeding more than half of the global population. However, during the rice planting process, it faces many disease threats, such as rice blast, bacterial blight, sheath blight, etc., resulting in a 10%-15% reduction in production every year, seriously threatening China's food security and the sustainable development of agriculture. Reducing the food losses caused by diseases is one of the important and effective means to ensure China's food security.
[0003] Traditional crop disease control measures mainly achieve through applying chemical pesticides and cultivating disease-resistant varieties. Chemical pesticides can reduce the harm caused by diseases to a certain extent, but the large-scale application brings high costs, environmental pollution and threats to food safety. In addition, the single application can greatly increase the drug resistance probability of pathogens, making the pesticides ineffective. Cultivating disease-resistant varieties using different R genes, the cultivated disease-resistant varieties have high vertical resistance and show high resistance to certain physiological races, but may lose disease resistance as the physiological races of pathogens change.
[0004] As sessile organisms, plants need to face various environmental stresses, including the invasion of pathogenic microorganisms. To cope with these challenges, plants have developed a complex immune system that can recognize and respond to pathogen attacks. The immune response of plants can be divided into two main levels: conserved pathogen-associated molecular pattern-triggered immunity (PTI) and effector-triggered immunity (ETI). In recent years, scientists have found that plants can form an immune memory after experiencing a pathogen attack, making their response to subsequent attacks faster and more effective. This phenomenon is called "plant immune memory". Plants can activate the potential defense mechanisms of the plant itself through relevant elicitors to achieve the purpose of disease prevention, with many advantages such as broad-spectrum, long-lasting, environmentally friendly, easy to use, and not prone to resistant pathogens. Several compounds acting on the salicylic acid (SA) signaling pathway have been discovered and widely used in the control of plant diseases, such as benzothiadiazole (BTH), probenazole (PBZ), etc. The application research of plant immune memory in rice provides a new way to improve the disease resistance of rice.
[0005] Plant induced disease resistance is one of the important self - defense systems, and the related mechanism of BTH - induced immune memory in monocotyledonous plants has not been reported. Summary of the Invention
[0006] In order to solve the above - mentioned technical problems, the present invention provides a key protein induced by BTH in rice and its encoding gene.
[0007] In order to solve the above - mentioned technical problems, the present invention provides the following technical solutions:
[0008] The present invention first provides a plant immune memory regulatory protein IMM1, which is any one of the following:
[0009] A1) A protein with an amino acid sequence shown in SEQ ID No.1;
[0010] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence in A1), having more than 80% identity with the protein shown in A1) and having the same function;
[0011] A3) A fusion protein with the same function obtained by connecting a tag to the N - terminal and / or C - terminal of A1) or A2).
[0012] Furthermore, SEQ ID No.1 consists of 721 amino acid residues.
[0013] Furthermore, in order to facilitate the purification or detection of the protein in A1), a tag protein can be connected to the amino - terminal or carboxyl - terminal of the protein in A1). The tag protein includes but is not limited to the tag proteins listed in Table 1.
[0014] Table 1. Sequences of tags
[0015] Label Residue Sequence Poly-Arg 5 - 6 (usually 5) RRRRR Poly-His 2 - 10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0016] Furthermore, the protein IMM1 in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then biotically expressed. The encoding gene of the protein IMM1 in A2) above can be obtained by deleting and / or missense - mutating the DNA sequence shown in SEQ ID No.2, and / or connecting the encoding sequences of the tags shown in Table 1 to its 5′ - end and / or 3′ - end.
[0017] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding IMM1 of the present invention by using known methods, such as directed evolution and site-directed mutagenesis. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of IMM1 isolated from the present invention, as long as they encode IMM1 and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0018] As used herein, the term "identity" refers to sequence similarity to a native nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No.1 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0019] The above-mentioned identity of 75% or more than 75% can be 80%, 85%, 90% or 95% or more identity.
[0020] The present invention also provides a plant immune memory regulation gene IMM1, and a nucleotide sequence encoding the protein described in claim 1, and the nucleotide sequence is as shown in SEQ ID No.2.
