Bacillus velezensis engineering flora for preventing and controlling tomato bacterial wilt under salt stress and application of bacillus velezensis engineering flora

Abstract

The invention discloses a bacillus velezensis engineering flora for preventing and controlling tomato bacterial wilt under salt stress and application of the bacillus velezensis engineering flora, the bacillus velezensis engineering flora is formed by inserting TnYLB-1 transposon of three bacillus velezensis T-5 into mutant strains, the insertion sites are respectively ndh, btr and ykcB, and the preservation numbers of the strains are respectively GDMCC NO: 66119, GDMCC NO: 66120 and GDMCC NO: 66121. Compared with a wild type T-5, the engineering flora can significantly improve the abundance of beneficial bacillus amyloliquefaciens in rhizosphere and reduce the abundance of pathogenic bacterial wilt, and can efficiently prevent and control tomato bacterial wilt under salt stress.

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms, and specifically relates to three TnYLB-1 transposon random insertion mutants T5M1 (ndh), T5M2 (btr), and T5M3 (ykcB) of Bacillus velezensis T-5 with antagonistic effects against Ralstonia solanacearum (referred to as "Ralstonia solanacearum"), relates to an engineered Bacillus velezensis consortium for controlling tomato bacterial wilt under salt stress, and relates to the application of the engineered Bacillus velezensis consortium in controlling tomato bacterial wilt under salt stress. Background Art

[0002] The growth of crops often faces threats from multiple soil stress factors simultaneously, severely restricting the improvement of food production capacity. There are many types of soil stress factors, which can be divided into two categories: one is caused by abiotic factors, such as salt stress caused by excessive salt concentration; the other is caused by pathogenic microorganisms in the soil, such as bacterial wilt caused by the soil-borne pathogen Ralstonia solanacearum. However, current research mostly focuses on the occurrence mechanisms and prevention and control strategies of single stress, ignoring the fact that multiple stress factors coexist.

[0003] Tomato (Solanum lycopersicum L.) is an important vegetable crop with economic value. During its production process, it often faces the combined stress of bacterial wilt and salt stress. Bacterial wilt occurs in most parts of China, especially severe in the south. Traditional control methods mainly use chemical fungicides, but there are problems such as high cost, environmental pollution, and the easy generation of drug resistance in pathogenic bacteria. Biological control, as an environmentally friendly and sustainable control method, has received extensive attention. A large number of studies have shown that beneficial microorganisms in the rhizosphere can effectively control the occurrence of tomato bacterial wilt. For example, Bacillus velezensis, etc. Bacillus velezensis can inhibit the proliferation of pathogenic Ralstonia solanacearum by producing secondary metabolites, competing for ecological niches, etc. However, the biocontrol effect of a single beneficial microorganism is often unstable during application because the functions of beneficial bacteria are restricted by abiotic stresses such as salt stress in the soil.

[0004] Engineering transformation and the construction of synthetic beneficial microbial consortia are effective technical means to enhance and stabilize the functions of beneficial bacteria. Engineering transformation is to modify the DNA sequence in the microbial genome using molecular biology techniques so that it can exert the expected functions. Currently, there have been studies that have obtained beneficial microorganisms with improved biocontrol characteristics through the means of random transposon insertion, effectively reducing the occurrence of diseases. The construction of synthetic microbial consortia mainly combines multiple beneficial microorganisms. Compared with a single strain, synthetic microbial consortia can perform complex functions that individuals cannot complete and have higher stability, and can better resist environmental disturbances.

[0005] Therefore, it is urgent to combine the advantages of engineering transformation and synthetic microbiota construction, use the mutant strains obtained by engineering transformation of beneficial bacteria for synthetic microbiota construction, and utilize the engineered microbiota to effectively prevent and control the occurrence of tomato bacterial wilt under salt stress. Summary of the Invention

