Pediococcus acidilactici and fermented food prepared from same

Abstract

The invention relates to the field of food, in particular to pediococcus acidilactici and fermented food prepared from the pediococcus acidilactici. The invention provides pediococcus acidilactici, and the preservation number of the pediococcus acidilactici is CGMCC (China General Microbiological Culture Collection Center) No. 31573. The microbial diversity of the jackfruit during the storage period after picking is analyzed based on Illumina PE300 high-throughput sequencing, indigenous bacteria suitable for processing and fermentation of the jackfruit are obtained through separation and purification, gene information and function prediction information of the indigenous bacteria are mastered by adopting 16S rDNA sequencing identification and whole genome sequencing, and the jackfruit with good fermentation flavor and high fermentation efficiency is obtained by optimizing the fermentation process. The jack fruit fermented leisure food is simple in process.

Description

Technical Field

[0001] The present invention relates to the field of food, and particularly to Pediococcus acidilactici and fermented foods prepared therefrom. Background Art

[0002] Jackfruit is a tropical fruit with a large yield and is rich in various nutrients. However, it is easily invaded by microorganisms and spoiled after harvesting, resulting in great waste. Moreover, the product price of jackfruit is extremely low. The traditional processed products of fresh jackfruit are mainly dried fruits and preserved fruits, with low added value, causing great waste of resources and low income for relevant industrial personnel. Fermented jackfruit is an excellent method for deep processing of jackfruit, but there is no special jackfruit fermentation strain. Other microorganisms have poor adaptability to the fermentation substrate of jackfruit pulp, the processing technology is immature, and the characteristic flavor of jackfruit cannot be fully exerted, unable to meet the needs of consumers for nutrition and diverse tastes.

[0003] The disadvantages of the prior art include:

[0004] (1) Limitations of jackfruit fermentation strains: The reported strains in the existing jackfruit fermentation technology are common commercial strains or specific strains screened in the laboratory. Although these strains can ferment jackfruit to a certain extent and produce products with certain flavors and nutritional values, there is a lack of in-depth research and utilization of jackfruit indigenous bacteria. Jackfruit indigenous bacteria have better adaptability and synergy in fermenting jackfruit pulp, but have not been fully emphasized and explored in the existing jackfruit fermentation research. Some studies have screened Saccharomyces cerevisiae as a fermentation strain in jackfruit wine fermentation, which can improve the alcohol content and wine quality to a certain extent, but ignore the potential contribution of jackfruit indigenous bacteria in the non-alcohol fermentation process.

[0005] (2) Complexity and instability of the fermentation process: The existing jackfruit fermentation processes mostly use common commercial bacteria: Lactobacillus bulgaricus, Lactobacillus plantarum, Lactobacillus acidophilus and other composite bacteria, and never use the natural indigenous bacteria of jackfruit. There is no in-depth optimization of the process of indigenous bacteria fermenting jackfruit. The simplified fermentation process is not conducive to the formation of the natural fermentation flavor of jackfruit pulp itself.

[0006] (3) Insufficient utilization of the unique nutritional components of jackfruit: Jackfruit contains rich bioactive substances such as polysaccharides, phenolic compounds, and carotenoids, which have beneficial physiological effects such as antioxidant, assisting in reducing blood sugar, and improving immunity. However, the existing fermenting bacteria are introduced from outside and are difficult to fully utilize and exert the flavor and nutrition of jackfruit.

[0007] (4) Issues regarding the use of additives: During the fermentation of jackfruit and the preparation of snack foods, to improve taste, extend shelf life, etc., food additives are often added in appropriate amounts. If the use of these additives is not properly controlled, it may have a certain impact on human health. However, the indigenous bacteria isolated, purified, and identified in this patent have a good taste during fermentation, avoiding excessive addition of additives. Summary of the Invention

[0008] In view of this, the present invention provides Pediococcus acidilactici and the fermented food prepared therefrom. Based on Illumina PE300 high-throughput sequencing to analyze the microbial diversity during the post-harvest storage of jackfruit, indigenous bacteria suitable for the processing and fermentation of jackfruit are isolated and purified, identified by 16S rDNA sequencing, and whole-genome sequencing is used to master the gene information and functional prediction information of this indigenous bacteria. Through optimizing the fermentation process, a jackfruit fermented snack food with good fermentation flavor and simple process is obtained.

[0009] To achieve the above-mentioned invention objectives, the present invention provides the following technical solutions:

[0010] The present invention provides Pediococcus acidilactici, and its preservation number is: CGMCC No. 31573.

[0011] The present invention also provides a microbial inoculant, including: the above-mentioned Pediococcus acidilactici and an acceptable adjuvant.

[0012] The present invention also provides the application of the above-mentioned Pediococcus acidilactici and / or the above-mentioned microbial inoculant in the preparation of fermented food.

[0013] In some embodiments of the present invention, in the above application, the fermented food contains jackfruit.

[0014] In some embodiments of the present invention, in the above application, the fermented food includes: solid and / or liquid.

[0015] The present invention also provides a preparation method of a solid-state fermented food containing jackfruit. After piercing the pretreated jackfruit, inoculate the above-mentioned Pediococcus acidilactici and / or the above-mentioned microbial inoculant for fermentation, and after drying, obtain the solid-state fermented food containing jackfruit.

