Hansenula polymorpha Y3 and application thereof
Through screening and identification of yeast Y3 of the Sporodonus, this strain has a significant antibacterial effect on the gizzard cavity bacteria, solving the problem of preventing and treating soft rot after harvest of kiwi fruit, and achieving a biological control effect that reduces the incidence of disease.
Patent Information
- Application Number
- CN202510463744.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-06-24
AI Technical Summary
After-harvest soft rot of kiwi fruit causes serious economic losses to the kiwi fruit industry. The existing chemical control methods lead to increased resistance to pathogenic bacteria, and physical control such as low-temperature storage has an adverse impact on the nutritional quality of the fruit.
A strain of yeast yeast Y3 with sporodonus was screened and identified. This strain has antibacterial effect on the citrus cavity bacteria, and as an antagonist bacteria, it can reduce the incidence of soft rot after harvest of kiwi fruit.
The antibacterial rate of yeast Y3 of yeast yeast Y3 on the saccharomyces reached 74.1%, significantly reducing the incidence of soft rot after harvest of kiwi fruit and providing a new, long-lasting and stable biological control method.
Smart Images
Figure CN120192860A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microorganisms and their applications, and relates to a strain of Hanseniaspora uvarum Y3 and its applications. Background Art
[0002] Kiwifruit is a perennial dioecious vine native to China, Japan, Korea and other countries. Due to its rich nutritional value and various health benefits, it has become a popular fruit globally. Shaanxi is the main production area of kiwifruit in China, and Cuixiang kiwifruit is an important variety of kiwifruit in China. However, kiwifruit is susceptible to various diseases before and after harvest. Postharvest soft rot of kiwifruit is one of the main diseases affecting the fruit quality of kiwifruit, mainly caused by Botryosphaeria dothidea. This disease has caused a serious economic decline in the kiwifruit industry.
[0003] Currently, the prevention and control measures for postharvest soft rot of kiwifruit mainly rely on chemical control. Referring to the reference "Evaluation of the control effects of different fungicides on the soft rot pathogen of kiwifruit", the indoor toxicity of 8 fungicides against the soft rot pathogen Botryosphaeria dothidea of kiwifruit was evaluated, and all the fungicides used were chemical fungicides. Although chemical fungicides have a relatively low cost and are relatively easy to operate, and have a certain degree of control effect on postharvest soft rot of kiwifruit, the long-term use of chemical fungicides will cause the pathogen to develop drug resistance, resulting in an increasing dosage of the drug and an increase in the residue of chemical fungicides on the fruit. In addition, physical control also accounts for a certain proportion in controlling postharvest soft rot of kiwifruit. Although physical control (such as low-temperature storage) can weaken the respiratory intensity of the fruit, delay postharvest ripening and senescence, and prevent postharvest soft rot of kiwifruit, during the low-temperature storage process, when the storage temperature is lower than the temperature control range of the fruit itself, it will cause low-temperature injury, i.e., chilling injury, to the fruit, and further affect the nutritional quality of the fruit to a certain extent. Therefore, it is necessary to find new ways to prevent and control postharvest soft rot of kiwifruit.
[0004] In recent years, the use of biological control of plant diseases has become a new research hotspot. Biological control is a control method that uses beneficial organisms or other organisms to inhibit or eliminate harmful organisms, which is the result of the interaction between species. The characteristics of biological control are that the control effect is persistent and stable, there is no drug resistance, no pollution, and no harm to the fruit, etc. As a control method of biological control, antagonistic bacteria mainly inhibit the growth of pathogenic bacteria by competing for nutrients and space with pathogenic bacteria through antagonistic effects, secreting antibacterial substances, etc., and at the same time inducing the activity of related enzymes in the fruit, further enhancing the disease resistance of the fruit, making it more dominant in the biological control of plant diseases.
[0005] Therefore, how to screen out an antagonistic bacterium that can effectively prevent and control the post-harvest soft rot disease of kiwifruit is an important research topic in current R & D. Summary of the Invention
[0006] Based on the technical problems mentioned in the background art regarding the chemical and physical control of post-harvest soft rot disease of kiwifruit, the present invention provides a strain of Hanseniaspora uvarum Y3 and its application.
[0007] The present invention screens and identifies a strain of Hanseniaspora uvarum Y3, which can inhibit the growth of Botryosphaeria dothidea. As an antagonistic bacterium, it can reduce the incidence of post-harvest soft rot disease of kiwifruit, providing a new method for the prevention and control of post-harvest soft rot disease of kiwifruit.