[0006] In view of the fact that beneficial microorganisms often struggle to multiply in large numbers in the soil and achieve the expected prevention and control effect due to the concurrent occurrence of bacterial wilt and salt stress. In this invention, taking the beneficial microorganism Bacillus velezensis T-5 as the object, 3 mutant strains were obtained by random insertion of the TnYLB-1 transposon, named Bacillus velezensis T5M1, Bacillus velezensis T5M2, and Bacillus velezensis T5M3 respectively, with the insertion sites being ndh, btr, and ykcB. Through experiments, it was found that under salt stress, compared with the wild-type strain T-5, the yields of antagonistic substances and siderophores of T5M1 were significantly increased, the yield of siderophores of T5M2 was significantly increased, and the yields of antagonistic substances and biomass of T5M3 were significantly increased; compared with the wild-type, the amounts of antagonistic substances, biomass, and siderophores of the engineered microbiota constructed by combining the three were significantly increased; in greenhouse pot experiments, when the engineered microbiota was applied to the salt-stressed soil by root irrigation, the abundance of Bacillus velezensis in the tomato rhizosphere could be significantly increased and the abundance of Ralstonia solanacearum could be decreased, effectively inhibiting the occurrence of tomato bacterial wilt under salt stress. This indicates that by constructing an engineered microbiota composed of three randomly inserted mutant strains T5M1, T5M2, and T5M3 of Bacillus velezensis T-5 with the TnYLB-1 transposon, the biocontrol efficiency of beneficial microorganisms under salt stress can be improved, and the occurrence of tomato bacterial wilt under salt stress can be prevented and controlled.

[0007] The purpose of this invention is to provide three randomly inserted mutant strains T5M1, T5M2, and T5M3 of Bacillus velezensis T-5 with the TnYLB-1 transposon and the application of the combined use of mutant strains T5M1, T5M2, and T5M3 in preventing and controlling tomato bacterial wilt under salt stress.

[0008] The purpose of this invention is achieved through the following technical solutions:

[0009] In the first aspect, this invention provides the following strains:

[0010] Bacillus velezensis mutant strain 1, named: Bacillus velezensis T5M1, classified as: Bacillus velezensis, is a random insertion mutant strain of the TnYLB-1 transposon of Bacillus velezensis T-5, with an insertion site of ndh. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, the culture collection number is: GDMCC NO: 66119, and is subsequently referred to as mutant strain T5M1.

[0011] Bacillus velezensis mutant strain 2, named: Bacillus velezensis T5M2, classified as: Bacillus velezensis, is a random insertion mutant strain of the TnYLB-1 transposon of Bacillus velezensis T-5, with the insertion site being btr. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the culture collection number is: GDMCC NO: 66120, and is subsequently referred to as mutant strain T5M2.

[0012] Bacillus velezensis mutant strain 3, named: Bacillus velezensis T5M3, classified as: Bacillus velezensis, is a random insertion mutant strain of the TnYLB-1 transposon of Bacillus velezensis T-5, with the insertion site being ykcB. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the culture collection number is: GDMCC NO: 66121, and is subsequently referred to as mutant strain T5M3.

[0013] In a second aspect, the present invention provides an engineered bacterial population for preventing and controlling tomato bacterial wilt under salt stress, wherein the engineered bacterial population is composed of at least two of mutant strains T5M1, mutant strain T5M2, and mutant strain T5M3.

[0014] In a third aspect, the present invention provides the use of the strains and engineered bacterial flora described above for preventing and controlling tomato bacterial wilt under salt stress.

[0015] In a fourth aspect, the present invention provides the use of the strains and engineered bacterial flora described above in the preparation of microbial preparations for preventing and controlling tomato bacterial wilt under salt stress.

[0016] In a specific embodiment, the microbial preparation is live bacteria of the strain or engineered bacterial population described above, or a microbial preparation made from the engineered bacterial population described above.

[0017] In a more specific embodiment, the application is carried out by applying the microbial agent prepared as described above into the rhizosphere of tomatoes by root irrigation.

[0018] In a fifth aspect, the present invention provides a microbial inoculant, which contains the engineered microbial community described above.

[0019] In a specific embodiment, the volume ratio of mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 in the microbial inoculant is 1:1:1.

[0020] In a sixth aspect, the present invention provides the application of the microbial inoculant described above in preventing and controlling tomato bacterial wilt under salt stress.

[0021] In a specific implementation embodiment, the application includes the step of applying the microbial inoculant described above to the rhizosphere of tomatoes by the root irrigation method.

[0022] In a seventh aspect, the present invention provides a method for preventing and controlling tomato bacterial wilt under salt stress using the engineered microbial community described above. The engineered microbial community is applied to the rhizosphere of tomatoes by the root irrigation method, and the engineered microbial community solution with a concentration of 1×10 6 ~10 8 CFU / g soil is applied to each tomato plant.

[0023] In a specific embodiment, the method includes the following specific steps:

[0024] (1) Mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 are respectively cultured to obtain mutant strain T5M1 bacterial solution, mutant strain T5M2 bacterial solution, and mutant strain T5M3 bacterial solution, and then the mutant strain T5M1 bacterial solution, mutant strain T5M2 bacterial solution, and mutant strain T5M3 bacterial solution are mixed according to a volume ratio of 1:1:1 to obtain a bacterial solution;

[0025] (2) The mixed bacterial solution obtained in step (1) is applied to the rhizosphere of tomatoes by the root irrigation method.

