Herbicide metolachlor degradation complex microbial inoculant TDW2 and application thereof

By developing the complex bacterial agent TDW2, the degradation ability of Bacillus Bacillus subtilis and Aspergillus fungi was used to solve the drug damage problem of Jinduer on buckwheat, and the effect of effective degradation and yield improvement was achieved.

CN120192889APending Publication Date: 2025-06-24INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510438714.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively degrade the herbicide Jinduer, which makes it difficult to solve the problem of drug damage to buckwheat, and there is a lack of research measures for the prevention and control of herbicides in buckwheat fields.

Method used

A complex bacterial agent TDW2, including Bacillus Bacillus WXB10, Bacillus subtilis TXB2 and Aspergillus fungus DH5, was developed. By screening and identifying the degradation ability of these strains, a complex bacterial system was constructed to degrade and alleviate the drug damage of Jinduer to buckwheat.

Benefits of technology

The complex bacteria agent TDW2 can effectively degrade Jinduer, alleviate the harm of buckwheat seedlings, increase crop yield and 1,000 grain weight, and is pollution-free to humans, livestock and the environment, and has good development and application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192889A_ABST
    Figure CN120192889A_ABST
Patent Text Reader

Abstract

The invention discloses a herbicide Jinmetolachlor degradation complex microbial inoculant TDW2 and application thereof. Belongs to the technical field of gold metolachlor degradation. The method comprises the following steps: taking a soil sample from a land parcel where Jinmetolachlor is applied throughout the year, screening out a strain capable of degrading the herbicide Jinmetolachlor, identifying the screened strain through morphology, physiology, biochemistry and molecular biology, then carrying out an antagonism test between strains, and selecting strains without antagonism to construct a compound strain TDW2, so that the compound strain TDW2 can be used for degrading the herbicide Jinmetolachlor. The strain TDW2 is used for carrying out potting control effect tests and field control effect tests on buckwheat seedlings to obtain a Jinmetor degrading strain TDW2, the phytotoxicity in the buckwheat seedling stage is relieved, and the Jinmetor degrading strain TDW2 is safe to human and livestock and free of pollution to the environment and has good development and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of Jindul degradation, and more particularly to a Jindul-degrading composite bacterial agent TDW2 for herbicide degradation and application thereof. Background Art

[0002] Weeds in buckwheat fields are a major factor affecting buckwheat yield. Current control measures fail to fully utilize agricultural and mechanical measures, relying primarily on chemical herbicides. However, buckwheat is particularly sensitive to herbicides. Herbicides used to control grass weeds during the seedling stage must be strictly controlled. For broadleaf weeds in buckwheat fields, no herbicides are available after emergence, and soil sealing treatment with individual amide herbicides, such as Kindol (S-isopropylamine), is the only option. However, growers often fail to accurately measure the size of the fields and accurately weigh the amount of herbicide and water used, often leading to herbicide damage. There is no research on herbicide damage control in buckwheat fields, both domestically and internationally, and there is a lack of measures to address herbicide damage and environmental hazards during the planting process.

[0003] Using microorganisms such as bacteria and fungi to mitigate herbicide damage and degrade herbicides is a safe, pollution-free method that helps improve crop quality, yield, and safety. However, the effectiveness of individual strains of the herbicide Jindur is currently less than ideal. Furthermore, the specific characteristics of individual strains in the screening of complex bacterial agents make their combined effectiveness unpredictable. Currently, there are no reports of complex bacterial agents that degrade the herbicide Jindur.

[0004] In summary, how to provide a composite degradation bacterial agent for the herbicide Jindul to alleviate the herbicide Jindul's phytotoxicity to buckwheat is an urgent problem that those skilled in the art need to solve. Summary of the Invention

[0005] In view of this, the present invention provides a herbicide Jindul-degrading composite bacterial agent TDW2 and its application.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A herbicide Jindul-degrading composite bacterial agent TDW2, comprising Bacillus velezensis WXB10, Bacillus subtilis TXB2, and Aspergillus fungus DH5;

[0008] The Bacillus velezensis WXB10 is classified as Bacillus velezensis and was deposited in the China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022680. The deposit address is Wuhan University, Wuhan, China.