[0008] A strain of Hanseniaspora uvarum Y3, with the Latin name Hanseniaspora sp.Y3, was deposited at the China Center for Type Culture Collection on February 19, 2025, with the deposit number CCTCC M2025252.
[0009] Further defined, the 18S rRNA sequence of Hanseniaspora uvarum Y3 is as shown in SEQ No.1.
[0010] Further defined, the colony morphology of Hanseniaspora uvarum Y3 is as follows: The colony morphology of Hanseniaspora uvarum is that the colony surface is smooth, without irregular morphologies such as protrusions, depressions, folds or granularity, the colony color is mostly white to milky white, with uniform color. Under microscopic observation, the cells are oval-shaped with relatively sharp ends.
[0011] Further defined, Hanseniaspora uvarum Y3 enters the logarithmic growth phase at 4 h and is in the growth stable phase at 28 - 32 h.
[0012] Further defined, the application of the said Hanseniaspora uvarum Y3 in preventing and controlling post-harvest soft rot disease of kiwifruit.
[0013] Further defined, the application of the said Hanseniaspora uvarum Y3 in preventing and controlling post-harvest soft rot disease of kiwifruit by inhibiting Botryosphaeria dothidea.
[0014] An antagonistic bactericide for preventing and controlling post-harvest soft rot disease of kiwifruit, comprising the said Hanseniaspora uvarum Y3.
[0015] It can be understood that: the antagonistic bactericide includes Hanseniaspora uvarum Y3; the antagonistic bactericide also includes other common microbial bacteria that have an inhibitory effect on post-harvest soft rot disease of kiwifruit. These common microbial bacteria are mixed and compounded with Hanseniaspora uvarum Y3 to jointly inhibit Botryosphaeria dothidea and play a role in preventing and controlling post-harvest soft rot disease of kiwifruit.
[0016] Compared with the prior art, the beneficial effects of the present invention are:
[0017] 1. A strain of antagonistic bacterium was screened from healthy kiwifruit fruits in the present invention. After identification, the strain was Hanseniaspora sp. Y3, with the Latin name Hanseniaspora sp. Y3, and was deposited at the China Center for Type Culture Collection on February 19, 2025, with the deposit number CCTCC M2025252. The antagonistic bacterium has a good antibacterial effect on Botryosphaeria dothidea and can be used for the prevention and control of postharvest soft rot of kiwifruit.
[0018] 2. Through research, it was found in the present invention that the antibacterial rate of Hanseniaspora sp. Y3 against Botryosphaeria dothidea reached 74.1%. As an antagonistic bacterium, it can reduce the incidence of postharvest soft rot of kiwifruit and provide a new method for the prevention and control of postharvest soft rot of kiwifruit. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 For the comparison result of the phylogenetic tree;
[0020] Figure 2 For the plate diagram of strain Y3;
[0021] Figure 3 For the growth curve of strain Y3;
[0022] Figure 4 For the comparison result of the growth amounts of strain Y3 in different culture media;
[0023] Figure 5 For the antibacterial effect diagram of the volatile substances of strain Y3 against Botryosphaeria dothidea. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0024] The technical solutions of the present invention will be further described below with reference to the drawings and embodiments.
[0025] Unless otherwise defined, the technical terms or scientific terms used in the present invention shall have the ordinary meanings understood by those of ordinary skill in the field to which the present invention belongs.
[0026] For technologies, methods and equipment known to those of ordinary skill in the relevant fields, they may not be discussed in detail, but under appropriate circumstances, the said technologies, methods and equipment shall be regarded as part of the specification.
[0027] It should also be understood that the above-mentioned specific embodiments are only used to explain the present invention, and the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solutions and inventive concepts of the present invention, makes equivalent substitutions or changes, and should be covered within the protection scope of the present invention.
[0028] Example 1
[0029] The purpose of this example is to screen and identify a strain of antagonistic bacterium from healthy kiwifruit fruits.