[0026] The concentration of the mutant strain T5M1 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0027] The concentration of the mutant strain T5M2 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0028] The concentration of the mutant strain T5M3 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0029] The mutant strain bacterial liquid is prepared by the following method:

[0030] The mutant strain T5M1 is activated using an LB solid medium supplemented with 10 μg / mL of kanamycin. A single colony of the mutant strain T5M1 is picked and inoculated into an LB liquid medium, and cultured at 37 °C and 170 - 180 rpm for 18 - 40 h to obtain the mutant strain T5M1 bacterial liquid;

[0031] The mutant strain T5M2 is activated using an LB solid medium supplemented with 10 μg / mL of kanamycin. A single colony of the mutant strain T5M2 is picked and inoculated into an LB liquid medium, and cultured at 37 °C and 170 - 180 rpm for 18 - 40 h to obtain the mutant strain T5M2 bacterial liquid;

[0032] The mutant strain T5M3 is activated using an LB solid medium supplemented with 10 μg / mL of kanamycin. A single colony of the mutant strain T5M3 is picked and inoculated into an LB liquid medium, and cultured at 37 °C and 170 - 180 rpm for 18 - 40 h to obtain the mutant strain T5M3 bacterial liquid;

[0033] The described tomato bacterial wilt is caused by the soil - borne pathogen Ralstonia solanacearum.

[0034] Seven days after transplanting healthy tomato seedlings with consistent growth vigor into a seedling - raising pot, the engineering bacterial community liquid is applied to the rhizosphere soil of the plants by the root - watering method.

[0035] The beneficial effects of the present invention:

[0036] The present invention applies an engineering bacterial community constructed by randomly inserting the TnYLB - 1 transposon of three strains of Bacillus velezensis T - 5 into mutant strains T5M1, T5M2, and T5M3 to control tomato bacterial wilt under salt stress. The biocontrol characteristics of the engineering bacterial community under salt stress, such as antagonistic substances, biomass, and siderophores, are significantly improved. The abundance of Bacillus velezensis in the tomato rhizosphere is significantly increased, and the abundance of Ralstonia solanacearum is significantly decreased, which can effectively control the occurrence of tomato bacterial wilt under salt stress.

[0037] Biological deposit information:

[0038] Bacillus velezensis mutant strain 1, named Bacillus velezensis T5M1, is classified as Bacillus velezensis. It is a random insertion mutant of the TnYLB - 1 transposon of Bacillus velezensis T - 5, and the insertion site is ndh. It was deposited at the Guangdong Provincial Microbial Culture Collection Center on April 11, 2025. Address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou. The culture collection number is: GDMCC NO: 66119.

[0039] Bacillus velezensis mutant strain 2, named Bacillus velezensis T5M2, is classified as Bacillus velezensis. It is a random insertion mutant strain of Bacillus velezensis T-5 with the TnYLB-1 transposon inserted at the btr locus. It was deposited at the Guangdong Microbial Culture Collection Center on April 11, 2025. The address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou. The strain deposit number is GDMCC NO: 66120.

[0040] Bacillus velezensis mutant strain 3, named Bacillus velezensis T5M3, is classified as Bacillus velezensis. It is a random insertion mutant strain of Bacillus velezensis T-5 with the TnYLB-1 transposon inserted at the ykcB locus. It was deposited at the Guangdong Microbial Culture Collection Center on April 11, 2025. The address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou. The strain deposit number is GDMCC NO: 66121. Description of the Drawings

[0041] Figure 1 Show the morphological characteristics of Bacillus velezensis T-5 and its TnYLB-1 transposon insertion mutant strains T5M1, T5M2 and T5M3.

[0042] Figure 2 Show the biocontrol characteristics of the Bacillus velezensis T-5 transposon insertion mutant strains under salt stress. Among them, Figure 2 Figure A in shows the evaluation of antagonistic ability; Figure 2 Figure B in shows the evaluation of biomass; Figure 2 Figure C in shows the ability to produce siderophores. The comparison between the engineered strains and the wild type was performed using a t-test: **, P < 0.01; *, P < 0.05. All error bars represent the standard error of the mean.

