Pea C-glycosyl transferase and application thereof in synthesis of SGLT-2 inhibitor

Abstract

The invention relates to the technical field of gene engineering and enzyme engineering, in particular to pea C-glycosyltransferase and application thereof in synthesis of an SGLT-2 inhibitor. The invention provides a pea C-glycosyl transferase PsCGT and a coding gene thereof. The C-glycosyl transferase has catalytic activity on phloretin and phloroglucinol compounds, can be used for biosynthesis of carbon glycosylation products of the compounds, and has high economic value and wide application prospects.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and enzyme engineering, and in particular to a pea C-glycosyltransferase and an application thereof in synthesizing an SGLT-2 inhibitor. Background Art

[0002] Any discussion of the prior art throughout the specification should not be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0003] Flavonoids are an important class of secondary metabolites widely distributed in plants. Flavonoids in plants mostly exist as glycosides, primarily including flavonoid oxyglycosides and flavonoid carbonyl glycosides. Compared to oxyglycosides, flavonoid carbonyl glycosides have stronger bond energies, better structural stability, and greater water solubility. In plants, flavonoid carbonyl glycosides can help plants protect against UV-B radiation, exert antimicrobial effects, and participate in plant allelopathic effects and pigmentation. Besides playing an important role in plant physiology, flavonoid carbonyl glycosides also possess important pharmacological activities. Typical examples include vitexin, orientin, and nothofagin (CAS: 11023-94-2), all of which possess antioxidant, anticancer, anti-inflammatory, antiviral, antibacterial, and potentially antidiabetic activities.

[0004] Currently, flavonoid carbonyl glycoside inhibitors, exhibiting excellent stability and activity, are a research hotspot for SGLT-2 inhibitors. However, due to plant resource limitations and the numerous steps and low yields of chemical synthesis methods, the production of these carbonyl glycoside compounds is costly and uncompetitive, necessitating the development of novel strategies. The biosynthesis of flavonoid carbonyl glycosides is catalyzed by C-glycosyltransferases (CGTs). CGTs belong to the UDP-dependent glycosyltransferase (UGT) family and utilize activated UDP-sugars as donors to transfer them to sugar acceptors. While there are some reports on the biosynthesis of flavonoid carbonyl glycosides, the yields are still insufficient to meet the requirements of industrial production. Therefore, it is of great significance to screen for CGTs with high catalytic activity, elucidate their catalytic characteristics, and apply them to synthetic biology research on flavonoid carbonyl glycoside SGLT-2 inhibitors.

[0005] Pea (Pisum sativum), a plant of the genus Pisum in the family Fabaceae, has both edible and medicinal value and is rich in flavonoid glycosides. The main isolated compounds are orientin and vitexin. However, the CGTs that catalyze the biosynthesis of flavonoid glycosides have remained largely unexplored. Summary of the Invention

[0006] The present invention aims to provide a pea C-glycosyltransferase (PsCGT) and its mutants, and to explore their application in C-glycosylation reactions. Specifically, the present invention aims to:

[0007] Provided is a new C-glycosyltransferase (PsCGT), which can efficiently catalyze the C-glycosylation reaction of flavonoids such as phloretin to generate C-glycosylated flavonoids (such as nothofagin), has significant biological activity, especially SGLT-2 inhibition, and can be used for the treatment of diabetes.

[0008] Optimize the catalytic efficiency of PsCGT and improve the catalytic activity of the enzyme through site-directed mutagenesis (such as I377H mutation), thereby enhancing the product generation efficiency of the C-glycosylation reaction to meet the needs of industrial production.

[0009] Develop an efficient and green C-glycosylation synthesis method, use PsCGT or its mutants to catalyze the synthesis of flavonoid C-glycosylated compounds, replace traditional chemical synthesis methods, and provide a new green catalytic pathway for the production of natural products.

[0010] Provided are pharmacologically active C-glycosylated compounds, which have SGLT-2 inhibitory effects, can be used for the treatment of diabetes, and have good pharmacological properties.

[0011] It provides new ideas for the application of biocatalysts in drug development and promotes the development of the medicinal value of C-glycosylated compounds, especially in the field of diabetes treatment.

[0012] Specifically, the present invention provides the following technical solutions.

[0013] In a first aspect, the present invention provides a pea C-glycosyltransferase, PsCGT, whose amino acid sequence is shown in SEQ ID NO: 1. This enzyme has the ability to transfer a glycosyl group (e.g., UDP-glucose) to a substrate molecule, thereby achieving C-glycosylation. Through this enzyme's catalytic action, pharmacologically active C-glycosylated compounds can be synthesized. This discovery provides a new tool for synthesizing new pharmaceutical products, particularly in the areas of hypoglycemic and anti-diabetic treatments.

[0014] In one embodiment of the present invention, the enzyme can efficiently catalyze the C-glycosylation reaction of flavonoids and has the following characteristics: it exhibits high catalytic activity for phloretin, with a kcat / Km value of 4.43×10 3 M -1 s -1 ; It can be efficiently catalyzed under mild conditions (such as 30°C, pH 7.5); It is used to synthesize C-glycosylated products with SGLT-2 inhibitory activity.

[0015] In a second aspect of the present invention, a gene encoding the pea C-glycosyltransferase PsCGT is provided, the nucleotide sequence of which is shown in SEQ ID NO:2. This gene can be extracted from peas via gene cloning techniques, obtained using conventional molecular biology methods, and efficiently expressed in hosts such as Escherichia coli. Expression of this gene yields a catalytic PsCGT enzyme, providing the necessary enzyme source for the subsequent synthesis of C-glycosylated compounds. This gene can be applied in fields such as genetic engineering and enzyme engineering, and is widely used for the synthesis of C-glycosylated flavonoids.

[0016] In a third aspect of the present invention, a recombinant expression vector containing a gene encoding the pea C-glycosyltransferase PsCGT is provided. This vector can be used to express the PsCGT enzyme in recombinant cells, thereby achieving efficient enzyme production. In one embodiment, the vector is pET32a. The pET32a vector is a commonly used expression vector that can efficiently express recombinant proteins in host cells such as Escherichia coli. This recombinant expression vector can be used to produce the pea C-glycosyltransferase PsCGT on an industrial scale for large-scale synthesis of C-glycosylated compounds.

[0017] In a fourth aspect of the present invention, a recombinant cell containing a gene encoding the pea C-glycosyltransferase PsCGT is provided. The recombinant cell is a host cell transformed with a recombinant expression vector.

[0018] In one embodiment, the host cell is Escherichia coli, such as E. coli BL21(DE3), a bacterial strain commonly used for protein expression that can efficiently express the target protein under induction conditions. By introducing the PsCGT gene into E. coli host cells, high yields of the PsCGT enzyme can be obtained and recovered through simple culture and purification steps. These recombinant cells provide a sufficient enzyme source for subsequent catalytic reactions.