[0021] Furthermore, the present invention also provides the following applications of the protein IMM1 or a biological material that regulates the expression of the gene encoding the protein IMM1 or a biological material that regulates the activity and / or content of the protein IMM1 in at least one of D1)-D6) below:
[0022] D1) Improving the disease resistance of rice;
[0023] D2) Preparing a product for improving the disease resistance of rice;
[0024] D3) Cultivating rice with improved disease resistance;
[0025] D4) Preparing a product for cultivating rice with improved disease resistance;
[0026] D5) Improving highly disease-resistant rice or preparing a product of highly disease-resistant rice;
[0027] D6) Breeding highly disease-resistant rice.
[0028] Further, the regulation of the expression of the protein IMM1-encoding gene may be to enhance the expression of the protein IMM1-encoding gene, up-regulate the expression of the protein IMM1-encoding gene, or increase the expression of the protein IMM1-encoding gene. The regulation of the protein activity and / or content of the protein IMM1 may be to enhance the activity and / or content of the protein IMM1, may be to up-regulate the activity and / or content of the protein IMM1, or may be to increase the activity and / or content of the protein IMM1.
[0029] Further, the biological material is any one of the following:
[0030] B1) A nucleic acid molecule encoding the protein IMM1;
[0031] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0032] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0033] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);
[0034] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2);
[0035] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).
[0036] Further, among the above biological materials, the expression cassette containing the nucleic acid molecule encoding the protein IMM1 (IMM1 gene expression cassette) refers to DNA that can express IMM1 in a host cell, and this DNA may not only include a promoter that initiates the transcription of IMM1, but also include a terminator that terminates the transcription of IMM1.
[0037] Furthermore, the expression cassette may further include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters; tissue-, organ- and development-specific promoters, and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium tumefaciens nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and terminators of nopaline and octopine synthases.
[0038] The recombinant vector containing the IMM1 gene expression cassette can be constructed using existing expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, etc., such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (from CAMBIA), etc. The plant expression vector may also contain the 3′ untranslated region of the foreign gene, that is, it contains the polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3′ end of the mRNA precursor. For example, the genes of Agrobacterium tumefaciens Ti plasmid (such as the nopaline synthase gene Nos) and the 3′ untranslated regions transcribed from plant genes (such as soybean storage protein genes) have similar functions. When constructing a plant expression vector using the gene of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the adjacent region start codon, etc., but must have the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene encoding an enzyme or a luminescent compound that can produce a color change and can be expressed in plants (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (such as the NptII gene conferring resistance to kanamycin and related antibiotics, the bar gene conferring resistance to the herbicide phosphinothricin, the hph gene conferring resistance to the antibiotic hygromycin, and the dhfr gene conferring resistance to methotrexate, the EPSPS gene conferring resistance to glyphosate), or a marker gene for anti-chemical reagents (such as an anti-herbicide gene), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress conditions.
[0039] Among the above biological materials, the vector can be a plasmid, cosmid, phage or viral vector
[0040] Among the above biological materials, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.
[0041] Among the above biological materials, the transgenic plant cell lines do not include propagation materials.
[0042] Furthermore, the disease resistance is broad-spectrum disease resistance, including rice blast and bacterial blight.
[0043] The present invention also provides a method for cultivating transgenic rice with high disease resistance, including transgenic rice obtained by up-regulating, enhancing or increasing the expression level of the gene encoding protein IMM1 or the content of protein IMM1 in the target rice.
[0044] In the above method, the disease resistance of the rice is resistance to stripe rust. The rice blast can be caused by infection with the rice blast physiological race 97-27-2. The resistance to rice blast is specifically embodied in any one of the following (1)-(3): (1) Under the condition of rice blast stress, the sporulation amount of the rice blast fungus infecting the transgenic rice is lower than that of the receptor plant; (2) Under stress conditions, the expression level of the pathogenesis-related genes of the transgenic plant is higher than that of the receptor plant; (3) Under the condition of rice blast fungus stress, the hyphal infection area of the rice blast fungus infecting the transgenic rice is lower than that of the receptor plant.
[0045] Furthermore, the up-regulation, enhancement or increase of the expression level of the gene encoding protein IMM1 or the content of the protein IMM1 in the target rice is to introduce the gene encoding the aforementioned protein IMM1 into the target rice.
[0046] Furthermore, the gene encoding protein IMM1 is introduced into Agrobacterium EHA105 through the recombinant vector 1305-IMM1 containing the expression cassette of the gene encoding protein IMM1; the recombinant vector 1305-IMM1 is obtained by inserting the DNA fragment of IMM1 into the 1305 vector by homologous recombination while keeping other sequences of the 1305 vector unchanged; the vector restriction enzyme sites are BamH 1 and EcoRI.