[0016] In some embodiments of the present invention, in the above preparation method, the temperature of the fermentation is 28 - 36 °C, and the time is 6 - 30 h.

[0017] In some embodiments of the present invention, in the above preparation method, the temperature of the fermentation is 30 °C and the time is 18 h.

[0018] In some embodiments of the present invention, in the above preparation method, the viable cell count of the inoculation is 10 3 ~10 7 CFU / mL.

[0019] In some embodiments of the present invention, in the above preparation method, the viable cell count of the inoculation is 10 6 CFU / mL.

[0020] In some embodiments of the present invention, in the above preparation method, the step of adding sucrose is further included during the fermentation; the addition amount of the sucrose is 1-5%.

[0021] In some embodiments of the present invention, in the above preparation method, the step of adding sucrose is further included during the fermentation; the addition amount of the sucrose is 3%.

[0022] In some embodiments of the present invention, in the above preparation method, the pretreatment includes the steps of screening, washing, taking flesh and removing pits.

[0023] In some embodiments of the present invention, in the above preparation method, the temperature of the drying is 50 °C.

[0024] The present invention also provides a solid-state fermented food containing jackfruit obtained by the above preparation method.

[0025] The present invention also provides a preparation method of a liquid fermented food containing jackfruit. After mixing the pretreated jackfruit with water, sterilizing and cooling, it is inoculated with the above Pediococcus acidilactici and / or the above microbial inoculum for fermentation to obtain the fermented juice, and after blending, the liquid fermented food containing jackfruit is obtained.

[0026] In some embodiments of the present invention, in the above preparation method, the temperature of the fermentation is 26-36 °C and the time is 6-14 h.

[0027] In some embodiments of the present invention, in the above preparation method, the temperature of the fermentation is 28-32 °C and the time is 6-10 h.

[0028] In some embodiments of the present invention, in the above preparation method, the temperature of the fermentation is 30 °C and the time is 8 h.

[0029] In some embodiments of the present invention, in the above preparation method, the viable cell count of the inoculation is 10 3 ~10 7 CFU / mL.

[0030] In some embodiments of the present invention, in the above preparation method, the number of viable bacteria inoculated is 10 5 ~10 7 CFU / mL.

[0031] In some embodiments of the present invention, in the above preparation method, the number of viable bacteria inoculated is 10 6 CFU / mL.

[0032] In some embodiments of the present invention, in the above preparation method, citric acid and xylitol are used for the blending; in the liquid fermented food containing jackfruit, by weight, it contains 10-18 parts of the fermented fruit juice, 0.05-0.3 part of citric acid, and 1-3 parts of xylitol.

[0033] In some embodiments of the present invention, in the above preparation method, in the liquid fermented food containing jackfruit, by weight, it contains 12-16 parts of the fermented fruit juice, 0.1-0.2 part of citric acid, and 1.5-2.5 parts of xylitol.

[0034] In some embodiments of the present invention, in the above preparation method, in the liquid fermented food containing jackfruit, by weight, it contains 14 parts of the fermented fruit juice, 0.15 part of citric acid, and 2 parts of xylitol.

[0035] In some embodiments of the present invention, in the above preparation method, the liquid fermented food containing jackfruit is 100 parts by weight.

[0036] In some embodiments of the present invention, in the above preparation method, the pretreatment includes the steps of screening, washing, taking the flesh, removing the cores, coarsely crushing, and blanching.

[0037] In some embodiments of the present invention, in the above preparation method, the temperature of the blanching is 90°C and the time is 1-2 min.

[0038] In some embodiments of the present invention, in the above preparation method, the mass-volume ratio of the pretreated jackfruit to water is 1:10.

[0039] In some embodiments of the present invention, in the above preparation method, the temperature of the sterilization is 121°C and the time is 15-20 min.

[0040] In some embodiments of the present invention, in the above preparation method, the temperature after cooling is 40°C.

[0041] The present invention also provides a liquid fermented food containing jackfruit obtained by the above preparation method.

[0042] The beneficial effects of the present invention include:

[0043] (1) Exploring the indigenous bacteria resources of jackfruit: By deeply studying the composition, functions, and interactions of the original microbial community of jackfruit, indigenous bacteria with potential application value in fermenting jackfruit pulp are explored, better utilizing the jackfruit pulp matrix, adapting to the fermentation process of jackfruit pulp, improving fermentation efficiency, enhancing the quality of fermentation products, and providing strain resources for the intensive processing of jackfruit pulp.

[0044] (2) Improving the nutritional and flavor quality of products: Utilizing the excavated indigenous bacteria of jackfruit and its optimized fermentation process to give full play to the advantages of the flavor substances in jackfruit. Flavor substances such as organic acids, alcohols, and esters are produced, enriching the flavor levels of the products, and making the semi-dried fermented jackfruit leisure food have a unique jackfruit flavor and fermentation aroma.

[0045] (3) Reducing or even eliminating the use of additives: By optimizing the fermentation process and utilizing the natural inhibitory effects of indigenous bacteria, the use of food additives is reduced or eliminated, inhibiting the growth of harmful microorganisms, thereby reducing the usage amount of additives such as sodium sulfite or not using them at all, making the products healthier, safer, and meeting consumers' demands for natural and green foods. Description of the Drawings

[0046] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art.