[0019] In a fifth aspect of the present invention, a mutant of pea C-glycosyltransferase PsCGT is provided, which comprises one or more mutations selected from the following: (1) substitution of tyrosine at position 87 with phenylalanine (Y87F); (2) substitution of phenylalanine at position 149 with isoleucine (F149I); (3) substitution of leucine at position 181 with proline (L181P); (4) substitution of isoleucine at position 377 with histidine (I377H); (5) substitution of alanine at position 85 with proline (L181P); (6) substitution of isoleucine at position 377 with histidine (I377H); (7) substitution of alanine at position 85 with proline (L181P); (8) substitution of phenylalanine at position 149 with isoleucine (F149I); (9) substitution of phenylalanine at position 149 with isoleucine (F149I); (10) substitution of phenylalanine at position 149 with isoleucine (F149I); (11) substitution of phenylalanine at position 149 with isoleucine (F149I); (12) substitution of phenylalanine at position 149 with isoleucine (F149I); (13) substitution of phenylalanine at position 149 with isoleucine (F149I); (14) substitution of phenylalanine at position 149 with isoleucine (F149I); (15) substitution of phenylalanine at position 149 with isoleucine (F149I); (16) substitution of phenylalanine at position 149 with isoleucine (F149I); (17) substitution of phenylalanine at position 149 with isoleucine (F149I); (18) substitution (6) simultaneously including the replacement of tyrosine at position 87 with phenylalanine and isoleucine at position 377 with histidine (Y87F / I377H); (7) simultaneously including the replacement of isoleucine at position 192 with leucine and isoleucine at position 377 with histidine (I192L / I377H); (8) simultaneously including the replacement of lysine at position 336 with glutamic acid and isoleucine at position 377 with histidine (K336E / I377H). By site-directed mutagenesis, the application effect of PsCGT in biocatalysis can be further improved, especially in the efficient synthesis of C-glycosylated compounds in industrial production. In particular, in some embodiments, the present invention obtains a series of PsCGT mutants through rational design. Through molecular docking and structural analysis, it is found that the I377 site is a key site affecting catalytic activity. Mutating this site to histidine (I377H) significantly improves the enzyme's catalytic activity, providing an important tool for further improving production efficiency. Therefore, in a preferred embodiment of the present invention, the mutant comprises at least the I377H mutation. The introduction of this mutation site, I377H, can significantly increase the catalytic efficiency of PsCGT, thereby increasing the rate of the C-glycosylation reaction and the amount of product produced.

[0020] In the sixth aspect of the present invention, the present invention provides the use of pea C-glycosyltransferase PsCGT or a mutant thereof in a C-glycosylation reaction.

[0021] In the C-glycosylation reaction, the PsCGT or a mutant thereof described in the present invention is used as a catalyst, and UDP-sugar (particularly UDP-glucose) is used as a glycosyl donor. The PsCGT or a mutant thereof described in the present invention can effectively transfer the glycosyl group (such as glucose group) in the UDP-sugar to the substrate molecule, thereby generating a C-glycosylated product. These C-glycosylated compounds have important application value in the fields of diabetes treatment, natural product synthesis, and health product development. In particular, PsCGT can catalyze phloretin to generate the C-glycosylated flavonoid compound nothofagin, which has SGLT-2 inhibitory activity and can be used to treat diabetes.

[0022] In a seventh aspect of the present invention, a method for catalyzing a C-glycosylation reaction is provided, comprising using the pea C-glycosyltransferase PsCGT described in the first aspect or the mutant described in the fifth aspect, using UDP-sugar as a glycosyl donor, to convert a phloroglucinol compound into its C-glycosylated product;

[0023] In some embodiments of the present invention, the UDP-sugar is UDP-glucose;

[0024] In some embodiments of the present invention, the phloroglucinol compound is phloretin or a compound represented by formula I;

[0025] In some specific embodiments, the C-glycosylation reaction catalyzes phloretin (CAS No. 60-82-2) to produce Nothofagin (CAS No. 11023-94-2);

[0026]

[0027] Phloretin, as a substrate, reacts with UDP-glucose under the catalysis of PsCGT or its mutants to produce the flavonoid C-glycoside compound nothofagin. This method provides a new route for the efficient, green, and controllable production of C-glycosylated flavonoids.

[0028] Alternatively, the C-glycosylation reaction is catalyzed Generate its C-glycosylated product

[0029] Right now:

[0030] Wherein, R is a substituent on the benzene ring, the number of which is one or more, and R is selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl.

[0031] In some embodiments, R is selected from hydrogen, fluoro, chloro, methyl, methoxy, and trifluoromethyl.

[0032] In some embodiments, R is one or two. When R is two, they are defined as R1 and R2, respectively. R1 and R2 are the same or different.

[0033] In some embodiments, the substitution position of R is numbered clockwise with the carbon atom connected to the methylene group as position 1. When R is one, the substitution position of R is position 2, position 3 or position 4; when R is two, they are defined as R1 and R2, respectively, and their positions are selected from positions 3 and 4, positions 3 and 5, positions 4 and 5, and positions 2 and 6.

[0034] In some embodiments, Formula I is selected from the following structures:

[0035]

[0036] Formula II is selected from the following compounds (compounds 1a, 2a, 3a, 4a, 5a in sequence):

[0037]

[0038] Specifically, the method can be implemented in the following two ways:

[0039] Method 1: In vitro enzymatic reaction method, i.e., directly using purified enzymes and adding UDP-glucose to achieve reaction conversion. This involves mixing the pea C-glycosyltransferase PsCGT or its mutant with the substrate and UDP-glucose in a buffer, reacting at a suitable temperature for a certain period of time, and then terminating the reaction to obtain the target product. Preferably, the reaction is carried out in the pH range of 6.0-8.0 and the reaction temperature is 20-40°C. The substrate is selected from phloretin or the compound of Formula I; the target product is selected from Nothofagin or the compound of Formula II.

[0040] Method 2: In vivo microbial transformation, utilizing engineered strains and metabolic engineering strategies to construct a complete UDP-glucose synthesis pathway and C-glycosyltransferase reaction system to achieve efficient substrate conversion. This involves constructing an engineered strain expressing the pea C-glycosyltransferase PsCGT or its mutant, adding the substrate to a fermentation system containing the engineered strain, culturing under suitable conditions for a specified period of time, and isolating the target product. Preferably, the engineered strain is constructed by co-transforming a plasmid expressing PsCGT or its mutant with an auxiliary metabolic plasmid into a host bacterium, wherein the fermentation system contains a suitable carbon source. The substrate is selected from phloretin or a compound of Formula I, and the target product is selected from Nothofagin or a compound of Formula II. For example, in one embodiment, PsCGT-I377H-pET32a and pACYCDuet-Pgm-GalU plasmids are co-transformed into Escherichia coli BL21(DE3) to obtain engineered strain EA1. After fermentation and conversion, the target product is isolated.