[0009] The Bacillus subtilis TXB2 is classified as Bacillus subtilis and was deposited in the China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022679. The deposit address is Wuhan University, Wuhan, China.

[0010] The Aspergillus fungus DH5 is classified and named Aspergillus sp., and was deposited in the China Center for Type Culture Collection on July 1, 2024, with a deposit number of CCTCC NO: M 20241438, and the deposit address is Wuhan University, Wuhan, China.

[0011] Furthermore, the volume ratio of the Bacillus velez WXB10 bacterial solution, the Bacillus subtilis TXB2 bacterial solution, and the Aspergillus fungus DH5 spore suspension is 1:1:1;

[0012] The number of viable cells of Bacillus velezensis WXB10 and Bacillus subtilis TXB2 was 1×10 8 CFU / mL;

[0013] The spore amount of Aspergillus fungus DH5 spore suspension is 1×10 7 CFU / mL.

[0014] The application of the above-mentioned composite bacterial agent TDW2 in the degradation of the herbicide Jindul.

[0015] The application of the above-mentioned composite bacterial agent TDW2 in alleviating the damage caused by Jindul to plants.

[0016] The application of the above-mentioned composite microbial agent TDW2 in increasing plant yield and thousand-grain weight.

[0017] It can be seen from the above technical solutions that, compared with the prior art, the present invention has the following beneficial effects:

[0018] The invention collects soil samples from a plot where Jindul is applied all year round, 0 to 10 cm above the ground surface, screens out strains capable of degrading the herbicide Jindul, identifies the screened strains through morphology, physiology, biochemistry and molecular biology, then conducts an inter-strain antagonism test, selects strains without antagonistic effects to construct a composite bacterial system TDW2, and uses the bacterial system TDW2 to conduct pot plant control efficacy tests and field control efficacy tests on buckwheat seedlings to obtain a Jindul-degrading bacterial system TDW2, which alleviates the herbicide damage in the buckwheat seedling stage, is safe for humans and animals, does not pollute the environment, and has good development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0020] Figure 1 This is a diagram showing the results of the WXB10, TXB2, and DH5 plate tests in Example 2 of the present invention;

[0021] Figure 2 This is a diagram showing the antagonistic effect among WXB10, TXB2, and DH5 strains in Example 3 of the present invention;

[0022] Figure 3 The strain morphology diagram of strains WXB10, TXB2 and DH5 in Example 4 of the present invention;

[0023] Figure 4 Gram staining of strains WXB10 and TXB2 in Example 4 of the present invention;

[0024] Figure 5 This is the phylogenetic tree of strains WXB10, TXB2 and DH5 in Example 4 of the present invention. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0026] The reagents required for the present invention are conventional experimental reagents, purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0027] The culture medium components used in the following examples are as follows:

[0028] LB solid medium: peptone 10 g, yeast extract powder 5 g, NaCl 10 g, agar 15 g, distilled water 1000 mL.

[0029] LB liquid medium: peptone 10 g, yeast extract powder 5 g, NaCl 10 g, distilled water 1000 mL.

[0030] PDA medium: 200 g peeled potatoes, 18 g agar, 20 g glucose, 1000 mL distilled water.

[0031] Basic inorganic salt culture medium: KH2PO4 1.6 g, K2HPO4 0.52 g, NH4NO3 1.0 g, NaCl 0.5 g, MgSO4·7H2O 0.5 g, distilled water 1000 mL.

[0032] Carbon source determination basal culture medium: KH2PO4 2.38 g, K2HPO4·3H2O 5.65 g, (NH4)2SO4 2.64 g, MgSO4·7H2O 1 g, CuSO4·5H2O 6.4 mg, ZnSO4·7H2O 1.5 mg, FeSO4·7H2O 1.1 mg, MnCl2·7H2O 7.9 mg, agar 15 g, distilled water 1000 mL.