[0030] 1.1 Screening of antagonistic strains
[0031] 1) Pick healthy kiwifruit from orchards in Zhouzhi County, Xi'an City, Shaanxi Province;
[0032] 2) Disinfect the surface of the kiwifruit, rinse it thoroughly, and then put it into phosphate buffer solution. Ultrasonically clean it for 30 min to obtain the washing solution;
[0033] 3) Dilute the washing solution to 1×10 7 cfu / mL, and then spread it on LB medium and PDA medium respectively. Place the LB medium in an incubator at 37°C for cultivation, and place the PDA medium in an incubator at 28°C for 3 - 4 days;
[0034] 4) Place the cultured plates in a laminar flow hood. Use an inoculation loop to pick the bacteria at the edge of the colony and inoculate them on the above two media until single colonies are obtained; then place the LB medium in an incubator at 37°C for cultivation, and place the PDA medium in an incubator at 28°C for cultivation;
[0035] 5) Rinse the cultured plates with sterile water to obtain a bacterial suspension, and adjust its concentration to 1×10 7 cfu / mL for standby;
[0036] 6) Use a 5 - mm puncher to punch holes in the center of the plate. Add 5 μL of the spore suspension of the pathogen (Botryosphaeria dothidea, denoted as pathogen P) into the holes. After 2 h, add 5 μL of the bacterial suspension. The CK group adds 5 μL of sterile water. Observe the growth of the pathogen after 5 days of cultivation, and screen out the colonies with obvious antibacterial effects on pathogen P, that is, the antagonistic strains, denoted as strain Y3, and then identify and preserve them.
[0037] 1.2 Identification of strain Y3
[0038] Entrust Shanghai Sangon Biotech Co., Ltd. to determine the gene sequence of the antagonistic strain, and conduct a homology comparison of the sequencing results in the GenBank nucleic acid database.
[0039] In this example, a nucleotide sequence fragment of about 720 bp was obtained by PCR amplification and sequencing of strain Y3.
[0040] The primers used for PCR amplification are as follows:
[0041] ITS1: TCCGTAGGTGAACCTGCGG;
[0042] ITS4 - R: TCCTCCGCTTATTGATATGC.
[0043] The reaction system for PCR amplification is as follows: 12.5 μL of 10×PCR Buffer Mix, 1 μL of Template, 1 μL each of forward and reverse primers, and made up to 25 μL with ddH2O.
[0044] The procedure for PCR amplification is: 95°C for 5 min, 94°C for 30 s, 57°C for 30 s, 72°C for 90 s, for 30 cycles; extension at 72°C for 10 min; and finally incubation at 4°C.
[0045] After PCR amplification, the 18S rRNA nucleotide sequence of strain Y3 is as follows:
[0046] ACTGCGGAAGGATCATTAGATTGAATTATCTTGTTGCTCGAGTTCtTGTT
[0047] TAGATCTTTTACAATAATGTGTATCTTTATTGGAGATGTGCGCTTAATTGCGC
[0048] TGCTTCATTAGAGTGTCGCAGTAGAAGTAGTCTTGCTTGAATCTCAGTCAA
[0049] CGTTTACACACATTGGAGTTTTTTACTTTAATTTAATTCTTTCTGCTTTGAAT
[0050] CGAAAGGTTCAAGGCAAAAAACAAACACAAACAATTTTATTTTATTATAAT
[0051] TTTTTAAACTAAACCAAAATTCCTAACGGAAATTTTAAAATAATTTAAAACT
[0052] TTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTG
[0053] CGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGC
[0054] ACATTGCGCCCTTGAGCATTCTCAAGGGCATGCCTGTTTGAGCGTCATTTC
[0055] CTTCTCAAAAGATAATTTTTTATTTTTTGGTTGTGGGCGATACTCAGGGTTA
[0056] GCTTGAAATTGGAGACTGTTTCAGTCTTTTTTAATTCAACACTTAGCTTCTT
[0057] TGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTTATTCGTTTTACTTTA
[0058] CAAGGGAAATGGTAATGTACCTTAGGCAAAGGGTTGCTTTTAATATTCATC
[0059] AAGTTGACCTCAAATCAGTAGGATTACCCGCTGAACTTAAGCATATCA
[0060] The nucleotide sequence fragment structure after the above PCR amplification was subjected to BLAST homology alignment in the GenBank database, and based on the DNA sequence, a phylogenetic tree was constructed by the neighbor-joining method using MEGA 7.0. The results are as Figure 1 shown. Meanwhile, the plate map of strain Y3 is as Figure 2 shown.
[0061] See Figure 1 , the gene sequence homology of strain Y3 is closest to Hanseniaspora_pseudoguilliermondii; see Figure 2 , the colony morphology of strain Y3 is that the colony surface is smooth, without irregular morphologies such as protrusions, depressions, wrinkles or granularity, and the colony color is mostly white to milky white with uniform color.