[0047] Figure 1 Showing the heatmap of the bacterial community of jackfruit pulp at different storage times (at the genus level);

[0048] Figure 2 Showing the sequencing peak map;

[0049] Figure 3 Showing the phylogenetic analysis based on housekeeping genes;

[0050] Figure 4 Showing the gene annotation map of Pediococcus_acidilactici;

[0051] Figure 5 Showing the CGView genomic circular map;

[0052] Figure 6 Showing the sensory scores of fermented jackfruit pulp at different fermentation temperatures;

[0053] Figure 7 Showing the sensory scores of fermented jackfruit pulp at different bacterial liquid concentrations;

[0054] Figure 8Showing the sensory scores of fermented jackfruit pulp at different times;

[0055] Figure 9 Showing the sensory scores of fermented jackfruit pulp with different sucrose addition amounts;

[0056] Figure 10 Showing the two-dimensional GC-IMS spectra of volatile components in samples of fermented jackfruit pulp by Pediococcus acidilactici GYL-001 at different fermentation times;

[0057] Figure 11 Showing the differential spectra of volatile components in samples of fermented jackfruit pulp by Pediococcus acidilactici GYL-001 at different fermentation times;

[0058] Figure 12 Showing the fingerprint spectra of volatile components in samples of fermented jackfruit pulp by Pediococcus acidilactici GYL-001 at different fermentation times;

[0059] Figure 13 Showing the sensory scores of fermented jackfruit juice at different times;

[0060] Figure 14 Showing the sensory scores of fermented jackfruit juice at different temperatures;

[0061] Figure 15 Showing the sensory scores of fermented jackfruit juice with different inoculation amounts;

[0062] Figure 16 Showing the studentized residual plot;

[0063] Figure 17 Showing partial interaction surfaces;

[0064] Figure 18 Showing the maximized willingness value.

[0065] Biological deposit description

[0066] Biological material: GYL-001; Taxonomic name: Pediococcus acidilactici; Deposited at the General Microbiology Center of the China National Culture Collection of Microorganisms on August 13, 2024; Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Deposit number: CGMCC No. 31573. Detailed implementation manners

[0067] The present invention discloses Pediococcus acidilactici and fermented foods prepared therefrom.

[0068] It should be understood that the expression "one or more of..." individually includes each of the objects recited after said expression and various different combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0069] The terms "comprising", "having" or "containing", including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, e.g., not excluding other unrecited elements or steps, unless specifically stated otherwise or otherwise understood from the context.

[0070] It should be understood that the order of steps or the order of performing certain actions is not important as long as the present invention remains operable. In addition, two or more steps or actions can be carried out simultaneously.

[0071] The use of any and all examples or exemplary language such as "for example" or "including" in this document is merely intended to better illustrate the present invention and does not limit the scope of the present invention unless a claim is made. No language in this specification should be construed as indicating that any unclaimed element is essential for the practice of the present invention.

[0072] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant values in the specific embodiments have been presented as precisely as possible herein. However, any numerical value inherently contains standard deviations due to individual testing methods. Therefore, unless otherwise clearly stated, it should be understood that all ranges, quantities, numerical values and percentages used in this disclosure are modified by "about". Herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0073] In Examples 1 to 4 of the present invention, the raw materials and reagents used can be purchased from the market.

[0074] The present invention will be further described below in conjunction with examples:

[0075] Example 1 High-throughput sequencing analysis of the bacterial community diversity during the natural storage of jackfruit pulp

[0076] During the natural storage of jackfruit, obvious flavor substances are produced. To isolate the relevant microorganisms, the 16S rDNA of the microbial flora in jackfruit pulp at different natural storage times was sequenced and analyzed for diversity using the Illmina PE300 high-throughput diversity sequencing technology: the 16S rDNA sequence of bacteria was amplified and sequenced to understand the changes in the bacterial flora during the storage of jackfruit pulp. The amplification primers were 799F_1193R. A total of 342,262 16S rDNA sequences, with a total length of 128,410,938 bp, an average length of 375 bp, and 567 OTUs, were obtained from 5 samples, which could be classified into 24 Phylum, 56 Class, 119 Order, 193 Family, and 334 Genus.

[0077] In the heatmap of the diversity analysis, the main microbial genera that may be used for jackfruit fermentation during the spoilage of jackfruit are: Lactobacillus, Prevotella, Pediococcus_Claussen, etc., as Figure 1 shown.

[0078] (2) Isolation and primary screening of microorganisms that may be used for jackfruit pulp fermentation

[0079] MRS medium was used to screen Lactobacillus and Pediococcus, acetate agar medium was used for further isolation and screening of Pediococcus, and Prevotella selective medium was used to isolate and screen Prevotella.

[0080] After the isolated microorganisms were fermented according to the following fermentation conditions, 10 mL of the strain with a concentration of 10 6 CFU / mL was added to 100 g of crushed ripe jackfruit pulp and mixed evenly. The odor discrimination of the fermentation products at different fermentation times (6 h, 12 h, 18 h, 24 h, 30 h) was used for primary screening. The fermentation conditions were:

[0081] Lactobacillus, 36 °C, pH 6.2, anaerobic condition;

[0082] Pediococcus_Claussen, 30 °C, pH 6.5, light-shielded, anaerobic condition;

[0083] Prevotella, 37 °C, pH 7.0, anaerobic condition;

[0084] After cultivation, 30 trained professionals (professional students) conducted a preliminary screening of the odor of the fermentation products at different times according to Table 1, and unanimously agreed that the products fermented by Pediococcus_Claussen had the best aroma (Table 2).