[0033] Nitrogen source determination basal medium: glucose 10 g, K2HPO4·3H2O 1 g, MgSO4·7H2O 5 g, NaCl 5 g, FeSO4·7H2O 10 mg, agar 15 g, distilled water 1000 mL.

[0034] Malonate test medium: sodium malonate 3 g, yeast extract 1 g, NaCl 2 g, (NH4)2SO4 2 g, KH2PO4 0.4 g, K2HPO4·3H2O 0.6 g, bromothymol blue 25 mg, distilled water 1000 mL, pH 7.4.

[0035] Methyl red test medium: peptone 7.0 g, glucose 5 g, NaCl 5 g, distilled water 1000 mL.

[0036] Starch hydrolysis test medium: soluble starch 2 g, beef extract 3 g, peptone 5 g, glucose 2.5 g, agar 18 g, distilled water 1000 mL, pH 7.0.

[0037] Fat hydrolysis test medium: peptone 10 g, CaCl2·2H2O 0.1 g, agar 17 g, distilled water 1000 mL, pH 7.4.

[0038] NA medium: 3 g beef extract, 5 g peptone, 2.5 g glucose, 18 g agar, 1000 mL distilled water, pH 7.0.

[0039] Example 1

[0040] Isolation of strains

[0041] Soil samples were collected from Wuchuan County, Hohhot City, Inner Mongolia and the farm plot of Inner Mongolia Agricultural University New District, Hohhot City, Inner Mongolia, at a distance of 0 to 10 cm from the ground surface. 5 g of soil sample was weighed and placed in 95 mL of liquid basic inorganic salt culture medium. Jinduer was added as the only carbon source for microbial growth to make the final concentration of Jinduer 50 mg / L. The sample was cultured on a shaker at 150 r / min and 28 ° C. After enrichment culture for 7 days, 1 mL was transferred to the basic inorganic salt culture medium containing 100 mg / L Jinduer and cultured for 7 days. Then 1 mL was transferred to the basic inorganic salt culture medium containing 150 mg / L Jinduer and cultured for 7 days. By gradually increasing the concentration of Jinduer, the selection pressure of herbicides on microorganisms was increased, in order to isolate and screen efficient herbicide-degrading strains. After 21 days of enrichment culture, the basic inorganic salt culture medium was made into 10 -1 , 10 -3 , 10 -4 , 10 -5 Different concentrations, take different concentrations of culture solution 200μL and apply it to PDA and LB culture medium respectively, apply 10 -3 concentration culture medium, 10 -4 and 10 -5 Concentrated culture medium was used to separate fungi and bacteria, repeated 3 times, and cultured in a 25℃ constant temperature box for 2-5 days after inoculation. Single colonies with different morphologies were picked for purification, numbered, preserved and set aside.

[0042] Example 2

[0043] Preliminary screening of Jindul-degrading bacteria by plate assay

[0044] The isolated bacterial strains were purified twice on LB medium by the plate streak method, and the fungal strains were purified twice on PDA medium by the single spore separation method. The purified bacterial strains were spread on LB medium by the dilution coating plate method and cultured for 3 days, and the fungal strains were inoculated in PDA medium and cultured for 5 days. Take 500μL of the herbicide Jindul and quickly add it to 99.5mL of basic inorganic salt culture medium at a temperature of 40±2.5℃ to make the total amount of solution in the culture medium 100mL. Mix it immediately and pour it into the glass culture dish before the culture medium solidifies, 20mL per dish. After the culture medium solidifies in the culture dish, the isolated bacteria and fungi cakes with a diameter of 5mm are inverted and inoculated into the culture dish. The uninoculated culture dish is used as a control. Each treatment is repeated 3 times and cultured at a constant temperature of 25℃. Observe whether there is a transparent circle around the cake. The diameter of the transparent circle is measured after 7 days of culture. The presence of a transparent circle is used to preliminarily judge whether the strain can utilize the herbicide Jindul. The results are shown in Table 1. Figure 1 shown.