[0047] In the above method, the transgenic plant is understood to include not only the first-generation transgenic plant obtained by transforming the receptor plant with the IMM1 gene, but also its offspring. For transgenic plants, the gene can be propagated in this species, or the gene can be transferred into other varieties of the same species by conventional breeding techniques, especially including commercial varieties. The transgenic plants include seeds, callus, whole plants and cells.
[0048] The experiments of the present invention prove that the IMM1 gene discovered by the present invention is induced by BTH and pathogenic bacteria, and the transgenic rice obtained by introducing the IMM1 gene into rice has higher resistance to rice blast than wild-type rice. After knocking out the IMM1 gene, the knockout lines lose the ability to be induced by BTH. The protein and gene provided by the present invention provide a basis for artificially controlling the expression of disease resistance-related genes and will play an important role in cultivating plants with broad-spectrum disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 Induced by BTH to improve the resistance of rice to rice blast.
[0050] Figure 2 It is the localization result of IMM1 in rice protoplasts.
[0051] Figure 3 It is the identification result of the IMM1 knockout line. The red letters in the figure represent insertion mutations, and the horizontal lines represent deletion mutations.
[0052] Figure 4 It is the expression pattern of IMM1 and the induced expression analysis. Among them, A is the expression in different tissue parts of seedlings and mature plants; B is the detection of IMM1 expression at the four-leaf stage after BTH seed treatment; C is the detection of IMM1 expression induced by pathogen infection, and the expression of IMM1 in infected and non-infected plants at the four-leaf stage.
[0053] Figure 5 It is the disease resistance identification of IMM1 transgenic rice induced by BTH. Among them, (A) shows the disease phenotypes of NB, IMM1 gene knockout lines (KO1-3), and IMM1 overexpression lines (OE1-3) after inoculation with Magnaporthe oryzae; (B) shows the statistical results of the disease grades of NB, IMM1 gene knockout lines (KO1-3), and IMM1 overexpression lines (OE1-3) after inoculation; (C) shows the relative content of pathogens in the leaves of NB, IMM1 gene knockout lines (KO1-3), and IMM1 overexpression lines (OE1-3) after inoculation.
[0054] Figure 6 The figure shows the field phenotypes of IMM1 transgenic lines. Among them, A is the field phenotype of IMM1 transgenic lines; B-G are the plant heights, tiller numbers, grains per panicle, seed setting rates, 1000-grain weights, and panicle lengths of transgenic lines and the control in the field; the analysis method is one-way ANOVA test, and different capital letters represent extremely significant differences, P < 0.01, n = 20. Specific implementation manners
[0055] The present invention will be further described in detail below in combination with specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0056] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.
[0057] The GFP (green fluorescent protein) vector in the following examples is described in the literature "Molecular Characterization and Functional Identification of Foxtail Millet WRKY36 Transcription Factor [J]. Scientia Agricultura Sinica, 2015, 48(5): 851-860.", and the public can obtain it from the Shandong Academy of Agricultural Sciences.
[0058] The RFP (red fluorescent protein) in the following examples is described in the literature "Shaner N C, Campbell R E, Steinbach P A, et al. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein [J]. Nature biotechnology, 2004, 22(12): 1567-1572.", and the public can obtain it from the Shandong Academy of Agricultural Sciences.
[0059] The HAK1 protein in the following examples is described in the literature "Li Weihong. Functional Analysis of OsHAK Potassium Transporter in Rice Fertility and Potassium-Sodium Balance [D]. Nanjing Agricultural University, 2020. DOI: 10.27244 / d.cnki.gnjnu.2020.001952.", and the public can obtain it from the Shandong Academy of Agricultural Sciences.
[0060] The rice blast physiological race 97-27-2 in the following examples has been disclosed in the literature "Peng H, Zhang Q, Li Y, et al. A putative leucine-rich repeat receptor kinase, OsBRR1, is involved in rice blast resistance [J]. Planta, 2009, 230: 377-385.". The public can obtain it from the Shandong Academy of Agricultural Sciences.