[0062] Combining the phylogenetic tree and the morphology of the antagonistic strain, strain Y3 was identified as Hanseniaspora sp. Y3, with the Latin name Hanseniaspora sp.Y3, and was deposited in the China Center for Type Culture Collection on February 19, 2025, with the deposit number CCTCC M 2025252.
[0063] In this example, the growth curve of strain Y3 was further determined.
[0064] The method for determining the growth curve was as follows: Strain Y3 was inoculated into PDB medium and cultured under the conditions of a shaker at 27 °C and 170 rpm. The fermentation broth was taken every 4 hours, and its growth amount was observed under a microscope. At the same time, three groups were repeated, and then the growth curve of the strain was plotted. The growth curve of the antagonistic strain is as Figure 3 shown.
[0065] See Figure 3, strain Y3 enters the logarithmic growth phase at about 4 h and is in the growth stable phase from 28 to 32 h. The growth cycle of the antagonistic strain is short, with high production efficiency, and is suitable for industrial production. At the same time, the measurement time of the subsequent cell concentration is measured at the 28th h after inoculation of Y3.
[0066] In this example, the culture medium of strain Y3 was further screened.
[0067] Take strain Y3 to make a bacterial suspension, and inoculate equal amounts of the bacterial suspension into equal amounts of YEPD medium, PDB medium, yeast minimal medium and yeast complete medium respectively, and then carry out fermentation culture on a shaker; the fermentation temperature is 28 °C, the initial pH is 5.5, the shaker speed is 170 rpm, take the fermentation broth in the logarithmic growth phase of the strain, and observe its growth amount under a microscope. The results are as Figure 4 shown.
[0068] The formulations of the above four culture media are as follows. It should be noted that the percentages given in the following formulations refer to mass fractions.
[0069] (1) The YEPD medium includes YEPD liquid medium and YEPD solid medium. The formulation of YEPD liquid medium is: 1% yeast extract, 2% glucose, 2% peptone, and the rest is made up with distilled water. The formulation of YEPD solid medium is: add 2% agar to YEPD liquid medium, and the rest is made up with distilled water.
[0070] (2) The formulation of yeast minimal medium is: 0.1% yeast extract, 0.025% (NH4)2SO4, 0.025% MgSO4, 2% glucose and 0.05% K2HPO4, and the rest is made up with distilled water.
[0071] (3) The formulation of yeast complete medium is: 2.5% sucrose, 0.05% FeSO4, 0.05% MgSO4, 0.5% ZnSO4, 0.05% K2HPO4, 0.3% (NH4)2SO4, and the rest is made up with distilled water.
[0072] (4) The formulation of PDB medium is: 20% potato, 2% sucrose, and the rest is made up with distilled water.
[0073] See Figure 4 , the concentration of strain Y3 is the highest in PDB medium, which can reach 32.2×10 8 cfu / mL, while the concentration is the lowest in yeast complete medium, only 2.7×10 8 cfu / mL. Therefore, PDB medium was selected as the fermentation medium for strain Y3.
[0074] Example 2
[0075] The purpose of this example is to investigate the antibacterial effect of strain Y3 in Example 1 against Botryosphaeria dothidea.
[0076] After culturing strain Y3 in PDB medium for 2 - 3 days, the cell suspension was adjusted to 1×10 7 cfu / mL and placed in a sterile centrifuge tube for later use.
[0077] The pathogenic bacterium (Botryosphaeria dothidea) was evenly spread on PDA medium. After culturing for 3 - 4 days, a 5 - mm punch was used to take the stipe and inoculate it in the center of the blank medium. Then, another plate was taken. After adding PDA medium, the plate cover was removed, and 100 μL of Y3 bacterial liquid was evenly spread on the PDA medium. The control group was spread with sterile water. After the two plates were buckled bottom - to - bottom, they were sealed with paraffin oil to observe the antibacterial effect.
[0078] See Figure 5 , the left side is the plate diagram of Botryosphaeria dothidea in the blank control group, and the right side is the plate diagram after the action of strain Y3. It can be seen that the volatile substances of strain Y3 have an obvious antibacterial effect on Botryosphaeria dothidea, and the antibacterial rate reaches 74.1%. It shows that strain Y3 has a good control effect on kiwifruit soft rot.