[0085] Table 1 Flavor Evaluation Table

[0086]

[0087]

[0088] Table 2 Evaluation Results Table of the Flavors of Jackfruit Fermented by Different Isolated Microorganisms

[0089] Separation bacteria genus Latin Average score Sorting Lactobacillus genus Lactobacillus 76.11 2 Prevotella genus Prevotella 62.32 3 Pediococcus genus Pediococcus_Claussen 88.91 1

[0090] (3) Identification of the Bacterial Genus with the Best Flavor

[0091] The isolated bacterial strains were sent to Shanghai Majorbio Bio-Pharm Technology Co., Ltd. for bacterial identification:

[0092] Universal primer sequences 27F: AGAGTTTGATCCTGGCTCAG (as shown in SEQ ID NO: 1); 1492R: GGTTACCTTGTTACGACTT (as shown in SEQ ID NO: 2);

[0093] PCR Amplification

[0094] PCR Reaction System:

[0095]

[0096] PCR Reaction Conditions:

[0097]

[0098]

[0099] The raw sequences at both ends obtained by Sanger sequencing were respectively subjected to quality control to remove low-quality bases. After obtaining the clean sequences, they were assembled to obtain the assembled sequences, and the species information of the top 10 species with the highest similarity to the NT database was obtained by blast.

[0100] Table 3 Information of the Top 10 Microbial Species with the Highest Similarity to the NCBI Database

[0101]

[0102] Bacterial Identification Results:

[0103] Table 4 Bacterial Strain Identification Results Table

[0104] Sample name Sample type for submission Sample source Primer F-end sequencing Primer R-end sequencing NT comparison structure A Bacterial cells Jackfruit 27F: Normal 1492R: Normal Pediococcus_acidilactici

[0105] The results of bacterial identification showed that the bacterium with a better flavor during the fermentation of jackfruit pulp during the storage of jackfruit pulp was Pediococcus_acidilactici.

[0106] (4) Genome sequencing of Pediococcus_acidilactici

[0107] From Figure 3 it can be seen that from the perspective of the tree structure, the isolated bacterium A clustered into a branch with other species of the genus Pediococcus, indicating that they have a relatively close genetic relationship in evolution. The branches adjacent to the genus Pediococcus include species of other genera of lactic acid bacteria, such as Lacticaseibacillus porcinae, Latilactobacillus curvatus_A, etc. These species have a certain genetic relationship with the genus Pediococcus in evolution, but relatively far. The branch of the genus Pediococcus where the isolated bacterium A of the present invention is located is in a relatively independent position in the phylogenetic tree, indicating that the species of this genus have formed certain specificities during the evolutionary process, and once again proving the results of bacterial identification.

[0108] The genome annotation map is as Figure 4 shown. The genome annotation map shows the linear arrangement, transcription direction, functional classification of the genome of Pediococcus_acidilactici, and the relationship between genes, providing important information for understanding the genome structure and function, and revealing that the genome of Pediococcus_acidilactici has:

[0109] Genes related to metabolism: such as bglF (possibly related to β-glucosidase and involved in carbohydrate metabolism), celB (possibly related to cellulase and involved in polysaccharide decomposition), galM (possibly related to galactose metabolism), etc., indicating that Pediococcus_acidilactici has strong functions in carbohydrate metabolism.

[0110] Genes related to amino acid metabolism: such as leuS (possibly related to the biosynthesis of leucine), ilvA (possibly related to the biosynthesis of isoleucine), indicating that Pediococcus_acidilactici can synthesize various amino acids.

[0111] Other functional genes: There are also genes related to nucleic acid metabolism (such as endA, possibly related to endonuclease activity), vitamin metabolism (such as metK, possibly related to methionine biosynthesis), etc., showing that Pediococcus_acidilactici has a relatively comprehensive metabolic ability.

[0112] The CGView genomic circular map can comprehensively display the characteristics of the genome, such as Figure 5 As shown, this figure shows the genomic characteristics of Pediococcus acidilactici. Genome size: 1,933,675 bp. Functional classification analysis of the genes in the genome: This microorganism has functions such as RNA processing and modification (A), chromatin structure and dynamics (B), energy production and conversion (C), cellular defense mechanisms (D), amino acid transport and metabolism (E), nucleotide transport and metabolism (F), carbohydrate transport and metabolism (G), coenzyme transport and metabolism (H), lipid transport and metabolism (I), post-translational modification, protein turnover, molecular chaperones (O), transcription (K), replication, recombination and repair (L), cell wall / membrane / envelope biosynthesis (M), intracellular transport, secretion and vesicle transport (U), defense mechanisms (V), signal transduction mechanisms (T), biosynthesis, transport and degradation of secondary metabolites (Q), etc. It has a high gene coding density and may adapt to the needs of rapid growth and metabolism, as well as relatively comprehensive metabolic and adaptability capabilities. Therefore, this bacterium can utilize a variety of carbon sources and energy sources, adapt to different environmental conditions, and has potential application value in various fields.

[0113] (5) Preservation and registration of the isolated strain

[0114] This strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), named Pediococcus acidilactici GYL-001, and the preservation number is CGMCC No. 31573.