[0061] The rice materials Nipponbare and the rice blast physiological race 97-27-2 in the following examples have been disclosed in the literature "Zhang Lingli. Molecular Mechanism of miR156 and miR535 Coordinating Rice Blast Resistance and Yield Traits [D]. Sichuan Agricultural University, 2020. DOI: 10.27345 / d.cnki.gsnyu.2020.000061.". The public can obtain it from the Shandong Academy of Agricultural Sciences.
[0062] Cellulase R10 (YaKult Honsha), cellulase (Yakult, C6270-1g); Mecerozyme R10 (YaKult Honsha), pectinase (Rongxing Bio, RX-L0042-100mg); Mannitol (Beijing Mengyimei Trading Center, M0122-500g); KOH (Beijing Xiyang Huizhi Technology Co., Ltd., XYHZ-2017-05185); KCl (Beijing Baoruijie Technology Co., Ltd., 7447-40-7); MES (Beijing Bayerd Biotech Co., Ltd., DE-E169-100g); CaCl2 (Beijing Bayerd Biotech Co., Ltd., 031-00435); NaCl (Beijing Bayerd Biotech Co., Ltd., 7647-14-5); MgCl2 (Beijing Bayerd Biotech Co., Ltd., DE-0288-500g); Glucose (Beijing Bayerd Biotech Co., Ltd., 049-31165); PEG4000 (Beijing Bayerd Biotech Co., Ltd., BR-0084); BSA bovine serum albumin (Beijing Zeping Technology Co., Ltd., 0219989980); β-Mercaptoethanol (Beijing Readbio Technology Co., Ltd., 0482-100ml).
[0063] The reagent formulations used in the following examples are as follows:
[0064] Table 2. Cellulase Hydrolysate Formulation
[0065]
[0066] Table 3. PEG4000 Solution
[0067]
[0068] Table 4. W5 Solution (1000 mL)
[0069] Reagent Mass Final concentration NaCl 9g 154 mM <![CDATA[CaCl2·2H2O]]> 18.4g 125 mM KCl 0.37g 5 mM Glucose 0.9g 5 mM MES 0.3g 0.03%
[0070] Adjust the pH to 5.8 with KOH, autoclave for 20 min, and store at room temperature.
[0071] Table 5. MMG Solution (500 mL)
[0072] Reagent Mass Final concentration <![CDATA[MgCl2]]> 0.71g 15 mM MES 0.5g 0.1% Mannitol 0.37g 0.4M
[0073] Adjust the pH to 5.6 with KOH, autoclave for 20 min, and store at room temperature.
[0074] Table 6. WI Solution (200 mL)
[0075] Reagent Mass Final concentration Mannitol 18.2g 0.5M MES (pH 5.7) 0.3g 4 mM KCl 0.12g 20 mM
[0076] Autoclave for 20 min and store at room temperature.
[0077] Example 1. Obtaining of IMM1 Protein and Its Encoding Gene
[0078] I. Isolation of mRNA and Amplification of IMM1
[0079] Take the seedlings of 7-day-old normal-growing Nipponbare rice, quickly freeze them with liquid nitrogen, and store them at -80 °C for later use.
[0080] Extract the total RNA of rice leaves using a polysaccharide polyphenol plant RNA extraction kit (Huayueyang Biotechnology Co., Ltd.), and use reverse transcriptase XL (AMV) for the first-strand cDNA synthesis. Synthesize cDNA by the SMART method. Using this cDNA as a template, perform PCR with IMM1-F and IMM1-R as primers. Detect the PCR product by 1.0% agarose gel electrophoresis to obtain a 2274-bp PCR product. The amplification primers are:
[0081] IMM1-F: 5`-ATGCCTCCCCACAGAAATGCAGCTA-3`;
[0082] IMM1-R: 5`-TCATCTGGCAAATTCTGTGCTCATC-3`.
[0083] After sequencing, this PCR product has the nucleotides shown in Sequence 2 (SEQ ID No.2) in the sequence listing. These nucleotides
[0084] have the gene named IMM1 gene. The nucleotide sequence of this gene is Sequence 2 (SEQ ID No.2) in the sequence listing.
[0085] The amino acid sequence of the encoded protein is shown in Sequence 1 (SEQ ID No.1) in the sequence listing. This protein is named IMM1 protein. The genomic sequence of the IMM1 gene is as shown in SEQ ID No.3.