[0043] Figure 3 Show the effect of the engineered bacterial community in controlling tomato bacterial wilt under salt stress. Among them, Figure 3 Figure A in shows the disease incidence of tomato plants; Figure 3 Figure B in shows the disease index; Figure 3 Figure C in shows the abundance of pathogenic Ralstonia solanacearum in the rhizosphere; Figure 3 Figure D in shows the abundance of beneficial Bacillus amyloliquefaciens in the rhizosphere. The comparison between different treatments was performed using a t-test: ***, P < 0.001; **, P <0.01; *, P < 0.05. All error bars represent the standard error of the mean. Detailed Implementation Modes

[0044] The technical solution of the present invention will be further described below in conjunction with specific embodiments. Reagents or equipment not indicating the manufacturer are regarded as conventional products that can be purchased on the market.

[0045] LB liquid medium: peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, adjust the pH to 7.2 - 7.4, autoclave at 115 °C for 30 min.

[0046] LB solid medium: Add 20 g / L agar to the LB liquid medium, sterilize at 115 °C for 30 min.

[0047] NCM medium: K2HPO4 17.4 g / L, NaCl 11.6 g / L, glucose 5.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, trisodium citrate 0.3 g / L, MgSO4·7H2O 0.05 g / L, sorbitol 91.1 g / L, adjust the pH to 7.2, sterilize at 115 °C for 30 min.

[0048] NA medium: glucose 10.0 g / L, peptone 5.0 g / L, beef extract 3.0 g / L, yeast extract 0.5 g / L, adjust the pH to 7.2 - 7.4, autoclave at 115 °C for 30 min.

[0049] NA solid medium: Add 20 g / L agar to the NA liquid medium, pH 7.5, sterilize at 115 °C for 30 min.

[0050] MKB medium: K2HPO4 2.5 g / L, MgSO4·7H2O 2.5 g / L, glycerol 15.0 mL / L, casein amino acids 5.0 g / L, adjust the pH to 7.2 - 7.4, sterilize at 115 °C for 30 min.

[0051] Root exudate simulation (recomposed exudate, abbreviated as "RE") medium: MgSO4·7H2O 0.5 g / L, K2HPO4 1.0 g / L, 0.5 g / L KCl, 1.0 g / L yeast extract, 1.2 mg / L Fe2(SO4)3, 0.4 mg / L MnSO4, 1.6 mg / L CuSO4, 2 g / L (NH4)2SO4, 0.8 g / L glucose, 1.3 g / L fructose, 0.2 g / L maltose, 0.02 g / L ribose, 5.6 g / L citric acid, 1.4 g / L succinic acid, 0.2 g / L malic acid, 0.8 g / L casein amino acids. Adjust the pH to 7.2 - 7.4 and filter sterilize with a 0.22 μm sterile filter membrane.

[0052] Pathogenic bacterium: Ralstonia solanacearum QL - RS1115, isolated from the rhizosphere soil of tomato plants with bacterial wilt by the laboratory. It is the model pathogenic bacterium of the present invention and can grow on NA medium.

[0053] Beneficial bacterium: Bacillus velezensis T - 5, isolated from the rhizosphere soil of healthy tomatoes by the laboratory. It is the model beneficial bacterium of the present invention and can grow on LB or NA medium.

[0054] Plasmid: Thermosensitive shuttle plasmid pMarA, carrying the TnYLB - 1 transposon. The HimarI transposase gene is under the control of the P A promoter, Kan r 、Amp r 、Erm r (Le Breton et al., 2006).

[0055] Example 1 Construction, screening and identification of mutant strains

[0056] First, culture Bacillus velezensis T - 5 overnight in NCM medium. Dilute the bacterial solution 25 - fold with fresh NCM medium supplemented with 5 mg / mL glycine and culture at 30 °C and 170 rpm until the OD 600 is approximately 0.8. After ice - bathing for 30 min, centrifuge at 8000 rpm for 6 min at 4 °C to collect the cells. Wash the cells 4 times with ice - cold electroporation buffer (ETM, 0.5 mol / L sorbitol, 0.5 mol / L mannitol and 10% glycerol), and resuspend the cells in ETM buffer containing 10% PEG 6000 and 1 mmol / L MgCl2 to obtain competent cells, which are stored at - 80 °C in the refrigerator for later use.