[0115] Example 2 Processing technology of semi-dry leisure food fermented from Pediococcus acidilactici GYL-001 strain with good flavor

[0116] (1) Process flow and operation points

[0117] Screening → Washing → Taking the flesh and removing the core → Puncturing (making holes with a nail board) → Inoculating and fermenting → Low-temperature drying → Finished product.

[0118] (2) Operation points:

[0119] Screening: For jackfruit fruits (the source of jackfruit fruits is dry-pack jackfruit (Qiong Yin No. 1) purchased from Zhongliao Village, Jiyang District, Sanya City, Hainan Province), fruits with more than 90% maturity should be selected, and diseased and rotten fruits should be removed.

[0120] Washing: Clean the dirt on the surface of the jackfruit.

[0121] Flesh extraction and core removal: In the jackfruit, the pericarp and core contain a large amount of white latex-like substances, which have strong adhesiveness, are soluble in grease, and insoluble in water. When the fruit is cut, a large amount of latex-like substances will ooze out. When extracting the flesh, grease should be applied to the cutter to avoid the adhesion of latex-like substances to the flesh as much as possible.

[0122] Puncturing: Puncture the jackfruit flesh with a nail board, with 3 - 5 punctures / cm 2 , which is conducive to the entry of the strain into the interior of the flesh for uniform fermentation.

[0123] Inoculation and fermentation: Use single-factor experiments to determine the fermentation temperature, fermentation broth concentration, fermentation time, and sucrose addition amount respectively.

[0124] Low-temperature drying: To maintain the activity of the strain, stop drying at 50 °C when the weight of the finished product reaches 50% of the initial weight.

[0125] (3) Use single-factor experiments to preliminarily determine the culture conditions:

[0126] Taking the sensory flavor evaluation as an index, use single-factor experiments to determine the fermentation temperature, fermentation broth concentration, fermentation time, and sucrose addition amount respectively.

[0127] Table 5 Sensory scoring items and scoring criteria for fermented jackfruit flesh

[0128]

[0129]

[0130] 1) Use single-factor experiments to determine the fermentation temperature: Select fermentation temperatures of 28 °C, 30 °C, 32 °C, 34 °C, and 36 °C respectively. Fixed conditions: 500 mL of broth, broth density of 10 6 CFU / mL, sucrose addition amount of 3%, jackfruit flesh weight of 100 g, fermentation time of 18 h. As Figure 6 shown, the optimal fermentation temperature is 30 °C.

[0131] 2) Use single-factor experiments to determine the cell concentration of the broth: Select broth concentrations of 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL, 10 7 CFU / mL respectively. Fixed conditions: Fermentation temperature of 30 °C, sucrose addition amount of 3%, jackfruit flesh weight of 100 g, fermentation time of 18 h. As Figure 7 shown, the optimal fermentation broth concentration is 10 6 CFU / mL.

[0132] 3) Determination of fermentation time by single-factor experiment: Select 6h, 12h, 18h, 24h, 30h respectively, fermentation temperature 30°C, sucrose addition amount 3%, jackfruit pulp weight 100g, fermentation broth concentration 10 6 CFU / mL, as Figure 8 shown, the optimal fermentation time is determined to be 18h.

[0133] 4) Determination of sucrose addition amount by single-factor experiment: Select 1%, 2%, 3%, 4%, 5% (i.e., 1 - 5g sucrose added to 100g pulp) respectively, fermentation temperature 30°C, sucrose addition amount 3%, jackfruit pulp weight 100g, fermentation broth concentration 10 6 CFU / mL, fermentation time 18h, as Figure 9 shown, the optimal sucrose addition amount is determined to be 3%.

[0134] (4) To better determine the flavor of fermented jackfruit pulp, using fermentation time as the gradient, GC-IMS was used to determine the volatile flavor components of semi-dried jackfruit pulp fermented by Pediococcus acidilactici GYL-001 at different fermentation times.

[0135] The samples for determination were: fermentation temperature 30°C, sucrose addition amount 3%, jackfruit pulp weight 100g, fermentation broth concentration 10 6 CFU / mL, the optimal sucrose addition amount was determined to be 3%, and the samples at different fermentation times were respectively denoted as 1, 2, 3, 4, 5, corresponding to fermentation times 6h, 12h, 18h, 24h, 30h respectively, with three parallels for each sample.

[0136] The GC-IMS determination results are as Figures 10 - 12As shown, the contents of substances such as Butyl isobutyrate, ethyl 2-methylpropanoate, (Z)-3-Hexen-1-yl acetate, (E)-2-Hexen-1-ol acetate, Hexan oicacid.methyl ester, 3-Hexanone, etc. are relatively high in Sample 1; the contents of substances such as 2-butanol, 4-He ptanone, etc. are relatively high in Sample 2; the contents of substances such as alpha-Pinene, Geraniol, 5-Hepten-2-one.6-methyl-, Isopropylisobutyrate, (Z)-2-Methylpent-2-enal, gamma-Terpinene, 3-methyl-1-pentanol, etc. are relatively high in Sample 3; the contents of substances such as Amyl acetate, beta-myrcene, Ethyl nonanoate, 1-hexanal, methylpentanoate, butyl acetate, etc. are relatively high in Sample 4; the contents of substances such as Ethyl Acetate, Decanal, (E)-Ethyl-2-hexenoate, (E)-2-hexen-1-al, Li monene, 2-Butanone, 2-Heptanone, (Z)-3-hexen-1-ol, (Z)-4-heptenal, (Z)-3-Hexenyl formate, 1-pentanal, (E)-2-Heptenal, Ethyl 2-hydroxypropanoate, Bu tanoic acid ethyl ester, 1-Butanol.3-methyl, etc. are relatively high in Sample 5.