[0086] SEQ ID No.1 (758AA)
[0087]
[0088] SEQ ID No.2 (2274bp)
[0089]
[0090]
[0091] SEQ ID No.3 (7310 bp)
[0092]
[0093]
[0094]
[0095]
[0096]
[0097] II. Detection of the induced expression of IMM1 by BTH and Magnaporthe oryzae using RT-PCR
[0098] 1. Preparation of experimental materials
[0099] For the inoculation of rice blast, the method described by (Zhu Yajun, et al. Analysis of blast resistance genes in japonica rice variety Jijing 809 [J]. Acta Agronomica Sinica, 2016, 42(11): 1638-1646.) was referred to. Rice at the three-leaf and one-heart stage was sprayed with BTH (20 μM), and sterile water was used as a control. After 24 h, the spores of Magnaporthe oryzae were sprayed at a concentration of 1×10 5 cells / mL, and then incubated in an incubator at 25 °C with 100% relative humidity for 24 h, and then placed in a greenhouse for cultivation at 25-28 °C.
[0100] Samples were taken at 0 h, 24 h, 48 h, and 72 h after inoculation, and the sampling time points of the control were consistent with those of the treatment. When sampling, fresh leaves were cut, wrapped with tin foil, quickly frozen in liquid nitrogen, and then stored at -80 °C for later use. Total RNA of rice leaves was extracted using the Trizol method (TianGen), and the first-strand cDNA was synthesized using reverse transcriptase XL (AMV). cDNA was synthesized using the SMART method.
[0101]
[0102] 2. Detection of the expression level of IMM1 by RT-PCR
[0103] Specific quantitative PCR primers were designed according to the sequences of rice IMM1 and UBQ genes (Os06g0681400). The specific sequences are as follows:
[0104] RT-PCR primer sequences are:
[0105] Q-IMM1-F: 5’-GCAAATGCATGACGTAAACATG-3’
[0106] Q-IMM1-R: 5’-GACACCAAGAAGCAAGTTTCTT-3’.
[0107] Q-UBQ-F: 5'-GGAGCTGCTGCTGTTCTAGG-3'
[0108] Q-UBQ-R: 5'-TTCAGACACCATCAAACCAGA-3'
[0109] The specificity and amplification efficiency (≥90%) of the amplification products of the quantitative PCR primers need to be detected before use. OsUBQ is used as an internal reference gene in Real-time PCR analysis. Using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and an ABI 7500 quantitative PCR instrument, referring to the instructions, real-time quantitative PCR amplification was performed with the cDNA of each treatment sampling point as a template. Each reaction was repeated at least 3 times, and the Ct values, their averages, and standard deviations of each repetition were generated by the quantitative PCR instrument by manually adjusting the baseline. Each reaction was repeated 3 times, and the average Ct value was taken. The 2 -△△Ct method was used to analyze the experimental data to determine the relative expression level of the gene.
[0110] IMM1 is up-regulated in Nipponbare rice after BTH induction or pathogen infection.
[0111] The results of qRT-PCR are as Figure 1 shown. It can be Figure 1 seen that with the increase in the BTH treatment concentration, the resistance of rice to Magnaporthe oryzae increases and the disease severity decreases; through two independent experiments, Experiment1 and Experiment2, the relative DNA content of the pathogen in the leaves was detected, and it was found that with the increase in the BTH treatment concentration, the DNA content of Magnaporthe oryzae in the leaves decreased, indicating a decrease in the disease severity of Magnaporthe oryzae.
[0112] III. Subcellular localization analysis of IMM1
[0113] 1. Vector construction
[0114] The PCR product IMM1 fragment amplified in the above "I. Isolation of mRNA and amplification of IMM1" was ligated to the GFP (green fluorescent protein) vector digested with BamH I to obtain the recombinant vector IMM1-GFP, which can express the fusion protein IMM1-GFP.
[0115] The primer sequences of IMM1-GFP for IMM1 subcellular localization are as follows:
[0116] IMM1-GFP-F: 5’-AGATCCAGTGGGATCCATGGGAGATTGGTATGATAAACTTT-3’
[0117] IMM1-GFP-R: 5’-CCGCACTAGTAAGCTTGCTACTGGCAGACTTGGCACT-3’.