[0041] In an eighth aspect of the present invention, a compound is provided, which has a structure shown in Formula II or is a pharmaceutically acceptable salt of the structure shown in Formula II:

[0042]

[0043] Wherein, R is one or more substituents on the benzene ring, selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy, and C1-C3 haloalkyl. These compounds have excellent biological activity. By adjusting the type and position of the substituents, the pharmacological activity of the compounds can be further optimized, thereby enhancing their effectiveness in SGLT-2 inhibition and hypoglycemic effects.

[0044] In some embodiments, R is selected from hydrogen, fluoro, chloro, methyl, methoxy, and trifluoromethyl.

[0045] In some embodiments, R is one or two. When R is two, they are defined as R1 and R2, respectively. R1 and R2 are the same or different.

[0046] In some embodiments, the substitution position of R is numbered clockwise with the carbon atom connected to the methylene group as position 1. When R is one, the substitution position of R is position 2, position 3 or position 4; when R is two, they are defined as R1 and R2, respectively, and their positions are selected from positions 3 and 4, positions 3 and 5, positions 4 and 5, and positions 2 and 6.

[0047] In some embodiments, Formula II is selected from the following compounds:

[0048]

[0049] In some embodiments of the present invention, the pharmaceutically acceptable salts include but are not limited to the following types:

[0050] (1) Inorganic alkali salts, such as sodium salts (Na + ), potassium salt (K + ), calcium salt (Ca 2+ ), magnesium salts (Mg 2+ ), ammonium salt (NH4 + );

[0051] (2) Organic amine salts, for example, salts formed with meglumine, tromethamine, choline, triethylamine, diethanolamine, etc.

[0052] The pharmaceutically acceptable salt can be prepared by the following methods:

[0053] (1) Acid-base reaction: reacting the compound represented by Formula II with a suitable base, which may be an inorganic base (such as sodium hydroxide, potassium hydroxide, calcium hydroxide, etc.) or an organic base (such as meglumine, tromethamine, choline, etc.), in a suitable solvent to obtain the desired salt;

[0054] (2) Ion exchange or complexation reaction: Salts are formed through ion exchange or complexation, which is particularly suitable for the formation of salts of divalent metal ions (such as calcium, magnesium, etc.).

[0055] In the ninth aspect of the present invention, an intermediate for preparing a compound of formula II is provided, the structure of which is shown in formula I:

[0056] Wherein, R is a substituent on the benzene ring, the number of which is one or more, and R is selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl;

[0057] In some embodiments, R is selected from hydrogen, fluoro, chloro, methyl, methoxy, and trifluoromethyl.

[0058] In some embodiments, R is one or two. When R is two, they are defined as R1 and R2, respectively. R1 and R2 are the same or different.

[0059] In some embodiments, the substitution position of R is numbered clockwise with the carbon atom to which the benzene ring to which it is connected is connected to the methylene group as 1. When R is one, the substitution position of R is 2, 3 or 4; when R is two, they are defined as R1 and R2, respectively, and their positions are selected from 3 and 4, 3 and 5, 4 and 5, and 2 and 6.

[0060] In some embodiments, Formula I is selected from the following structures:

[0061]

[0062] In the tenth aspect of the present invention, a method for preparing the compound of the eighth aspect is provided, comprising using the compound of formula I as a raw material, UDP-sugar as a glycosyl donor, and catalyzing the reaction by C-glycosyltransferase to obtain a C-glycoside compound of formula II. In some embodiments, the method comprises using the pea C-glycosyltransferase PsCGT or its mutant catalyzed reaction described in the first aspect of the present invention. Generate its C-glycosylated product In some embodiments, the mutant is the mutant described in the fifth aspect of the present invention.

[0063] Wherein, the definition of R is the same as described in the eighth and ninth aspects above.

[0064] The method uses pea C-glycosyltransferase PsCGT or a mutant thereof as a catalyst to synthesize the compound through a C-glycosylation reaction. The method is efficient, environmentally friendly, and economical, and is suitable for large-scale production of C-glycosylated compounds, especially key ingredients in products such as hypoglycemic drugs.

[0065] In an eleventh aspect of the present invention, a pharmaceutical composition is provided, comprising the compound described in the eighth aspect; or further comprising at least one pharmaceutically acceptable excipient. This pharmaceutical composition can be used to treat diseases such as diabetes and control blood sugar (particularly lowering blood sugar), and exhibits high efficacy. The pharmaceutical composition can be formulated into various dosage forms, including oral preparations, injections, and sustained-release tablets.

[0066] In a twelfth aspect of the present invention, there is provided use of the compound described in the eighth aspect or the pharmaceutical composition described in the eleventh aspect in the preparation of a hypoglycemic drug. In an embodiment of the present invention, the drug is an SGLT-2 inhibitor. By inhibiting SGLT-2 glucose transport, the compound has significant therapeutic efficacy in controlling blood sugar levels and can be used to treat type 2 diabetes and other related diseases.

[0067] In a thirteenth aspect of the present invention, a method for treating diabetes is provided, comprising administering an effective amount of a compound of Formula II or a pharmaceutically acceptable salt thereof to a subject in need of treatment, wherein the compound of Formula II or a pharmaceutically acceptable salt thereof and R are as defined in the eighth aspect above. The administration is selected from oral administration, injection, or other pharmaceutically acceptable administration methods.

[0068] The effective dose is individually adjusted based on factors such as the subject's age, weight, and severity of illness, and is generally within the range of 0.001-100 mg / kg body weight per day; preferably, the effective dose is within the range of 0.01-50 mg / kg body weight per day; and more preferably, the effective dose is within the range of 0.1-10 mg / kg body weight per day. The administration can be a single daily dose or divided into 2-4 divided doses. The dosing regimen can be adjusted based on the subject's response to treatment. The administration can be used alone or in combination with other therapeutic agents.

[0069] In a fourteenth aspect of the present invention, a method for inhibiting SGLT2 activity is provided, comprising administering an effective amount of a compound of Formula II or a pharmaceutically acceptable salt thereof to a subject suffering from type 2 diabetes, wherein the effective amount is sufficient to lower the subject's blood glucose level, wherein the compound of Formula II or a pharmaceutically acceptable salt thereof and R are as defined in the eighth aspect above. The administration is selected from oral administration, injection, or other pharmaceutically acceptable administration methods.