[0057] Mix 200 μL of competent cells with 500 ng of plasmid pMarA in an electroporation cuvette with a path length of 0.2 cm. After placing the mixture at room temperature for 1 - 3 min, apply an electric pulse using a MicroPulser Electroporator (Bio-Rad Laboratories) at an electric field strength of 7.5 kV / cm for a pulse time of 4.6 - 6 ms. After the pulse, quickly transfer the cells to 1 mL of LB liquid medium and incubate at 30 °C with shaking at 170 rpm for 3 - 8 h. Then spread the bacterial suspension on an LB solid medium containing 10 μg / mL erythromycin and incubate at 30 °C for 36 - 48 h to obtain transformants. To screen for transposon insertion mutants, transfer the erythromycin-resistant colonies carrying the plasmid individually to fresh LB and incubate overnight at 30 °C. Dilute and spread the cultures on a solid medium containing 10 μg / mL kanamycin and incubate at 46 °C for 24 h to isolate single colonies. Since cells carrying the intact pMarA plasmid are resistant to both erythromycin and kanamycin, while cells carrying the integrated transposon are only resistant to kanamycin, the single colonies are cultured separately on LB solid media containing 10 μg / mL erythromycin or 10 μg / mL kanamycin, and three strains that are only resistant to kanamycin are selected and named Bacillus velezensis T5M1 (also known as mutant T5M1), Bacillus velezensis T5M2 (also known as mutant T5M2), and Bacillus velezensis T5M3 (also known as mutant T5M3) ( Figure 1 ).

[0058] The insertion sites of transposons in each mutant strain were determined by inverse PCR. First, a bacterial DNA extraction kit (Omega, USA) was used to extract the DNA of the mutant strain. The obtained DNA was digested with Taq I, and the digestion system (25 μL) was: 1 μL Taq I, 2 μL 10× Taq I Buffer, 2 μL 0.1% BSA, 5 μL DNA, 15 μL sterilized water, and reacted at 65 °C for 1 - 2 h. A PCR purification kit (Omega, USA) was used to recover the digested product, and then T4 DNA ligase (Takara, Japan) was used to self-circularize the purified digested product. The ligation system (20 μL) was: 1 μL T4 DNA ligase, 2 μL 10× T4 DNA Ligase Buffer, 5 μL digested product, 12 μL sterilized water, and reacted at 16 °C for 8 - 9 h. Inverse PCR was performed using the circularized ligation product, oIPCR1 primer (5’→3’: GCTTGTAAATTCTATCATAATTG), and oIPCR2 primer (5’→3’: AGGGAATCATTTGAAGGTT GG). The system (25 μL) was: 12.5 μL 2× Taq Master Mix, 1 μL oIPCR1, 1 μL oIPCR2, 10.5 μL ligation product. Amplification conditions: pre-denaturation at 94 °C for 5 min, enter the thermal cycle: denaturation at 94 °C for 30 s, annealing at 55 °C for 1 min 30 s, extension at 72 °C for 45 s, for a total of 30 cycles. A PCR purification kit (Omega, USA) was used to purify the cloned sequence, and the primer oIPCR3 (5’→3’: GCATTTAATACTAGCGACGCC) was used to sequence the flanking genomic region around the transposon insertion site. The obtained DNA sequence was aligned with the complete genome sequence of Bacillus velezensis T-5 (Accession: CP061168) to determine the mutation sites.

[0059] The mutant strain T5M1 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velezensis T-5, and the insertion site is ndh. It was deposited in the Guangdong Microbial Culture Collection Center on April 11, 2025. Address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou. The culture collection number is GDMCC NO: 66119.

[0060] The mutant strain T5M2 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velez T-5, with the insertion site being btr. It was deposited in the Guangdong Microbiological Culture Collection Center on April 11, 2025, at the 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, with the culture collection number of GDMCC NO: 66120.

[0061] The mutant strain T5M3 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velez T-5, with the insertion site being ykcB. It was deposited in the Guangdong Microbiological Culture Collection Center on April 11, 2025, at the 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, and the culture collection number is GDMCC NO: 66121.

[0062] Example 2

[0063] 1. Preparation of bacterial suspension

[0064] Preparation of mutant T5M1 bacterial suspension: LB solid medium supplemented with kanamycin 10 μg / mL was used to activate mutant T5M1, and a single colony was picked and placed in LB liquid medium, cultured at 30 °C and 170 rpm for 24 h, and the biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M1 was obtained.

[0065] Preparation of mutant T5M2 bacterial suspension: LB solid medium supplemented with kanamycin 10 μg / mL was used to activate mutant T5M2, and a single colony was picked and placed in LB liquid medium, cultured at 30 °C and 170 rpm for 24 h, and the biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M2 was obtained.

[0066] Preparation of mutant T5M3 bacterial suspension: LB solid medium supplemented with kanamycin 10 μg / mL was used to activate mutant T5M3, and a single colony was picked and placed in LB liquid medium, cultured at 30 °C and 170 rpm for 24 h, and the biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M3 bacterial liquid was obtained.