[0118] 2. Protoplast Preparation
[0119] Method for preparing and transforming rice leaf protoplasts:
[0120] (1) Sow Nipponbare in the culture room and incubate it in the dark for 10 - 15 days. Immerse the leaf sheaths in 0.6 M Mannitol and quickly cut the leaf sheaths into segments less than 1 mm with a sharp blade. Immediately transfer the cut leaf sheaths into the enzyme solution in Table 2 that has been prepared. Generally, the leaf sheaths of 50 etiolated seedlings are digested with 10 mL of enzyme solution, and at least 5 plasmid combinations can be transformed. For more transformations, the corresponding reaction system can be enlarged.
[0121] (2) Use a vacuum pump to evacuate in the dark (wrapped with tin foil) for 30 minutes. Prepare the PEG4000 solution shown in Table 3, and remove the tips of 200 μL and 1000 μL pipette tips to make the pipetting gentle during operation.
[0122] (3) Without shaking at room temperature, continue to shake at 28 °C and 50 rpm in the dark for at least 3 hours. When the enzyme solution turns green, gently shake the culture dish to promote the release of protoplasts.
[0123] (4) Examine the protoplasts in the solution under a microscope. The size of rice mesophyll protoplasts is approximately 30 - 50 μm.
[0124] (5) Dilute the enzyme solution containing protoplasts with an equal volume of the W5 solution (pre-cooled) shown in Table 4 before filtering out the undissolved leaves.
[0125] (6) First moisten a nylon membrane with a pore size of 35 - 75 μm or a 60 - 100 mesh sieve with the W5 solution, and then use it to filter the enzyme solution containing protoplasts.
[0126] (7) Centrifuge the protoplasts at 100 g for 1 - 2 minutes at 4 °C using a 30 mL round-bottom centrifuge tube, and precipitate the protoplasts. Try to remove the supernatant as much as possible. Then gently resuspend the protoplasts with 10 mL of W5 solution pre-cooled on ice.
[0127] (8) Let the protoplasts stand on ice for 30 minutes.
[0128] (9) The following operations are carried out at room temperature of 23 °C
[0129] (10) Centrifuge at 100 g for 8 - 10 min to precipitate the protoplasts. Remove the W5 solution as much as possible without disturbing the protoplast pellet. Then resuspend the protoplasts in an appropriate amount of MMG solution (1 mL) to a final concentration of 2×10 5 cells / ml.
[0130] (11) Add 10 μL or 20 μL of DNA (10 - 20 μg of the recombinant vector IMM1 - GFP approximately 5 - 10 kb) into a 2 mL EP tube.
[0131] (12) Add 100 μL of protoplasts (2×10 4 cells), and gently mix.
[0132] (13) Add 110 μL of PEG solution, gently tap the centrifuge tube to mix well (about 6 - 10 samples can be transformed each time). Incubate the transformation mixture for 20 - 30 min (the transformation time depends on the experimental conditions, and a longer transformation time may be required for higher expression levels).
[0133] (14) Dilute the transformation mixture with 400 - 440 μL of W5 solution at room temperature, then gently invert and shake the centrifuge tube to mix well to terminate the transformation reaction.
[0134] (15) Centrifuge at 100 g for 2 min at room temperature, then remove the supernatant. Add 1 mL of W5 solution to resuspend and wash once, centrifuge at 100 g for 2 min and remove the supernatant.
[0135] (16) Gently resuspend the protoplasts in 1 mL of WI solution in a multi - well tissue culture dish.
[0136] (17) Incubate the protoplasts for more than 18 hours at room temperature (20 - 25 °C).
[0137] Use the transfection of the HAK1 - GFP vector as a control. Then observe the expression of the GFP tag under a laser confocal microscope.
[0138] 3. Microscopic examination of rice protoplasts:
[0139] Press the protoplasts after 18 h of dark incubation onto a slide, and then observe the GFP (green fluorescent protein) fluorescence under a laser scanning confocal microscope (Bio - Rad MicroRadiance) (Laser scanning confocal microscopy, LSMC) and perform scanning photography. The working parameters of the LSCM are: Ex = 488 nm, Em = 525 ± 15 nm, Power = 10%, Zoom 7, medium - speed scanning, Frame 512×512. The software is TIME - COURSE and PHOTOSHOP 5.0.