[0070] The effective dose is individually adjusted based on factors such as the subject's age, weight, and severity of illness, and is generally within the range of 0.001-100 mg / kg body weight per day; preferably, the effective dose is within the range of 0.01-50 mg / kg body weight per day; and more preferably, the effective dose is within the range of 0.1-10 mg / kg body weight per day. The administration can be a single daily dose or divided into 2-4 divided doses. The dosing regimen can be adjusted based on the subject's response to treatment. The administration can be used alone or in combination with other therapeutic agents.

[0071] Compared with the prior art, the present invention has the following beneficial effects:

[0072] The present invention provides a novel C-glycosyltransferase (PsCGT) with higher catalytic efficiency and substrate specificity than existing C-glycosyltransferases. In particular, the enzyme can efficiently catalyze the conversion of phloretin to nothofagin, which has not been reported in existing literature.

[0073] By subjecting PsCGT to site-directed mutagenesis (e.g., I377H), the present invention significantly enhances the enzyme's catalytic activity, significantly improving its efficiency in generating target compounds during C-glycosylation reactions. Compared to existing technologies, the PsCGT mutants of the present invention exhibit higher reaction rates and product selectivity in catalytic reactions, demonstrating promising industrial applications.

[0074] This invention provides a green and environmentally friendly synthesis method: Compared with traditional chemical synthesis methods, this method synthesizes C-glycosylated flavonoids through biocatalysis, which has the advantage of being environmentally friendly. The biocatalytic method does not require the use of toxic or hazardous chemical reagents, operates under mild reaction conditions, and is environmentally friendly, making it an ideal alternative to chemical synthesis methods.

[0075] The present invention provides a series of compounds with SGLT-2 inhibitory activity and hypoglycemic effects: the C-glycosylated flavonoid compounds in the present invention (such as nothofagin and compounds of formula II) have significant SGLT-2 inhibitory effects and effectively lower blood sugar levels by inhibiting the transport of glucose by SGLT-2 in the kidney.

[0076] Efficient production process and industrial application: The present invention provides an efficient method for synthesizing C-glycosylated compounds, using PsCGT or its mutants as a catalyst to synthesize the target compound through biocatalysis. Compared with traditional chemical synthesis methods, the method of the present invention is low-cost, high-efficiency, simple to operate, and can adapt to the needs of large-scale production, providing reliable technical support for the production of products such as diabetes drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] The accompanying drawings, which constitute part of the present invention, are provided to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are provided to explain the present invention and do not constitute undue limitations thereon. The embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein:

[0078] Figure 1 This is the electrophoresis diagram of the amplified product of the expressed gene PsCGT in the embodiment of the present invention.

[0079] Figure 2 The figure is an SDS-PAGE electrophoresis diagram of the PsCGT protein in the embodiment of the present invention; wherein: lane 1: purified PsCGT protein; lane 2: supernatant protein of PsCGT; lane M: protein marker.

[0080] Figure 3 The following are HPLC / LC-MS spectra of the enzymatic activity of PsCGT using phloretin as a substrate in an example of the present invention. A. PsCGT-catalyzed reaction formula for the production of nothofagin from phloretin (1': phloretin; 1a': nothofagin); B. HPLC chromatogram of the glycosylation reaction; C. Negative ion mass spectrum of the product nothofagin.

[0081] Figure 4 Figure 1: Site-directed mutagenesis of PsCGT in the examples of the present invention. A: Comparative structural analysis of PsCGT and GgCGT; B: Comparative catalytic activity of wild-type PsCGT and its mutants towards phloretin; C: Comparison of the structures of PsCGT and the PsCGT-I377H mutant with a sugar donor and sugar acceptor (Glc:glucose) after molecular docking.

[0082] Figure 5 The synthesis of nothofagin in E. coli BL21 in the examples of the present invention. A: In vivo feeding of E. coli E1, E2, and E3 using phloretin (1') as a substrate at a substrate concentration of 300 μM; B: HPLC profile of the metabolites of the recombinant strain EA1 fed with phloretin (1') as a substrate and mass spectrometric identification of the products (NC is a negative control); C: In vivo feeding of E. coli EA1 and EB1 using phloretin (1') as a substrate at a substrate concentration of 300 μM; D: In vivo feeding of E. coli EA1 using phloretin (1') as a substrate at a concentration gradient of 0.6 mM, 0.9 mM, 1.2 mM, 1.8 mM, 2.4 mM, and 4.8 mM.

[0083] Figure 6The glycosylation products 1a, 2a, 3a, 4a, and 5a prepared by PsCGT-I377H-catalyzed compounds 1, 2, 3, 4, and 5 in the examples of the present invention. A: Schematic diagram of the glycosylation reaction (Glc:glucose), where the group X does not participate in the reaction, for example, it can be a phenyl or substituted phenyl group; B: Structure diagram of compounds 1, 2, 3, 4, and 5; C: HPLC chromatogram of the glycosylation reaction.

[0084] Figure 7 is the hydrogen spectrum of compound 1a.

[0085] Figure 8 This is the carbon spectrum of compound 1a.

[0086] Figure 9 is the hydrogen spectrum of compound 2a.

[0087] Figure 10 is the carbon spectrum of compound 2a.

[0088] Figure 11 is the hydrogen spectrum of compound 3a.

[0089] Figure 12 is the carbon spectrum of compound 3a.

[0090] Figure 13 is the hydrogen spectrum of compound 4a.

[0091] Figure 14 is the carbon spectrum of compound 4a.

[0092] Figure 15 is the hydrogen spectrum of compound 5a.

[0093] Figure 16 is the carbon spectrum of compound 5a.

[0094] Figure 17 This is the Western Blot verification of the overexpression plasmid constructed in the examples of the present invention transfected and expressed in 293T cells, wherein WT is the non-transfected group and HA-SGLT2 is the overexpression group.

[0095] Figure 18 The inhibitory activity of the compounds prepared in the examples of the present invention on glucose transport by the SGLT2 receptor is shown, wherein WT is the untransfected group, treated with DMSO; OE is the SGLT2 overexpression group, treated with DMSO; Dap is the SGLT2 overexpression group, treated with Dapagliflozin; 1a-5a is the SGLT2 overexpression group, treated with the corresponding compounds. DETAILED DESCRIPTION

[0096] The present invention will be further described with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope thereof. Experimental methods for which specific conditions are not specified in the examples are generally performed under conventional conditions or conditions recommended by the manufacturer.