[0137] Analysis of the main flavor substances in each sample:

[0138] Sample 1:

[0139] Butyl isobutyrate: It has a fruity aroma and is commonly used in food flavors.

[0140] Ethyl 2-methylpropanoate: It has a fruity aroma and is commonly used in flavors.

[0141] (Z)-3-Hexen-1-yl acetate: It has a fresh, grass-like aroma and is commonly used in flavors.

[0142] (E)-2-Hexen-1-ol acetate: It has a floral and fruity aroma and is commonly used in flavors.

[0143] Hexanoic acid, methyl ester: It has a fruity fragrance and is often used in perfumes.

[0144] 3-Hexanone: It has an odor like acetone and may cause some irritation.

[0145] The flavor of Sample 1 is mainly fruity and grassy, and is overall fresh and natural, suitable for people who like fresh fruity scents.

[0146] Sample 2:

[0147] 2-Butanol: It has an alcohol odor and may cause some irritation.

[0148] 4-Heptanone: It has a characteristic odor of ketones and may cause some chemical feeling.

[0149] The flavor of Sample 2 is relatively more stimulating, containing the odors of alcohol and ketones, and is overall more chemically felt, not very suitable for people sensitive to chemical odors.

[0150] Sample 3:

[0151] α-Pinene: It has an aroma like pine trees and is often used in perfumes and essential oils.

[0152] Geraniol: It has a rose fragrance and is often used in perfumes.

[0153] 5-Hepten-2-one, 6-methyl-: It has a characteristic odor of ketones and may cause some chemical feeling.

[0154] Isopropyl isobutyrate: It has a fruity fragrance and is often used in perfumes.

[0155] (Z)-2-Methylpent-2-enal: It has a characteristic odor of aldehydes and may cause some irritation.

[0156] γ-Terpinene: It has an aroma like pine trees and is often used in perfumes.

[0157] 3-methyl-1-pentanol: It has an alcohol odor and may cause some irritation.

[0158] The flavor of Sample 3 is relatively complex, containing pine and rose fragrances, but also has a chemical feeling and irritation brought by ketones and aldehydes. The overall aroma is relatively strong, suitable for people who like strong aromas.

[0159] Sample 4:

[0160] Amyl acetate: It has a banana-like fruity aroma and is often used in fragrances.

[0161] β-Myrcene: It has a pine and fruity aroma and is often used in fragrances.

[0162] Ethyl nonanoate: It has a fruity aroma and is often used in fragrances.

[0163] 1-Hexanal: It has a grassy aroma and is often used in fragrances.

[0164] Methylpentanoate: It has a fruity aroma and is often used in fragrances.

[0165] Butyl acetate: It has a fruity aroma and is often used in fragrances.

[0166] The flavor of Sample 4 is mainly fruity and grassy, and is overall fresh and natural, suitable for people who like fresh fruity scents.

[0167] Sample 5:

[0168] Ethyl Acetate: It has a nail polish-like odor and may cause some irritation.

[0169] Decanal: It has a waxy and citrus aroma and is often used in fragrances.

[0170] (E)-Ethyl-2-hexenoate: It has a fruity aroma and is often used in fragrances.

[0171] (E)-2-Hexen-1-al: It has a grassy aroma and is often used in fragrances.

[0172] Limonene: It has a lemon-like citrus aroma and is often used in fragrances.

[0173] 2-Butanone: It has an acetone-like odor and may cause some irritation.

[0174] 2-Heptanone: It has a characteristic ketone odor and may cause some chemical feeling.

[0175] (Z)-3-Hexen-1-ol: It has a grassy aroma and is often used in fragrances.

[0176] (Z)-4-Heptenal: It has a characteristic aldehyde odor and may cause some irritation.

[0177] (Z)-3-Hexenyl formate: It has a grassy aroma and is often used in fragrances.

[0178] 1-Pentanal: It has a grassy aroma and is commonly used in fragrances.

[0179] (E)-2-Heptenal: It has the characteristic odor of aldehydes and may cause some irritation.

[0180] Ethyl 2-hydroxypropanoate: It has a fruity fragrance and is commonly used in fragrances.

[0181] Butanoic acid ethyl ester: It has a fruity fragrance and is commonly used in fragrances.

[0182] 1-Butanol,3-methyl-: It has an alcoholic odor and may cause some irritation.

[0183] The flavor of Sample 5 is relatively complex, including citrus, fruity, and grassy scents. However, there is also a chemical and irritating feeling brought by ketones and aldehydes. The overall aroma is relatively strong, suitable for people who like strong aromas.

[0184] Summary: The overall flavors of Sample 2 and Sample 5 are relatively irritating; the flavor of Sample 1 is relatively fresh but too bland; Samples 3 and 4 both have good flavors. Among them, the flavor of Sample 3 is relatively strong, with a good natural flavor of jackfruit. The flavor of Sample 4 has a reduced rich jackfruit flavor due to the extended fermentation time, and there is a certain jackfruit fruit aroma. Therefore, Sample 3 is the most suitable time condition for fermenting jackfruit pulp.