[0079] Example 3
[0080] The purpose of this example is to investigate the control of post - harvest soft rot of kiwifruit by strain Y3 in Example 1.
[0081] 3.1. Preparation of microbial agent
[0082] (1) Botryosphaeria dothidea (denoted as pathogenic bacterium P) was cultured in PDB medium for 15 days. The mycelium was scraped off, and the granular hard clumps on the plate were crushed with forceps and adjusted to 1×10 6 cfu / mL with sterile water to obtain the spore suspension of pathogenic bacterium P.
[0083] (2) Strain Y3 was cultured in PDB medium for 3 days. The fermentation broth was taken and adjusted to a concentration of 1×10 7 cfu / mL. The precipitate was taken, glycerol was added, and it was placed in a freeze - dryer for freeze - drying at a temperature of - 80 °C to obtain the active substance of the microbial agent.
[0084] (3) Take 20 wt% of the active substance, 4 wt% of sodium dodecyl sulfate, 4 wt% of polyethylene glycol, 2 wt% of vitamin E, and the balance is added with diatomaceous earth. After mixing to obtain the antagonistic microbial agent, an appropriate amount of water was added to dissolve the antagonistic microbial agent and placed in a spray bottle for later use.
[0085] (4) Take 60 healthy kiwifruits. Immerse the kiwifruits in sodium hypochlorite for 3 min, then rinse them three times with distilled water and air-dry them in a cool place. After using a 5-mm puncher to evenly punch three holes at the equator of the kiwifruits, divide the treated kiwifruits into 4 groups. The CK group is injected with 10 μL of sterile water, sprayed with sterile water, and then air-dried. The T1 group is injected with 10 μL of the spore suspension of pathogen P, sprayed with sterile water, and then air-dried. The T2 group is injected with 10 μL of sterile water and sprayed with 50 mL of the antagonistic bacterium agent. The T3 group is injected with 10 μL of the spore suspension of pathogen P and sprayed with 50 mL of the antagonistic bacterium agent. Calculate the incidence rate of the kiwifruits.
[0086] In the T1 group, all 45 holes showed signs of disease, and the incidence rate was 100%. In the CK group and the T2 group, there was no disease, and the incidence rate was 0%. In the T3 group, 16 out of 45 holes were diseased, and the incidence rate was only 36.7%. From the incidence rate, it can be seen that strain Y3 can significantly reduce the incidence rate of postharvest soft rot of kiwifruits, indicating that strain Y3 has a good control effect on postharvest soft rot of kiwifruits.
[0087] In summary, the strain Y3 screened in the present invention can inhibit Botryosphaeria dothidea and has a control effect on kiwifruit soft rot. It can be compounded with existing microbial agents that have a control effect on kiwifruit soft rot to form an antagonistic bacterium agent, synergistically promoting the improvement of the antibacterial and control effects.
[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments. Those of ordinary skill in the art should understand that they can still modify the technical solutions of the present invention or make equivalent replacements, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A strain of Hansenula sporangiophora Y3, characterized in that: The Latin name is Hanseniaspora sp.Y3. It was deposited in the China Center for Type Culture Collection on February 19, 2025, with the deposit number CCTCC M2025252.
2. A strain of Hansenula sporangiophora Y3 according to claim 1, characterized in that: The 18S rRNA sequence of Hansenula sporogenes Y3 is shown in SEQ No.
1.
3. A strain of Hansenula sporangiophora Y3 according to claim 1, characterized in that: The colony morphology of Hansenula sporangiophore Y3 is as follows: the colony surface is smooth, without irregular shapes such as protrusions, depressions, wrinkles or granularity, and the colony color is mostly white to milky white with uniform color. Under a microscope, the cells are oval with sharp ends.
4. The strain of Hansenula sporangiophora Y3 according to claim 1, characterized in that: Hansenula sporangiophora Y3 entered the logarithmic growth phase at 4h and was in the stable growth phase at 28h-32h.
5. Use of the sporangial Hansenula Y3 as claimed in claim 1 in preventing and controlling postharvest soft rot of kiwifruit.
6. Use of the sporangial Hansenula Y3 as claimed in claim 1 in preventing and controlling postharvest soft rot of kiwifruit by inhibiting Botrytis cinerea.
7. An antagonist for preventing and treating postharvest soft rot of kiwifruit, characterized in that: The invention comprises the Hansenula sporangial yeast Y3 as described in claim 1.