[0140] The results are shown in Figure 2 (scale bar = 10 μm). From left to right are the protoplasts transfected with the recombinant vector IMM1-GFP, the protoplasts transfected with the recombinant vector HAK1-RFP, the fusion of the two, white light. It can be seen from the figure that IMM1 is localized to the cell membrane, and IMM1 co-localizes with the membrane localization marker HAK1 on the cell membrane.
[0141] Example 2. Application of the IMM1 gene in maintaining rice immune memory and improving disease resistance
[0142] I. Obtaining of IMM1 transgenic rice
[0143] 1. Construction of the IMM1 gene overexpression vector
[0144] The specific construction method of the IMM1 overexpression vector is as follows:
[0145] Using IMM1-F and IMM1-R as primers, and the full-length CDS of IMM1 amplified in the first part of Example 1 as a template for PCR amplification. The amplified fragment (with the nucleotides shown in SEQ ID No. 2 from 1 to 2274 in the sequence listing) was homologously recombined into the vector digested with BamH I using the ClonExpress II One Step Cloning Kit (vazyme) to obtain the recombinant vector IMM1-OE. This recombinant vector IMM1-OE is a recombinant vector obtained by inserting the nucleotide sequence from 1 to 2274 in SEQ ID No. 2 into the overexpression vector while keeping the remaining bases unchanged.
[0146] In-IMM1-F:
[0147] 5`-AGATCCAGTGGGATCCATGGGAGATTGGTATGATAAACTTT-3`
[0148] In-IMM1-R:
[0149] 5`-CCGCACTAGTAAGCTTGCTACTGGCAGACTTGGCACT-3`. Note: The underlines indicate the BamHI restriction site.
[0150] 2. Construction of the CRISPR / Cas9 vector for the gRNA site of the IMM1 gene
[0151] 1) Digest the CRPSPR / Cas9 vector with AarI (purchased from Thermo Fisher Scientific), recover the linearized fragment of about 15 kb in size, and name it CRISPR / Cas9(AarI). CTTGTGAAGCACCTAACATT
[0152] 2) Taking the designed gRNA1 site as an example, synthetic primers are prepared.
[0153] gRNA1-F: 5’- AGATGATCCGTGGCA CTTGTGAAGCACCTAACATT GTTTTAGAGCTATGC -3’, where the underlined part is the In-Fusion enzyme linker.
[0154] gRNA1-R: 5’- GCATAGCTCTAAAAC AATGTTAGGTGCTTCACAAG TGCCACGGATCATCT -3’
[0155] 3) Dilute gRNA1-F and gRNA1-R to 10 pmol. Add 1 μl of each to a PCR tube, and then add 8 μl of H2O. Incubate at 94 °C for 10 min, anneal at 0.1 °C / s to 15 °C, and maintain at 15 °C for 10 min to complete annealing.
[0156] 4) Take 1 μl of the sample obtained in step 3), perform infusion with CRISPR / Cas9 (AarI), transfer it into DH5α, and spread it on SPEC solid medium.
[0157] 5) Pick monoclonal colonies and sequence them with the primer Seq-gRNA: CGACAATCTGATCCAAGCTCA to obtain correct monoclonal colonies. Obtain the CRISPR / Cas9 vector for the gRNA2 site in the same way.
[0158] 3. Obtaining of IMM1 gene transgenic rice
[0159] Infect the callus of Nipponbare with the recombinant vector IMM1-OE to obtain T0 generation IMM1 gene transgenic rice. Cultivate the T0 generation IMM1 gene transgenic rice until two lines of T3 generation IMM1 gene transgenic rice are obtained.
[0160] 4. Verification of CRISPR / Cas9 editing of the IMM1 gene
[0161] Genomic DNA was extracted from the T0 generation seedlings of the transgenic CRISPR / Cas9-gRNA1 plants and the seedlings of the recipient parent rice Nipponbare (abbreviated as WT), and PCR was performed using the primer Am-IMM1-F (5’-CCTCAAAGAAACAGGGCCTT-3’) and the primer Am-IMM1-R (5’-GCAATCTGGAAGCGTGTCTC-3’). A 558 bp fragment was obtained, recovered, and sequenced using the primer Seq-IMM1-F: TCACGAATTTGCAGGCACAA. The sequencing result of WT was used as a reference and compared with the sequencing result of the T0 seedlings. If a sequence difference was found, the edited T0 generation seedlings were obtained.