[0045] Table 1 Flat plate test results

[0046]

[0047] After initial screening, three strains were obtained, named WXB10, TXB2, and DH5. Strains WXB10, TXB2, and DH5 showed clear zones on the plate with diameters of 1.54 cm, 1.35 cm, and 1.06 cm, respectively, and were able to utilize the herbicide Jindul.

[0048] Example 3

[0049] Construction of composite bacterial strain TDW2 and determination of Jindul degradation rate

[0050] The strains screened in the plate primary screening test were selected and the compatibility of the strains was determined by plate antagonism test. The strains WXB10 and TXB2 were prepared into a concentration of 1×10 8 CFU / mL bacterial suspension, strain DH5 was prepared to a concentration of 1×10 7 CFU / mL bacterial suspension. Take 200μL of bacterial strain WXB10 and TXB2 bacterial suspension respectively and spread it on LB medium, and culture it in a constant temperature incubator at 25℃ for 3 days until the plate is full. 200μL of fungal strain DH5 bacterial suspension is spread on PDA medium and cultured in a constant temperature incubator at 25℃ for 5 days until the plate is full. Strain TXB2 is beaten into a 5mm diameter cake and inverted into a culture dish full of strain WXB10. Set up 3 replicates. After 3 days, observe whether the inoculated cake can inhibit the growth of the strain in the culture dish and produce a transparent circle. The appearance of a transparent circle indicates antagonism between the two strains. The DH5 strain was then inoculated into a 5mm diameter cake in the center of a PDA culture medium. Four inoculation points were set 2cm from the DH5 cake on the plate. Seven 1cm diameter sterile filter paper slips were placed on each inoculation point. 100μL of a WXB10 or TXB2 suspension cultured at 25°C, 180 rpm for 2 days was inoculated onto each filter paper slip. Three replicates were set up and the presence of antagonistic effects was observed after 5 days. Strains with no antagonistic effects were selected to construct composite bacterial strains.

[0051] The compatibility test results of the strains are shown in Figure 2 The absence of a transparent circle around the bacterial cake indicated that there was no antagonism between the strains. The strains WXB10, TXB2, and DH5 without antagonistic effects were used to construct a composite bacterial strain named TDW2.

[0052] Determination of Jindul degradation rate: The concentration of preparation is 1×10 8 The concentration of bacterial suspension and spores of strains WXB10 and TXB2 was 1×10 CFU / mL. 7For each strain DH5 bacterial solution with a CFU / mL, take an equal proportion of each required bacterial solution, take a total of 5mL, and aseptically transfer it into 95mL of basic inorganic salt medium with a Jindul concentration of 100mg / L. Incubate at a constant temperature of 25℃ and 180r / min in a shaker for 7d and 21d to obtain the test solution. Take 5mL of the test solution and place it in a 50mL centrifuge tube, add 5mL of acetonitrile, and shake on a shaker at 25℃ and 220r / min for 1h. Add 1g of NaCl and shake until the liquid stratification can be clearly observed. Then centrifuge at 4000g for 5min, aspirate the upper organic liquid with a pipette, filter the supernatant with a 0.22μm disposable filter, and determine the degradation rate using a high-performance liquid chromatograph after filtration.

[0053] Instrumental Conditions: Determine the concentration of S-metolachlor in samples by liquid chromatography using a mobile phase of acetonitrile: ultrapure water (20:80, v / v). The detection wavelength for S-metolachlor is 254 nm, the flow rate is 1.0 mL / min, the injection volume is 5 μL, the column temperature is 25°C, and the retention time is 8 min. The substance is identified by its peak elution time, and the S-metolachlor content is quantitatively calculated based on its peak area.

[0054]

[0055] The results are shown in Table 2.