[0185] The process parameters for the final fermentation of semi-dry jackfruit snacks by Pediococcus acidilactici GYL-001 are determined as follows: fermentation temperature 30°C, sucrose addition 3%, jackfruit pulp weight 100g / 500mL, fermentation broth concentration 10 6 CFU / mL. The optimal sucrose addition is determined to be 3%, and the fermentation time is 18h.

[0186] Example 3 Fermentation of Jackfruit Juice by Pediococcus acidilactici GYL-001

[0187] Process Flow and Operating Key Points

[0188] Screening → Washing → Removing flesh and pits → Coarse crushing → Blanching → Jackfruit juice preparation → High-temperature and high-pressure sterilization → Cooling → Inoculation and fermentation → Beverage formulation → Canning into finished products.

[0189] (1) Operating Key Points:

[0190] Screening: The jackfruit fruits should be selected as fully ripe ones, and fruits with pests, diseases, or rot should be removed.

[0191] Washing: Clean the dirt on the surface of the jackfruit thoroughly.

[0192] Fleshy fruit extraction and core removal: In the jackfruit, the pericarp and the core contain a large amount of white latex-like substances with extremely strong adhesiveness. When extracting the fleshy fruit, grease should be applied to the cutter to avoid the latex-like substances adhering to the fleshy fruit as much as possible.

[0193] Coarse crushing: Crush the jackfruit into small pieces.

[0194] Blanching: Put the jackfruit fleshy fruit into hot water at about 90 °C for 1 - 2 min to inactivate the enzymes and soften the fleshy fruit tissue.

[0195] Jackfruit juice preparation: Crush it again and mix it in the ratio of 10 g of jackfruit / 100 mL of water, and use a juicer to beat the fleshy fruit into juice to make the juice delicate and without lumps.

[0196] High-temperature and high-pressure sterilization: Kill the harmful microorganisms that cause the spoilage of the jackfruit beverage and inactivate the enzymes, at 121 °C for 15 - 20 min.

[0197] Cooling: Cool the juice to about 40 °C and inoculate.

[0198] Fermentation: Mix the strains thoroughly and add them to the fruit pulp raw materials for fermentation at a temperature of 36 °C.

[0199] Formulation: For the fermented jackfruit juice, supplement with xylitol and citric acid for formulation (the formulation ratio is determined by step (4)).

[0200] (2) Sensory evaluation method for Pediococcus acidilactici GYL-001 fermented jackfruit juice

[0201] Develop a sensory evaluation form according to the sensory indexes such as the color, aroma, taste, and tissue condition of the beverage, as shown in Table 6.

[0202] Table 6 Beverage sensory scoring items and scoring criteria

[0203]

[0204] (3) Fermentation process determination

[0205] Fermentation process optimization:

[0206] Through preliminary experiments, the basic formula of the fermented beverage is determined as 10 g of jackfruit, 100 mL of water, 4 g of sucrose, and 3 g of milk powder, and the basic parameter range of the fermentation process is determined. The fermentation time is respectively 6 h, 8 h, 10 h, 12 h, 14 h; the fermentation temperature is 26 °C, 28 °C, 30 °C, 32 °C, 34 °C, 36 °C; the inoculation amount is 10 3 、10 4 、105 , 10 6 , 10 7 , a single-factor experiment was conducted, and the optimal three levels were selected to obtain the factor level table as Table 7.

[0207] As shown by Figure 13 , 6 h, 8 h, and 10 h were selected as the three levels of the orthogonal experiment.

[0208] As shown by Figure 14 , 28 °C, 30 °C, and 32 °C were selected as the three levels of the orthogonal experiment.

[0209] As shown by Figure 15 , 10 5 , 10 6 , 10 7 were selected as the three levels of the orthogonal experiment.

[0210] Table 7 Factor Level Table for Orthogonal Experiment of Fermentation Process

[0211]

[0212] Table 8 Results of L9(3 4 ) Orthogonal Experiment of Fermentation Process

[0213]

[0214] Results of orthogonal experiment: It can be seen from the table that the order of the influence of fermentation time, fermentation temperature, and inoculum amount on product quality in the fermentation process conditions is C > B > A, indicating that among the factors affecting the flavor quality of the product in the fermentation process conditions, the inoculum amount has the greatest influence, followed by temperature, and the fermentation time has the smallest influence; through range analysis, it is known that the best level combination is A2B2C2, but since the A2B2C2 experimental group is not in the table, through verification experiments, a sensory comprehensive score was given to A2B2C2, and the score result was 85 points, which is higher than the sensory comprehensive scores of the nine groups of experiments. That is, the optimal fermentation conditions are fermentation time of 8 h, fermentation temperature of 30 °C, and inoculum amount of 1×10 6 .