[0067] Preparation of the engineered bacterial flora: The bacterial flora of mutant strain T5M1, the bacterial flora of mutant strain T5M2 and the bacterial flora of mutant strain T5M3 were mixed at a volume ratio of 1:1:1 to obtain the bacterial flora of engineered bacterial flora.

[0068] Preparation of wild-type T-5 bacterial liquid: Activate T-5 using LB solid medium, pick a single colony and inoculate it into LB liquid medium, culture at 37 °C and 170 rpm for 24 h, and adjust the biomass OD of the bacterial liquid with sterile water 600 to 0.5 (1×10 7 CFU / mL) to obtain the mutant strain T-5 bacterial liquid.

[0069] Preparation of Ralstonia solanacearum QL-RS1115 bacterial liquid: Activate QL-RS1115 using NA solid medium, pick a single colony and inoculate it into NA liquid medium, culture at 30 °C and 170 rpm for 24 h, and adjust the biomass OD of the bacterial liquid with sterile water 600 to 0.5 (1×10 7 CFU / mL) to obtain the Ralstonia solanacearum QL-RS1115 bacterial liquid.

[0070] 2. Evaluation of antagonistic ability

[0071] Inoculate the engineered bacterial community liquid and wild-type T-5 bacterial liquid into NA liquid medium supplemented with 25 g / L NaCl at an inoculation ratio of 1%, and culture at 30 °C and 170 rpm for 24 h. Filter and sterilize the bacterial liquid using a 0.22 μm sterile filter membrane to obtain the fermentation broth of the engineered bacterial community and wild-type T-5 respectively. Add 193 μL of NA liquid medium and 2 μL of Ralstonia solanacearum QL-RS1115 bacterial liquid to a 96-well plate, add 5 μL of the fermentation broth of the engineered bacterial community and wild-type T-5 respectively, and use 5 μL of fresh NA liquid medium as a control instead. After culturing at 30 °C and 170 rpm for 24 h, measure OD 600 , and calculate the inhibition rate to evaluate the ability of the engineered bacterial community and wild-type T-5 to produce antagonistic substances. Each treatment is set with 3 replicates.

[0072] 3. Evaluation of biomass

[0073] Inoculate the engineered bacterial community liquid and wild-type T-5 bacterial liquid into RE medium supplemented with 25 g / L NaCl at an inoculation ratio of 1%, and culture at 30 °C and 170 rpm for 24 h. Measure OD 600 to evaluate the biomass of the engineered bacterial community and wild-type T-5. Each treatment is set with 3 replicates.

[0074] 4. Siderophore production ability

[0075] The engineered bacterial community broth and wild-type T-5 broth were inoculated into MKB medium supplemented with 25 g / L NaCl at an inoculation ratio of 1%, and cultured at 30 °C and 170 rpm for 48 h. Sterile filtration was carried out using a 0.22 μm sterile filter membrane to obtain the fermentation broths of the engineered bacterial community and wild-type T-5 respectively. The determination of siderophores was performed using Chrome azurol S (abbreviated as "CAS") detection solution (Schwyn et al., 1987). In a 96-well plate, 100 μL of the CAS detection solution was added and mixed with 100 μL of the fermentation broths of the engineered bacterial community and wild-type T-5 respectively, and the control was added with 100 μL of fresh MKB liquid medium instead. After standing and reacting at room temperature for 2 hours, the absorbance value at a wavelength of 630 nm was measured by an enzyme-linked immunosorbent assay (ELISA) reader, and the relative siderophore production (siderophore unit) was calculated to measure the ability of the engineered bacterial community and wild-type to produce siderophores.

[0076] The biocontrol characteristics of the engineered bacterial community under salt stress are shown in Figure 2 . The results showed that compared with wild-type T-5, the antagonistic substances, biomass and siderophores of the engineered bacterial community were significantly improved under salt stress (P < 0.05), indicating that the engineered bacterial community could better adapt to the salt stress environment and efficiently exert its biocontrol characteristics than wild-type T-5.

[0077] Example 3 Investigate the effect of the engineered bacterial community in controlling tomato bacterial wilt under salt stress

[0078] Preparation of the engineered bacterial community broth: Referring to the method of Example 2, the mutant strain T5M1 broth, mutant strain T5M2 broth and mutant strain T5M3 broth were separately cultured to obtain mutant strain T5M1 broth (1×10 8 CFU / mL), mutant strain T5M2 broth (1×10 8 CFU / mL), mutant strain T5M3 broth (1×10 8 CFU / mL); the mutant strain T5M1 broth, mutant strain T5M2 broth and mutant strain T5M3 broth were mixed according to a volume ratio of 1:1:1 to obtain an engineered bacterial community broth with a concentration of 1×10 8 CFU / mL.