[0056] Table 2 Degradation rate of S-Isopropylamine by composite bacterial system

[0057]

[0058] Example 4

[0059] Strain identification and preservation

[0060] (1) Morphological identification

[0061] The strain was spread on LB solid medium by dilution method to grow single colonies. The single colony of strain WXB10 was milky white, with a dry and rough surface, wrinkles, opaque, and irregular edges; the colony of strain TXB2 was milky white, opaque, with irregular edges, wrinkles, and a concave center; the mycelium of strain DH5 was white or light in color, turning gray-brown after aging, and the spore balls were irregular ( Figure 3 ).

[0062] (2) Physiological and biochemical identification

[0063] The test was carried out with reference to the Manual of Identification of Common Bacteria Systems, and the physiological and biochemical indicators of the strains, such as carbon source and nitrogen source utilization, malonate utilization, methyl red test, starch hydrolysis, oxidase test and catalase test, were determined. Strain WXB10 is a Gram-positive bacterium ( Figure 4), can use mannitol, fructose, glucose, histidine, ammonium nitrate and ammonium sulfate as the only carbon and nitrogen sources, can hydrolyze starch and fat, use malonate, and produce catalase, see Table 3 for details. Strain TXB2 is a Gram-positive bacterium ( Figure 4 ), can decompose starch and fat, can use glucose and mannitol as the sole carbon source, and can use ammonium nitrate and ammonium sulfate as the sole nitrogen source, see Table 4 for details.

[0064] Table 3 Physiological and biochemical characteristics of strain WXB10

[0065]

[0066] Note: “+” indicates positive, “-” indicates negative.

[0067] Table 4 Physiological and biochemical characteristics of strain TXB2

[0068]

[0069] Note: “+” indicates positive, “-” indicates negative.

[0070] (3) Molecular biological identification

[0071] Bacterial DNA was extracted according to the instructions for the TIAN GEN Bacterial Genomic DNA Extraction Kit (spin column type) (Beijing, China), purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Fungal DNA was extracted according to the instructions for the Ezup Fungal Genomic DNA Extraction Kit (spin column type), purchased from Sangon Biotech (Shanghai) Co., Ltd. The PCR primers for strains WXB10 and TXB2 were 27F and 1492R, 7F and 1540R, rpoBF and rpoBR, and trpBF and trpBR, respectively. The PCR primers for strain DH5 were ITS1 and ITS4, respectively. The primer sequences are shown in Table 5.

[0072] A 25 μL reaction system contained: 17 μL ddH2O, 2.5 μL 10× PCR Buffer, 2 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 0.5 μL Taq DNA polymerase, and 1 μL template DNA. PCR reaction conditions: initial denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 30 s; 72°C for 1 min; 34 cycles; and 72°C for 10 min.

[0073] The PCR product of the gene was detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for 16S rDNA sequencing. The sequencing results are as follows. The obtained gene sequences were spliced ​​and compared with the Gen Bank nucleic acid database. The strain sequences with high similarity were selected for analysis, and a phylogenetic tree was constructed using the software MEGA7.0. Strain WXB10 and Bacillus velezensis were clustered in the same group, strain TXB2 and Bacillus subtilis were clustered in the same group, and strain DH5 and Aspergillus sp. were clustered in the same group. Figure 5 ).

[0074] Table 5 Primers and sequences

[0075]

[0076] The WXB10 amplified sequence is as follows:

[0077] 27F 1492R:

[0078]

[0079] 7F 1540R:

[0080]

[0081] rpoBR rpoBF:

[0082]

[0083] trpBF trpBR:

[0084]

[0085] The TXB2 amplified sequence is as follows:

[0086] 27F 1492R:

[0087]

[0088] 7F 1540R:

[0089]

[0090] rpoBR rpoBF:

[0091]

[0092] trpBF trpBR:

[0093] ATGTACGCCCAATCCAAATGATGCTGGTAAAAAACAGATTTTCCATTGTAACATAAGTTGACAAAAAGAAAAAGGGAAGCAGCCAAACGGCTATTTCCCCTTTTTTATAGTGATGCTTTCAAAATTGACAGCACATCTTCTTTGTTGAGTGATTTAAATTGGCCGAATGTACCGTTAGCCATTGCCTTGTCAGCAATTGTGTCAAGCTGCTCATCATTAATATCATAATCAGCAAGACGGTTCGGAGCGCCAAGGCTTGTCCAGAATGCGGACAGCTTATCGATACCTTCAAGGGCAATTTCTTCATCCGTTTTACCTGCTTCTTCAACATCAAACACGCGAACTGCAAGCTGTTTCATGCGGGCAGGGTTTTCAGACAATGTGTGTCTCATCCAGTTCGGGAACAAAATTGCCAGTCCGCCGGCATGCGGAATATCATAAACGGCTGATACTGCATGTTCAATATGTGAGTGCCACAA, SEQ ID NO. 18.

[0094] The amplified sequence of DH5 is as follows:

[0095] ITS1 ITS4:

[0096]

[0097] Based on the results of morphological, physiological and biochemical tests and molecular biological identification, strain WXB10 was identified as Bacillus velezensis, strain TXB2 was identified as Bacillus subtilis, and strain DH5 was identified as Aspergillus sp.

[0098] (4) Preservation

[0099] The Bacillus velezensis was named WXB10, and its classification name was Bacillus velezensis. It was deposited in the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCCNO: M 2022680, and the deposit address is Wuhan University, Wuhan, China.

[0100] The Bacillus subtilis is named TXB2, and its classification name is Bacillus subtilis. It was deposited in the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCCNO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.

[0101] The Aspergillus fungus is named DH5, and its classification name is Aspergillus sp. It was deposited in the China Center for Type Culture Collection on July 1, 2024, with the deposit number CCTCC NO: M 20241438, and the deposit address is Wuhan University, Wuhan, China.

[0102] Example 5

[0103] Effect of compound microbial agent TDW2 on alleviating phytotoxicity of Jindul in potted plant experiments

[0104] Buckwheat seeds were mixed with the composite microbial agent TDW2, and then different concentrations of herbicides were sprayed. The effect of the composite microbial agent TDW2 in degrading Jindul and alleviating herbicide damage was analyzed by changing the herbicide damage index.

[0105] The isolated bacterial strain was cultured in LB liquid medium at 25°C and 180 r / min in a shaking incubator and diluted to 1×10 8 CFU / mL, and the bacterial suspension was prepared. The isolated fungal strain DH5 was cultured in a shaker at 25 °C and 180 r / min for 3 days and diluted to a spore volume of 1×10 7 CFU / mL to prepare a spore suspension; the composite inoculant TDW2 is a mixture of the individual components in equal volume ratios. Buckwheat seed dressing: add 20 mL of the composite inoculant per 20 g of seeds, mix thoroughly, and place in a cool, dry place to dry until ready for use.

[0106] There were two potted trials: one using sterilized soil (July 2023) and one using non-sterilized soil (December 2023).

[0107] In the first potted experiment, soil samples were taken from the farm of Inner Mongolia Agricultural University, sterilized in an oven at 180°C for 2 h, and mixed with vermiculite at a volume ratio of 2:1 before use. In the second potted experiment, soil from the New District Farm of Inner Mongolia Agricultural University was used directly without sterilization. The rest of the test was the same as the first potted experiment.

[0108] Each treatment was set to 0, 80, 100, 120, 140, 160 mL / 667 m 2 There were 6 herbicide concentrations and 3 replicates.

[0109] After sowing, cover the soil with 2 to 3 cm of soil. Calculate the soil surface area based on the diameter of the soil in different flower pots. 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 2 Six different concentrations were used, and the water and pesticide application rates were calculated proportionally based on the soil surface area of ​​the pots. The herbicide Jindul was then sprayed immediately. Ten days after sowing, the level of pesticide damage was assessed according to the pesticide damage grading standard (Table 6), and the pesticide damage index and the reduction rate were calculated.

[0110] Table 6 Buckwheat herbicide Jindul phytotoxicity grading standards

[0111]

[0112]

[0113] Note: During the investigation, the number of damaged buckwheat seedlings and the damage level were recorded, and the pesticide damage index and pesticide control efficacy were calculated.