[0097] Unless otherwise defined, all technical and scientific terms used herein shall have the meanings familiar to those skilled in the art. Unless otherwise specified, the reagents or raw materials used in the present invention can be obtained through conventional routes and used in accordance with conventional methods in the art or product specifications. In addition, any content similar or equivalent to the methods or materials described herein can be applied to the methods of the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0098] Example 1 Cloning of the expressed gene PsCGT

[0099] 1.1 Extraction of total RNA from peas using CTAB-PVP method

[0100] (1) Weigh fresh pea leaves grown for 15 days, rinse with double-distilled water, and remove excess water with filter paper. Place the leaves in a pre-cooled mortar and grind them with liquid nitrogen until they become powder.

[0101] (2) Transfer an appropriate amount of powder to a pre-cooled 2 mL inlet centrifuge tube, quickly add 800 μL of CTAB-PVP extract preheated at 65°C, and mix thoroughly by inverting.

[0102] (3) Incubate in 65°C warm water for 30 min, mixing by inverting every 10 min.

[0103] (4) Take out the sample, cool it to room temperature, add an equal volume of chloroform, and shake to mix thoroughly.

[0104] (5) Centrifuge at 13,000 rpm at 4°C for 10 min.

[0105] (6) Transfer the supernatant to a new 2 mL centrifuge tube, add an equal volume of chloroform, gently shake to mix, and centrifuge at 13,000 rpm at 4°C for 10 min.

[0106] (7) Repeat step (6) of the experimental procedure (i.e., extraction with chloroform three times).

[0107] (8) Aspirate the supernatant and transfer it to a new 1.5 mL centrifuge tube. Then, add 1 / 3 volume of 8 M LiCl and place in a -20 °C refrigerator overnight.

[0108] (9) The next day, centrifuge the sample at 13,000 rpm for 10 min at 4°C and discard the supernatant.

[0109] (10) Add an equal volume of 75% ethanol to wash the precipitate. Centrifuge at 13,000 rpm for 10 min at 4°C and discard the supernatant.

[0110] (11) After the excess ethanol evaporated, 30 μL of DEPC-treated sterile water was added to dissolve the RNA to obtain total RNA. The concentration and quality of the extracted RNA were measured using a BioPhotometer plus nucleic acid and protein analyzer.

[0111] The CTAB-PVP extraction buffer was prepared as follows:

[0112] 100 mM Tris·HCl (pH 8.0), 2% CTAB (w / v), 2% PVP (w / v), 25 mM EDTA, 2 M NaCl, autoclaved and then added with mercaptoethanol to 0.2%; the solution was prepared with DEPC-treated ddH2O, autoclaved and then used.

[0113] 1.2 PsCGT gene amplification

[0114] 1.2.1 cDNA synthesis

[0115] The cDNA template strand was obtained by PCR using the extracted pea total RNA as a template and the M5 HiPer First Strand cDNA Synthesis Kit.

[0116] The reverse transcription system and reverse transcription procedure are as follows:

[0117] 1. Dissolve the RNA template, Primer Mix, dNTP Mix, DTT, RT Buffer, M5 M-MuLV RTase, and RNase-Free Water and place on ice until ready to use.

[0118] 2. Prepare the reaction system according to the following table, with a total volume of 13 μL.

[0119]

[0120] 3. Incubate at 70°C for 10 minutes, then quickly place on ice for 2 minutes.

[0121] 4. Briefly centrifuge and continue to add the following reagents to the above reaction solution:

[0122]

[0123] Reverse transcription protocol: 37°C for 15 min; 85°C for 15 s; store at 4°C. Store the reverse transcription product at -20°C. Take 2 μL of the product and dilute it 10-fold before use.

[0124] 1.2.2 Primer design

[0125] Bioxm 2.6 software was used to locate the open reading frame (ORF) of PsCGT. Full-length primers were designed in the untranslated region (UTR) and the gene was amplified using pea cDNA as a template.

[0126] Full-length primers:

[0127] PsCGT-F: GACTACATACAGGAACAATC (SEQ ID NO:3)

[0128] PsCGT-R:TCAACTCCTACAACCAAAAC(SEQ ID NO:4)

[0129] Enzyme digestion primers:

[0130] PsCGT-BamHI-F:CGGGATCCATGTCTCTTGTTCCTATGAC (SEQ ID NO: 5)

[0131] PsCGT-HindⅢ-R:CCCAAGCTTTCAATTATTTTCAACTTTTT(SEQ ID NO:6)

[0132] 1.2.3 Full-length amplification of target gene

[0133] Reverse transcribed pea cDNA was used as template and PsCGT-F / R as primers for amplification.

[0134] The amplification system and amplification procedure are as follows:

[0135]

[0136] Add the above components to a 200 μL imported PCR tube, mix well, centrifuge at low speed, and amplify according to the following procedure:

[0137] ①94℃, 5min;

[0138] ②94℃, 30s;

[0139] ③55℃, 30s;

[0140] ④72℃, 1min;

[0141] ⑤Go to②,30cycles;

[0142] ⑥72℃, 10min.

[0143] PCR reaction products were detected by agarose gel electrophoresis (the results were as follows Figure 1 ), cut and recycle the target strip:

[0144] The PCR products were separated by agarose gel electrophoresis (1.5%, w / v, g / 100 mL) and the target fragments were recovered using the Mei5bio gel recovery kit. The steps are as follows:

[0145] (1) After the above PCR products were subjected to agarose gel electrophoresis, the target band was quickly cut out under ultraviolet light and placed in a 1.5 mL centrifuge tube for recovery.

[0146] (2) Add 100 μL of membrane binding buffer MB and place in a 50°C metal bath to completely dissolve it.

[0147] (3) Column equilibration: Place the adsorption column in a collection tube, add 500 μL of column equilibration solution BL, let it stand at room temperature for 5 min, then centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0148] (4) The sol solution was transferred to an adsorption column, allowed to stand at room temperature for 5-10 min, and then centrifuged at 13,000 rpm for 30 s. The filtrate was discarded.

[0149] (5) Add 600 μL of MW rinse solution to the adsorption column. Centrifuge at 13,000 rpm for 30 seconds and discard the filtrate.

[0150] (6) Repeat step (5) and discard the filtrate.

[0151] (7) Centrifuge at 13,000 rpm for 2 min to remove as much excess rinse solution as possible.

[0152] (9) Place the adsorption column in a new 1.5 mL centrifuge tube and leave it at room temperature until the ethanol evaporates.

[0153] (10) Add 30 μL of ddH 2 O to the adsorption membrane, let it stand at room temperature for 5-10 min, centrifuge at 13,000 rpm for 2 min, collect the DNA solution and store it at -20°C before use.

[0154] 1.2.4 Amplification of PsCGT ORF

[0155] Using the full-length sequence of PsCGT as a template, the ORF of the target gene PsCGT was amplified using the primer pair PsCGT-BamH IF / PsCGT-HindIII-R with restriction enzyme cutting sites and 2X Ape x HF FS PCR Master Mix high-fidelity enzyme.