[0079] Preparation of wild-type T-5 broth: Activate T-5 using LB solid medium, pick a single colony into LB liquid medium, culture at 37 °C and 170 rpm for 36 h, and adjust the concentration to 1×10 8 CFU / mL with sterile water to obtain mutant strain T-5 broth.

[0080] Preparation of the Ralstonia solanacearum QL-RS1115 bacterial suspension: Referring to the method of Example 2, QL-RS1115 was activated using NA solid medium. A single colony was picked and inoculated into NA liquid medium, and cultured at 30 °C and 170 rpm for 36 h. The concentration was adjusted to 1×10 7 CFU / mL with sterile water to obtain the Ralstonia solanacearum QL-RS1115 bacterial suspension.

[0081] Three treatments were set up in the experiment: (1) inoculation with the engineered bacterial community and Ralstonia solanacearum QL-RS1115; (2) inoculation with the wild-type T-5 and Ralstonia solanacearum QL-RS1115; (3) inoculation with only Ralstonia solanacearum QL-RS1115, and the beneficial bacteria were replaced with an equal volume of sterile water.

[0082] Tomato variety: Red Dwarf.

[0083] First, tomato seeds were soaked in 3% (v:v) NaClO solution, disinfected for 5 min, and then washed several times with sterile water. Sterilized filter paper moistened with sterile water was placed in a sterilized petri dish, and the washed seeds were evenly arranged on the filter paper and placed in an incubator at 28 °C for 2-3 days for germination. Subsequently, the germinated seeds were sown into sterilized seedling substrate. When the seedlings were cultured in the seedling substrate for 3 weeks (the three-leaf stage of tomatoes), the seedlings with the same growth vigor were transplanted into six-well seedling pots filled with about 100 g of cultivation substrate per pot. The greenhouse temperature was maintained at 28-35 °C. The six-well seedling pots were randomly rearranged every 3 days. Five days after the seedlings were transplanted, a salt addition treatment (2‰ NaCl) was carried out, and the treatment without salt addition was supplemented with an equal amount of sterilized water. Seven days after transplantation, the engineered bacterial community and wild-type T-5 bacterial suspensions with a final concentration of 10 7 CFU / g soil were inoculated, and the treatment inoculated with only Ralstonia solanacearum QL-RS1115 was replaced with an equal amount of sterile water. Fourteen days after transplantation, the Ralstonia solanacearum QL-RS1115 bacterial suspension with a final concentration of 10 6 CFU / g soil was inoculated. Each treatment had 4 replicates, and each replicate had 12 tomato plants.

[0084] According to the wilting degree of tomato plants, the disease severity was divided into 5 levels: plants without disease symptoms were recorded as 0, the wilting leaf degree less than 25% was recorded as 1, between 25% and 50% was recorded as 2, between 50% and 75% was recorded as 3, and greater than 75% or whole plant death was recorded as 4. The disease index was used to characterize the disease situation, and the calculation formula was (Guo et al., 2004):

[0085] Plant disease index = [∑(number of diseased plants at each level × corresponding level) / (total number of plants surveyed × highest level value)] × 100%

[0086] Thirty days after inoculation with pathogenic Ralstonia solanacearum, the disease incidence tended to be stable, and the greenhouse pot experiment was terminated. Rhizosphere soil of tomatoes was sampled, about 0.3 g was weighed, and DNA was extracted using an MP soil DNA extraction kit (MP Biomedicals, USA) according to the operation instructions. The extracted DNA was detected for quality (A 260 / A 280 ) and concentration.