[0114]

[0115] The results are shown in Tables 7, 8, 9 and 10.

[0116] Table 7 Injury index of buckwheat after seed dressing with compound fungicide and spraying with Jinduer (July 2023, soil sterilization)

[0117]

[0118] Table 8: The ratio of compound microbial agent seed dressing to reduce the damage of buckwheat after spraying Jinduer (%) (July 2023, soil sterilization)

[0119]

[0120] Table 9 Injury index of buckwheat after seed dressing with compound fungicide and spraying with Jinduer (December 2023, soil not sterilized)

[0121]

[0122] Table 10 The ratio of compound microbial agent seed dressing to reduce the damage of buckwheat after spraying Jinduer (%) (December 2023, soil not sterilized)

[0123]

[0124] From Tables 7 and 8, we can see that under the condition of soil sterilization, the application of herbicide 80, 100, 120, 140, 160mL / 667m 2 When the herbicide dosage was 80mL / 667m 2 and 100mL / 667m 2 The best mitigation effect was achieved, with mitigation rates of 82.7% and 79.4%. Tables 9 and 10 show that when the soil was not sterilized, the herbicide was applied at 80, 100, 120, 140, and 160 mL / 667 m 2 When the herbicide dosage was 80mL / 667m 2 The best mitigation effect was achieved with a mitigation rate of 94.0%, followed by a herbicide dosage of 120 mL / 667 m 2 , the reduction rate was 81.8%.

[0125] Example 6

[0126] Effect of compound microbial agent TDW2 on alleviating Jinduer phytotoxicity in field trials

[0127] Buckwheat seeds were mixed with the composite microbial agent TDW2, and then different concentrations of herbicides were sprayed. The effect of the composite microbial agent TDW2 in degrading Jindul and alleviating herbicide damage was analyzed by changing the herbicide damage index.

[0128] The experiment was conducted at the Inner Mongolia Agricultural University teaching base in Hailiutu, Tumote Left Banner, Hohhot, Inner Mongolia. 2 The seed pretreatment method of dressing with the composite microbial agent was the same as that in Example 5.

[0129] The seeds were sown on July 20, 2023, with a row spacing of 40 cm. A furrow opener was used to open a furrow with a depth of 4 to 5 cm. The seeds mixed with the compound fungus agent were sown and immediately covered with soil. Then, different concentrations of soil-sealed herbicide Jindul were immediately applied. The herbicide was diluted at 1000 rpm per 667 m 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 26 different concentrations were used. 15 days after sowing, the level of phytotoxicity was investigated according to the phytotoxicity grading standard (Table 6), and the phytotoxicity index and the phytotoxicity reduction ratio were calculated using the same calculation formula as in Example 5.

[0130] The effect of the composite fungicide TDW2 on alleviating the phytotoxicity of buckwheat seedlings can be seen in Tables 11 and 12.

[0131] Table 11 Injury index of buckwheat after spraying with Jinduer after seed dressing with compound fungicide in field trial

[0132]

[0133] Table 12 Effect of compound fungicide seed dressing on reducing the damage of buckwheat after spraying Jinduer in field test (%)

[0134]

[0135] From Table 11 and Table 12, we can see that the dosage of herbicide Jindul is 80, 100, 120, 140 and 160 mL / 667 m 2 The composite fungicide TDW2 could alleviate the phytotoxicity of Jinduer to buckwheat, and the herbicide dosage was 140mL / 667m 2 、160mL / 667m 2 The relief effect was the best, with relief rates of 22.5% and 26.7%.

[0136] Example 7

[0137] Effect of compound microbial agent TDW2 on improving buckwheat yield and 1000-grain weight in field trials

[0138] Buckwheat seeds were mixed with the compound microbial agent TDW2 and then sprayed with herbicides of different concentrations. The yield-increasing effect of the compound microbial agent TDW2 was analyzed by changes in yield and 1000-grain weight.