[0156] Using the full-length sequence of PsCGT as a template, the above primers were used to amplify its ORF. The amplification program was as follows: ①94℃, 3min; ②94℃, 30s; ③56℃, 30s; ④72℃, 1min; ⑤Go to ②, 30 cycles; ⑥72℃, 10min.

[0157] The PCR products were separated by gel electrophoresis and recovered using a gel recovery kit.

[0158] 1.3 Enzyme digestion

[0159] The vector pET32a and the gel-recovered fragments were digested with BamH I and Hind III, respectively. The digestion system is as follows:

[0160]

[0161] Incubate at 37°C for 3 h. After the reaction, add 2 μL of 10× Loading buffer, perform agarose gel electrophoresis, and cut out the target band for gel recovery using the same method as above.

[0162] 1.4 Connection

[0163] Use DNA Ligation Kit AG11801 to connect the target fragment to the vector:

[0164]

[0165] After the above components are mixed evenly, the connection is carried out at 16°C overnight.

[0166] 1.5 Conversion

[0167] Take out the Escherichia coli DH5α competent cells (50 μL) stored at -80°C and thaw them on ice, add 5 μL of the ligation product, gently pipette to mix, and place on ice for 30 minutes; after heat shock at 42°C for 45 seconds, then quickly place on ice for 2 minutes, add 500 μL of antibiotic-free LB liquid culture medium, incubate at 37°C with shaking for 1 hour, take 200 μL of the transformation solution and apply it to LB solid culture medium containing 100 μg / mL ampicillin resistance, and culture at 37°C for 12 hours.

[0168] LB medium components (1 L): 1 g yeast extract, 2 g tryptone, 2 g NaCl, dissolved in water and then adjusted to 200 mL. Agar (1.2%) was added to the solid medium and sterilized by high-pressure steam (121°C for 20 min).

[0169] 1.6 Identification of recombinant positive clones

[0170] Randomly select five single colonies in 200 μL LB medium (containing 100 μg / mL ampicillin resistance) and culture at 37°C with shaking for 3 hours. Perform colony PCR using PsCGT-F / R as primers and the bacterial solution as template. The system is as follows:

[0171]

[0172] Amplification procedure:

[0173] ①94℃, 5min;

[0174] ②94℃, 30s;

[0175] ③55℃, 30s;

[0176] ④72℃, 1min;

[0177] ⑤Go to②,30cycles;

[0178] ⑥72℃, 10min.

[0179] After colony PCR, perform agarose gel electrophoresis. Positive clones that amplify a band of the target fragment size are considered positive. Clones that amplify a band of the appropriate size are sent to Sangon Biotech Co., Ltd. for sequencing. Positive clones are stocked by adding 70 μL of DMSO to 930 μL of bacterial solution, mixing thoroughly, and storing at -80°C. The amino acid sequence of PsCGT is shown in SEQ ID NO:1, and the nucleotide sequence is shown in SEQ ID NO:2.

[0180] Example 2 Prokaryotic expression analysis

[0181] 2.1 Extraction of PsCGT-pET32a plasmid

[0182] Use the plasmid miniprep kit Mei5bio to extract the plasmid:

[0183] (1) Streak the existing strain PsCGT-pET32a-DH5α on an LB plate containing ampicillin resistance and grow a single colony at 37°C for 12 hours. Pick the single colony and place it in 6 mL of LB medium containing ampicillin resistance and culture it at 37°C at 110 rpm for 10 hours.

[0184] (2) Place the adsorption column in a collection tube, add 500 μL of buffer BL to the adsorption column, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and set aside for use.

[0185] (3) Centrifuge the bacterial solution at 12,000 rpm for 1 min at room temperature, discard the supernatant, collect the bacteria, and discard the supernatant as much as possible.

[0186] (4) Add 250 μL of solution I to the centrifuge tube containing the bacterial pellet and vortex until the bacteria are completely suspended.

[0187] (5) Add 250 μL of solution II to the centrifuge tube and gently invert it 6-8 times to fully lyse the bacteria.

[0188] (6) Add 350 μL of solution III to the centrifuge tube and immediately mix by inverting. A flocculent precipitate will form. Let stand for 2 minutes and then centrifuge at 12,000 rpm for 5 minutes.

[0189] (7) Transfer the supernatant collected in the previous step to the treated adsorption column (the adsorption column is placed in the collection tube). Centrifuge at 12,000 rpm for 1 minute and discard the waste liquid in the collection tube.

[0190] (8) Add 500 μL of buffer WB2 to the adsorption column, centrifuge at 12,000 rpm for 45 s, and discard the waste liquid in the collection tube.

[0191] (9) Repeat step (8).

[0192] (10) Discard the filtrate, place the adsorption column in a collection tube, and centrifuge at 12,000 rpm for 2 min to remove the remaining rinse solution in the adsorption column.

[0193] (11) Place the adsorption column in a clean 1.5 mL centrifuge tube. After evaporating the ethanol, add 30 μL of distilled water to the middle part of the adsorption membrane. Let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm for 2 min to collect the plasmid solution into the centrifuge tube.

[0194] 2.2 PsCGT protein expression

[0195] 2.2.1 Prokaryotic expression

[0196] (1) The empty vector pET32a and the constructed PsCGT-pET32a were respectively transformed into expression-type Escherichia coli BL21 (DE3) and positive clones were screened.

[0197] (2) Pick a positive single clone and inoculate it into 4 mL of LB liquid medium containing ampicillin resistance, and culture it at 37°C with shaking overnight.

[0198] (3) The bacterial solution was inoculated into 400 mL of LB medium containing ampicillin resistance at a ratio of 1:200, and cultured at 37°C with shaking until the OD600 reached 0.4-0.6. 1 M IPTG was added to a final concentration of 0.5 mM.

[0199] (4) Continue culturing at 16°C and 110 rpm for 18 h to induce protein expression.

[0200] 2.2.2 Protein separation and purification

[0201] (1) Add the bacterial solution to a 50 mL centrifuge tube several times, centrifuge at 5,000 rpm for 5 min, and discard the supernatant to collect the bacterial cells.

[0202] (2) Resuspend the collected cells in an appropriate amount of binding buffer, centrifuge at 5,000 rpm for 5 minutes, and discard the supernatant. Wash twice.

[0203] (3) Add buffer at a ratio of 5-10 mL of binding buffer per gram of bacteria.

[0204] (4) Place the bacterial solution in an ice-water mixture and disrupt the bacteria by ultrasonication.