[0087] Quantitative real-time PCR (qPCR) was used to quantify the abundance of pathogenic Ralstonia solanacearum in rhizosphere soil samples. The detection gene for the pathogen Ralstonia solanacearum was fliC encoding the flagellin subunit, forward primer (5’→3’): GGCGGCCTTCAGGGAGGTC, reverse primer (5’→3’): GAACGCCAACGGTGCGAACT. The detection gene for the beneficial Bacillus velezensis was gyrA encoding bacterial gyrase, forward primer (5’→3’): AAATCTGCCCGTATCGTCG, reverse primer (5’→3’): GCGTCACGGC GRATCTCAA. qPCR was performed using a qTOWER type real-time high-speed fluorescence quantitative PCR instrument (Analytikjena, Germany). The qPCR kit used was TB Green ® Premix Ex Taq ™ (Tli RNaseH Plus) kit (Takara, Japan), and the reaction system was 20 μL: 10 μL TBGreen Premix Ex Taq (Tli RNaseH Plus), 6 μL ddH2O, 2 μL DNA template, 0.8 μL forward primer, 0.8 μL reverse primer, 0.4 μL ROX Reference Dye II. Each DNA sample was replicated three times to obtain CT values. Standard curves were plotted using the fliC gene product amplified from Ralstonia solanacearum QL-Rs1115 and the gyrA gene product amplified from Bacillus velezensis T-5, and the CT values were converted into gene copy numbers. Meanwhile, about 0.3 g of rhizosphere samples were weighed, dried at 60 °C to a constant weight and then weighed again to calculate the water content of the samples and determine the dry weight of the rhizosphere samples used for DNA extraction. Finally, the abundance of Ralstonia solanacearum and Bacillus velezensis was characterized by the logarithm of the gene copy number per gram of dry weight (lg gene copies g -1 dw).

[0088] The results are as Figure 3As shown, the disease index of the treatment with only inoculation of Ralstonia solanacearum was 58.33%. The inoculation of beneficial microorganisms can effectively reduce the occurrence of bacterial wilt under salt stress, resulting in an increase in the abundance of Bacillus velezensis and a decrease in the abundance of Ralstonia solanacearum in the tomato rhizosphere. Compared with the wild type T-5 (disease index 29.17%), the disease index of the treatment inoculated with the engineered microbial community was significantly reduced, only 12.50%. The abundance of Bacillus velezensis in the rhizosphere was significantly increased, and the abundance of Ralstonia solanacearum was significantly decreased, indicating that the engineered microbial community has a significantly better effect on controlling bacterial wilt under salt stress than the wild type T-5 (P < 0.05).

[0089] The protection scope of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, the changes and advantages that can be conceived by those skilled in the art are included in the present invention, and the appended claims are taken as the protection scope.

Claims

1. An engineered microbial community, characterized in that, The engineered microbial community is composed of 3 mutant strains of Bacillus velezensis. Among them, Bacillus velezensis mutant strain 1, named: Bacillus velezensis T5M1, classified and named as: Bacillus velezensis , and the deposit number of the strain is: GDMCC NO: 66119; Bacillus velezensis mutant strain 2, named: Bacillus velezensis T5M2, classified and named as: Bacillus velezensis , and the deposit number of the strain is: GDMCC NO: 66120; Bacillus velezensis mutant strain 3, named: Bacillus velezensis T5M3, classified and named as: Bacillus velezensis , and the deposit number of the strain is: GDMCC NO: 66121.

2. Use of the engineered microbial community according to claim 1 in preventing and controlling tomato bacterial wilt under salt stress.

3. Use of the engineered microbial community according to claim 1 in preparing a microbial agent for preventing and controlling tomato bacterial wilt under salt stress.

4. The application according to claim 3, wherein The microbial agent is the live bacteria of the engineered microbial community according to claim 1 or a microbial inoculant prepared from the engineered microbial community according to claim 1.

5. The application according to claim 4, wherein The microbial inoculant prepared in claim 4 is applied to the tomato rhizosphere by the root irrigation method.

6. A microbial inoculant, the inoculant containing the engineered microbial community according to claim 1.

7. The microbial inoculant according to claim 6, wherein, In the microbial inoculant, the volume ratio of mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 is 1:1:

1.

8. Use of the microbial inoculant according to claim 6 in preventing and controlling tomato bacterial wilt under salt stress.

9. The application according to claim 8, wherein The microbial inoculant of claim 6 is applied to the tomato rhizosphere by the root irrigation method.

10. A method for preventing and controlling tomato bacterial wilt under salt stress by using the engineered bacterial community described in claim 1, characterized in that, The method comprises the following steps: (1) Mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 are respectively cultured to obtain mutant strain T5M1 bacterial liquid, mutant strain T5M2 bacterial liquid, and mutant strain T5M3 bacterial liquid, and then the mutant strain T5M1 bacterial liquid, mutant strain T5M2 bacterial liquid, and mutant strain T5M3 bacterial liquid are mixed according to a volume ratio of 1:1:1; (2) The mixed bacterial liquid obtained in step (1) is applied to the tomato rhizosphere by the root irrigation method; Among them, the concentration of the mutant strain T5M1 bacterial solution in each tomato plant is 1×10 6 ~1×10 8 CFU / g soil; the concentration of the mutant strain T5M2 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil; the concentration of the mutant strain T5M3 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil.

Images