[0215] (4) Optimization of Fermentation Formula

[0216] The main factors affecting the taste of jackfruit pulp fermented beverage are the concentration of jackfruit juice, the addition amount of xylitol, and the addition amount of citric acid. The dosage ranges of each factor in the experiment are initially determined. Using comprehensive sensory evaluation as the method, single-factor experiments are carried out: juice concentrations of 10%, 12%, 14%, 16%, 18%; xylitol addition amounts of 1.0%, 1.5%, 2.0%, 2.5%, 3.0%; citric acid addition amounts of 0.05%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%. (That is, 1 - 3 g of xylitol or 0.05 - 0.3 g of citric acid is added to 100 mL of the beverage) Single-factor experiments are carried out to obtain the factor level table as follows:

[0217] Table 9 Orthogonal test factor level table for L9(3 4 ) optimization of the formula

[0218]

[0219] Table 10 Results of the L9(3 4 ) orthogonal experiment

[0220]

[0221] Results of the orthogonal experiment. As can be seen from Table 10, in the beverage blending process, the order of the influence of the juice concentration, the addition amount of xylitol, and the addition amount of citric acid on the product quality is C > A > B. Through the primary and secondary factors, among the factors affecting the flavor quality of the product in the beverage blending process, the influence of the addition amount of citric acid is the greatest, followed by the juice concentration, and the addition amount of xylitol is the smallest; through range analysis, the best level combination is found to be A2B2C2. However, since the experimental group of A2B2C2 is not in the table, through verification experiments, a comprehensive sensory score is given to A2B2C2. The scoring result is 97 points, which is higher than the comprehensive sensory scores of the nine groups of experiments. That is, the optimal formula for beverage blending is a juice concentration of 14%, an addition amount of xylitol of 2%, and an addition amount of citric acid of 0.15%.

[0222] Summary: It is determined that the optimal fermentation process for Pediococcus acidilactici GYL - 001 fermented jackfruit juice beverage is a fermentation time of 8 h, a fermentation temperature of 30 °C, an inoculation amount of 1×10 6 , a juice concentration of 14%, 2% xylitol, and 0.15% citric acid. At this time, the flavor quality effect of the product is the best. The jackfruit pulp fermented beverage produced by this process and formula has a moderate fruit aroma, a good taste, a milky yellow color, and a stable and uniform system, meeting the requirements of beverage production and can be applied to production.

[0223] Example 4 Response surface optimization of the fermentation process of Pediococcus acidilactici GYL - 001 fermented jackfruit beverage

[0224] The sensory evaluation method was the same as that in Example 1. The single-factor experiments on the four factors of fermentation time, temperature, inoculum amount, and fruit juice concentration were the same as those in Example 1, and a response surface factor level table was established.

[0225] Table 11 Response surface factor level table of fermentation process

[0226]

[0227] According to Table 11, the Box-Behnken method was used to design the response surface experiment, and a corresponding surface experiment table was established. The experiments were carried out according to the experiment table (Table 12), with the sensory score as the response value. The standard least squares method was adopted, with the focus on effect screening.

[0228] Table 12 Response surface experiment table

[0229]

[0230]

[0231] From Figure 18 the prediction of the maximized willingness value, it is known that when the fermentation time is 8 h (7.9846316 h), the fermentation temperature is 30 °C (29.825363 °C), the inoculum amount is 1×10 6 (10 5.98032 ), and the fruit juice concentration is 14% (13.966932%), the maximized willingness score of 93.59484 points can be obtained. After re-verification through experiments, it is proved that the beverage produced with these parameters has the best flavor.

[0232] The above is only the preferred embodiment of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Pediococcus acidilactici, characterized in that Its deposit number is: CGMCC No.31573.

2. A microbial agent, characterized in that: include: The Pediococcus acidilactici according to claim 1 and an acceptable adjuvant.

3. Use of the Pediococcus acidilactici according to claim 1 and / or the microbial agent according to claim 2 in the preparation of a fermented food; the fermented food contains jackfruit; the fermented food comprises: Solid and / or liquid.

4. A method for preparing a solid-state fermented food containing jackfruit, characterized in that: The jackfruit after pretreatment is pierced, inoculated with the Pediococcus acidilactici as claimed in claim 1 and / or the microbial agent as claimed in claim 2 for fermentation, and dried to obtain the solid-state fermented food containing jackfruit.

5. The preparation method according to claim 6, characterized in that: The fermentation temperature is 28-36°C and the fermentation time is 6-30h; the number of viable bacteria inoculated is 10 3 ~10 7 CFU / mL; the fermentation also includes the step of adding sucrose; the amount of sucrose added is 1-5%.

6. The solid-state fermented food containing jackfruit obtained by the preparation method as claimed in claim 4 or 5.

7. A method for preparing a liquid fermented food containing jackfruit, characterized in that: The pretreated jackfruit is mixed with water, sterilized, and cooled, and then inoculated with the Pediococcus acidilactici as claimed in claim 1 and / or the microbial agent as claimed in claim 2 for fermentation to obtain fermented juice, which is then blended to obtain the liquid fermented food containing jackfruit.

8. The preparation method according to claim 11, characterized in that: The fermentation temperature is 26-36°C, the fermentation time is 6-14h; the number of viable bacteria inoculated is 10 3 ~10 7 CFU / mL.

9. The preparation method according to any one of claims 11 to 13, characterized in that: The preparation adopts citric acid and xylitol; the liquid fermented food containing jackfruit contains 10 to 18 parts of the fermented juice, 0.05 to 0.3 parts of citric acid and 1 to 3 parts of xylitol by weight.

10. A liquid fermented food containing jackfruit obtained by the preparation method according to any one of claims 7 to 9.

Images