[0205] (5) Centrifuge at 12,000 rpm for 30 min at 4°C. Collect the supernatant and transfer it to a new centrifuge tube. Then, purify it by passing it through a nickel column. Keep 20 μL of the supernatant and the precipitate for electrophoresis.

[0206] (6) Add the protein supernatant to the nickel column, then elute the impurities with 10 mL of binding buffer containing 10 mM imidazole, and finally elute the target protein with 5 mL of elution buffer with an imidazole concentration of 250 mM, and collect the fractions.

[0207] (7) Place the collected protein solution in a pre-cooled ultrafiltration tube and centrifuge at 3,500g for 10 minutes. Mix thoroughly by gently pipetting. When the total protein solution is concentrated to approximately 1 mL, add 4 mL of Binding buffer and repeat the above steps twice. Finally, mix thoroughly by gently pipetting, aspirate the concentrate, determine the protein concentration, and retain a sample for electrophoresis.

[0208] (8) The concentrated protein was used immediately or stored by adding an appropriate amount of 80% glycerol and aliquoted into 50 μL / tubes.

[0209] Binding buffer: Weigh 2.42 g Tris-HCl and 29.22 g NaCl and dissolve them thoroughly in water, adjust the pH to 8.0, and make up to 1 L. After sterilization, add 70 μL β-mercaptoethanol and mix thoroughly. Store at 4°C.

[0210] Elution buffer: Weigh 2.42 g Tris-HCl, 29.22 g NaCl, and 34 g imidazole, dissolve in water, adjust the pH to 8.0, and dilute to 1 L. After sterilization, add 70 μL β-mercaptoethanol and store at 4°C.

[0211] 2.2.3 Protein concentration determination

[0212] The protein concentration was determined using the Bradford protein assay kit.

[0213] (1) After the protein standard BSA (5 mg / mL) is completely dissolved, 10 μL is taken and diluted 10-fold with 0.9% NaCl to a final concentration of 0.5 mg / mL as a standard.

[0214] (2) Add 0, 1, 2, 4, 8, 12, 16, and 20 μL of the standard solution to a 96-well plate, and make up to 20 μL with 0.9% NaCl. Perform three replicates.

[0215] (3) Dilute the retained protein sample with 0.9% NaCl and add to 20 μL.

[0216] (4) Add 200 μL of G250 staining solution to each well and incubate at room temperature for 3-5 minutes.

[0217] (5) Use an enzyme-labeled analyzer to measure the absorbance at 595 nm (A595). Draw a standard curve based on the protein concentration of the standard and the corresponding absorbance. Calculate the protein concentration in the sample based on the standard curve.

[0218] 2.2.4 Protein SDS-PAGE electrophoresis

[0219] The expression and separation and purification of the target protein were detected by denaturing polyacrylamide gel electrophoresis (Sodium DodecylSulfate Polyacrylamide Gel Electrophoresis, SDS-PAGE). Figure 2 .

[0220] The preparation solutions and proportions of SDS-PAGE separation gel and stacking gel are as follows:

[0221]

[0222] 2.3 In vitro enzyme activity

[0223] The in vitro enzymatic activity of PsCGT was determined using a negative control reaction system containing pET32a protein. Phloretin was used as the substrate. The reaction system (100 μL) was as follows:

[0224]

[0225] The components were mixed and reacted at 30°C for 1 hour. After the reaction, 100 μL of methanol was added or 1 M HCl was used to terminate the reaction. After centrifugation at 13,000 rpm for 10 minutes, the enzyme activity reaction was analyzed by HPLC (the experimental results are shown in Figure 3 ).

[0226] HPLC analysis was performed using a reverse phase column XDB-C18 (5 μm, 4.6 × 150 mm). When the substrate was phloretin, the HPLC liquid phase analysis conditions were: Phase A, water containing 0.1% formic acid; Phase B, methanol; Flow rate: 1 mL / min, Injection volume: 20 μL. The mobile phase was as follows:

[0227]

[0228] LC-MS was used to identify the enzyme activity product. The analytical method and analytical column were the same as above.

[0229] 2.4 Determination of enzyme kinetic parameters

[0230] Kinetic analysis of PsCGT was performed in MES (pH 6.5) buffer at 30°C. The substrate was phloretin at concentrations of 5, 10, 20, 40, 50, 80, 120, and 150 μM. The reaction was timed starting with the addition of the protein and lasted for 10 minutes. The reaction was terminated by adding an equal volume of methanol. The experiment was repeated three times. The results are shown in Table 1.

[0231] Table 1 PsCGT kinetic parameters

[0232]

[0233]

[0234] Example 3 Site-directed mutagenesis of PsCGT to identify mutants with higher catalytic activity

[0235] Using the crystal structure of GgCGT (6L5P) from Glycyrrhiza glabra as a template, we http: / / swissmodel.expasy.org / interactivew The website simulated the homology of PsCGT and compared the structure of PsCGT with GgCGT ( Figure 4 Schrodinger Suites software was used to perform molecular docking of PsCGT protein with UDP-glucose and phloretin.

[0236] Select key amino acids that may affect protein activity for site-directed mutagenesis: Y87F, F149I, L181P, I377H, A85P / I377H, Y87F / I377H, I192L / I377H, K336E / I377H. Design mutagenesis primers based on the mutation site on the website Primer X (http: / / www.bioinformatics.org / primerx / ):

[0237] PsCGT-Y87F-F:CGACGCTTTTTTTCTCCAATTTGC(SEQ ID NO:7)

[0238] PsCGT-Y87F-R:GCAAATTGGAGAAAAAAAGCGTCG(SEQ ID NO:8)

[0239] PsCGT-F149I-F: GCTACTATGTTCTCCTTCATTTCTTACTTTCCTTCCGTG (SEQ ID NO: 9)

[0240] PsCGT-F149I-R: CACGGAAGGAAAGTAAGAAATGAAGGAGAACATAGTAGC (SEQ ID NO: 10)

[0241] PsCGT-L181P-F:CATCCCTCCACCGCTTCTGAAGCC(SEQ ID NO:11)

[0242] PsCGT-L181P-R: GGCTTCAGAAGCGGTGGAGGGATG (SEQ ID NO: 12)

[0243] PsCGT-I377H-F:GGTGGCCTCAACATGGAGACCAAAAG(SEQ ID NO:13)

[0244] PsCGT-I377H-R: CTTTTGGTCTCCATGTTGAGGCCACCC (SEQ ID NO: 14)

[0245] PsCGT-A85P / I377H-F:CTTCCGCCACTACCGACCCGTTTTACCTCCAATTTG(SEQ ID NO:15)

[0246] PsCGT-A85P / I377H-R: CAAATTGGAGGTAAAACGGGTCGGTAGTGGCGGAAG (SEQ ID NO: 16)