[0162] 4. Verification of IMM1 regulating plant immune memory
[0163] As Figure 4 shown, BTH can significantly improve the resistance of rice to Magnaporthe oryzae in the background of wild-type Nipponbare and overexpression lines. After knocking out IMM1, rice loses the ability to be induced by BTH; and the basal resistance of the IMM overexpression transgenic lines is stronger than that of wild-type Nipponbare.
[0164] Therefore, it can be seen that IMM1 is a key gene that can improve the resistance of rice to Magnaporthe oryzae and participate in the regulation of rice immune memory.
[0165] 5. Overexpression of IMM1 does not affect important agronomic traits
[0166] There is an inherent trade-off mechanism between plant growth and defense, which makes it a challenge to improve disease resistance without compromising growth and yield. Especially in the process of molecular breeding for disease resistance, problems such as growth and yield penalty are often encountered when improving disease resistance. Therefore, developing and using high-quality genes that can balance disease resistance and plant growth is a necessary strategy. As Figure 6 shown, this study found that there were no significant differences in agronomic traits and yield-related traits between the IMM1-OE lines and the wild type in the field experiment, indicating that this gene is expected to provide valuable gene resources for rice molecular breeding. High-expression or high-activity breeding materials of IMM1 can be obtained through mutant or genotype screening, providing germplasm resources for disease-resistant breeding.
[0167] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made by using conventional techniques known in the art.
Claims
1. A plant immune memory regulatory protein IMM1, characterized in that Any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID No. 1; A2) a protein having more than 80% identity with the protein shown in A1) and having the same function as that of the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of A1); A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).
2. The plant immune memory regulatory protein IMM1 according to claim 1, characterized in that: The tag is any one of the following: Poly-Arg with a sequence of RRRRR, Poly-His with a sequence of HHHHHH, FLAG with a sequence of DYKDDDDK, Strep-tag II with a sequence of WSHPQFEK, and c-myc with a sequence of EQKLISEEDL.
3. A plant immune memory regulatory gene IMM1, characterized in that: A nucleotide sequence encoding the protein according to claim 1, the nucleotide sequence being shown in SEQ ID No.
2.
4. Use of protein IMM1 or a biological material that regulates the expression of a gene encoding the protein IMM1 or a biological material that regulates the activity and / or content of protein IMM1 in at least one of the following D1) to D6): D1) Improve rice disease resistance; D2) preparing products for improving rice disease resistance; D3) Cultivate rice with improved disease resistance; D4) preparing products for breeding rice with improved disease resistance; D5) Improving highly disease-resistant rice or preparing highly disease-resistant rice products; D6) Breeding of rice with high disease resistance.
5. The use according to claim 4, characterized in that: The biological material is any of the following: B1) a nucleic acid molecule encoding the protein IMM1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).
6. The use according to claim 4, characterized in that: In the above biological materials, the expression cassette containing the nucleic acid molecule encoding the protein IMM1 refers to a DNA capable of expressing IMM1 in a host cell, and the DNA may include not only a promoter for initiating IMM1 transcription, but also a terminator for terminating IMM1 transcription.
7. The use according to claim 4, characterized in that: The disease resistance is broad-spectrum disease resistance, including rice blast and bacterial blight.
8. A method for cultivating highly disease-resistant transgenic rice, characterized in that: The invention comprises transgenic rice obtained by up-regulating, enhancing or increasing the expression amount of the protein IMM1 coding gene or the content of the protein IMM1 in the target rice.
9. The method for cultivating highly disease-resistant transgenic rice according to claim 8, characterized in that: The up-regulation, enhancement or increase of the expression level of the gene encoding the protein IMM1 or the content of the protein IMM1 in the target rice is to introduce the gene encoding the protein IMM1 into the target rice.
10. The method for cultivating highly disease-resistant transgenic rice according to claim 8, characterized in that: The coding gene of protein IMM1 is introduced into Agrobacterium EHA105 through a recombinant vector 1305-IMM1 containing a protein IMM1 coding gene expression cassette; the recombinant vector 1305-IMM1 inserts the DNA fragment of IMM1 into the 1305 vector by homologous recombination and keeps other sequences of the 1305 vector unchanged; the vector restriction sites are BamH 1 and EcoR I.