[0139] The experiment was conducted at the Inner Mongolia Agricultural University teaching base in Hailiutu, Tumote Left Banner, Hohhot, Inner Mongolia. 2 Six concentrations of the herbicide Jindul and one manual weeding control were used, with three replicates. The seed pretreatment method for dressing with the composite microbial agent was the same as in Example 5.

[0140] The seeds were sown on July 20, 2023, with a row spacing of 40 cm. A furrow opener was used to open a furrow with a depth of 4 to 5 cm. The seeds mixed with the compound fungus agent were sown and immediately covered with soil. Then, different concentrations of soil-sealed herbicide Jindul were immediately applied. The herbicide was diluted at 1000 rpm per 667 m 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 2Six different concentrations were used. Yield and 1000-grain weight were measured after harvest. The yield-increasing effect of the compound microbial agent TDW2 is shown in Tables 13 and 14.

[0141] Table 13 Effect of compound microbial agent seed dressing on buckwheat yield after spraying Jinduer in field experiment (kg / 667m 2 )

[0142]

[0143] Table 14 Effect of compound microbial agent seed dressing on 1000-grain weight of buckwheat after spraying Jinduer in field experiment (g)

[0144]

[0145] As shown in Table 13, the yield of the composite microbial agent TDW2 was greater than that of the non-microbial agent CK at all herbicide dosages. In the non-microbial agent CK, the herbicide dosage was 100 mL / 667 m 2 When the yield was compared with the manual weeding control, there was no significant difference, indicating that the herbicide dosage was 100mL / 667m 2 The application of TDW2 in the herbicide dosage is 80mL / 667m 2 The yield was significantly higher than that of the manual weeding control, and the herbicide dosage was 120mL / 667m 2 When the yield was compared with the manual weeding control, there was no significant difference, indicating that the composite fungus agent could alleviate the 80-120mL / 667m 2 As shown in Table 14, in the case of CK without the application of compound microbial agent, the herbicide dosage was 80 mL / 667 m 2 When the herbicide dosage was 80mL / 667m 2 The safety of buckwheat does not affect the thousand-grain weight. The application of the fungicide TDW2 is 80mL / 667m 2 、100mL / 667m 2 、140mL / 667m 2 When the 1000-grain weight was compared with the manual weeding control, there was no significant difference, indicating that the composite fungus agent could alleviate the 80-100mL / 667m 2 and 140mL / 667m 2 The thousand-kernel weight was reduced due to Jindul.

[0146] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0147] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A herbicide Jindul degrading composite bacterial agent TDW2, characterized in that: These include Bacillus velez WXB10, Bacillus subtilis TXB2, and Aspergillus DH5; The Bacillus velezensis WXB10 is classified as Bacillus velezensis and was deposited in China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022680. The deposit address is Wuhan University, Wuhan, China. The Bacillus subtilis TXB2 is classified and named as Bacillus subtilis, and was deposited in China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022679, and the deposit address is Wuhan University, Wuhan, China; The Aspergillus fungus DH5 is classified and named Aspergillus sp., and was deposited in the China Center for Type Culture Collection on July 1, 2024, with the deposit number CCTCC NO: M 20241438, and the deposit address is Wuhan University, Wuhan, China.

2. The composite bacterial agent TDW2 according to claim 1, characterized in that The volume ratio of Bacillus Velez WXB10 bacterial solution, Bacillus subtilis TXB2 bacterial solution and Aspergillus DH5 spore suspension is 1:1:1; The number of viable cells of Bacillus Velez WXB10 and Bacillus subtilis TXB2 was 1×10 8 CFU / mL; The spore amount of Aspergillus DH5 spore suspension is 1×10 7 CFU / mL.

3. Use of the composite bacterial agent TDW2 described in any one of claims 1 or 2 in degrading the herbicide Jindul.

4. Use of the composite bacterial agent TDW2 according to any one of claims 1 or 2 in alleviating Jindul pesticide damage to plants.

5. Use of the composite bacterial agent TDW2 according to any one of claims 1 or 2 in increasing plant yield and thousand-grain weight.