[0247] PsCGT-Y87F / I377H-F:CGACGCTTTTTTTCTCCAATTTGC(SEQ ID NO:17)

[0248] PsCGT-Y87F / I377H-R:GCAAATTGGAGAAAAAAAGCGTCG(SEQ ID NO:18)

[0249] PsCGT-I192L / I377H-F:GTTTATTTTCTAAACTGTTCATGGAGGACAG(SEQ ID NO:19)

[0250] PsCGT-I192L / I377H-R: CTGTCCTCCATGAACAGTTTAGAAAATAAAC (SEQ ID NO: 20)

[0251] PsCGT-K336E / I377H-F:GGATTGGTAGTTAAGGAATGGGTGGATCAAAG(SEQ ID NO:21)

[0252] PsCGT-K336E / I377H-R:CTTTGATCCACCCATTCCTTAACTACCAATCC(SEQ ID NO:22)

[0253] According to the Stratagene QuikChange site-directed mutagenesis method, the PsCGT-pET32a plasmid was used as a template to amplify the target band, and gel excision was performed according to the above method. After digestion with DpnI, the product was transformed into Escherichia coli DH5α, and 5 single clones were randomly selected for positive identification. After successful sequencing of the positive clones, they were transformed into Escherichia coli BL21 according to the above method to induce and purify the target protein. Enzyme activity was analyzed using UDP-glucose as a sugar donor and phloretin and apigenin (CAS No. 520-36-5) as substrates (the results are shown in Figure 2). Figure 4 B) in.

[0254] A key amino acid site, I377H, was found through site-directed mutagenesis. The mutant PsCGT-I377H significantly improved its catalytic activity towards phloretin. Comparison of the molecular docking models of PsCGT and PsCGT-I377H revealed that a hydrogen bond was formed between the mutated histidine at position 377 and the sugar donor, and that the C-1 position of the sugar donor and the C-3' and C-5' of the acceptor were closer, which was beneficial for the glycosylation reaction (results shown in Figure 2). Figure 4 C).

[0255] Example 4 Biosynthesis of carbonyl glycosides in Escherichia coli using PsCGT

[0256] 4.1 Construction of engineered strains

[0257] E. coli PsCGT-pET32a-BL21, PsCGT-I377H-pET32a-BL21, and PsCGT-Y87F / I377H-pET32a-BL21 were designated strains E1, E2, and E3, respectively. PsCGT-I377H-pET32a was combined with pACYCDuet-Pgm-GalU and pACYCDuet-cscB-Basp-UgpA, respectively, and co-transformed into E. coli BL21 to obtain strains EA1 and EB2. Simultaneously, strains EK were co-transformed with the pET32a empty vector and the pACYCDuet empty vector.

[0258] The pACYCDuet-Pgm-GalU and pACYCDuet-cscB-Basp-UgpA were obtained from research (Pei J, Dong P, Wu T, et al. Metabolic engineering of Escherichia coli for astragalin biosynthesis [J]. Journal of agricultural and food chemistry, 2016, 64 (42): 7966-7972).

[0259] 4.2 Biosynthesis of carbonyl glycosides in engineered strains

[0260] 4.2.1 Screening of the most suitable genes

[0261] In order to select the most suitable gene for in vivo feeding, an in vivo feeding experiment was conducted on the recombinant strains E1, E2, and E3 using phloretin as a substrate. The specific experimental procedures are as follows:

[0262] (1) Activation of the strain: Activate the bacterial suspension in a solid medium containing ampicillin resistance by streaking, pick a single colony and inoculate it into 2 mL of LB liquid medium, and culture it in a 37°C incubator with shaking for 6 h;

[0263] (2) Inoculate into 10 mL of resistant LB medium at a ratio of 1:100, culture at 37°C, 110 rpm until OD600 is approximately 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and culture at 16°C for 16 h;

[0264] (3) Add phloretin to the bacterial solution, set the substrate concentration to 300 μM, and continue culturing at 16°C for a period of time;

[0265] (4) Take 600 μL / tube of the sample after 12 hours of feeding, add an equal volume of n-butanol to extract twice, combine the organic phases, blow dry the sample, add 100 μL of 80% methanol to redissolve it, and analyze the product by HPLC. Figure 5 A in Table 2, HPLC and MS analysis results are shown in Figure 5 B in.

[0266] Table 2

[0267]

[0268] The results showed that the recombinant strain with the highest in vivo conversion yield was E2, so it was selected for subsequent feeding experiments.

[0269] 4.2.2 Screening of the optimal culture medium and carbon source

[0270] In order to select the optimal culture medium and carbon source for in vivo feeding, an in vivo feeding experiment was conducted on the recombinant strains EA1 and EB1 using phloretin as a substrate. The specific experimental procedures are as follows:

[0271] (1) Activation of strains: The bacterial suspension was activated in a solid medium containing ampicillin and chloramphenicol resistance by streaking method. A single clone was picked and inoculated into 2 mL of LB liquid medium and cultured in a 37°C incubator with shaking for 6 h.

[0272] (2) Inoculate into 10 mL of resistant LB medium at a ratio of 1:100, culture at 37°C, 110 rpm until OD600 is about 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and culture at 16°C for 16 h.

[0273] (3) Collect the induced cells in a 50 mL centrifuge tube and centrifuge at 3500 rpm for 10 min at 25°C. Discard the supernatant and repeat this step until all cells are collected.

[0274] (4) Add 30 mL of M9 medium to the centrifuge tube and gently shake the tube to resuspend the bacterial pellet. Centrifuge and discard the supernatant. Repeat this step twice.

[0275] M9 medium: 6.84g sodium phosphate dibasic dodecahydrate, 1.2g potassium dihydrogen phosphate, 0.4g ammonium chloride, 0.2g sodium chloride, dilute to 380mL with double-distilled water (Solution 1), sterilize and set aside. Separately prepare 1M calcium chloride solution and 1M magnesium sulfate solution, sterilize and set aside. Prepare 40% sucrose solution and 40% glucose solution, sterilize by filtration through a 0.22μm filter. 400mL M9 medium (containing 2% sucrose or glucose) is prepared as follows: 190mL Solution 1, 20mL 40% sucrose (or glucose) solution, 800μL 1M magnesium sulfate solution, 40μL 1M calcium chloride solution, and dilute to 400mL with sterile water.

[0276] (5) Add an appropriate amount of M9 medium containing the corresponding resistance to the centrifuge tube. Gently shake the centrifuge tube to resuspend the bacterial pellet and adjust the OD600 to 3.0. Aliquot 10 mL of the bacterial solution into each conical flask and add phloretin to a final concentration of 0.3 mM. 2% glucose should be added to the medium for EA1, and 2% sucrose should be added to the medium for EB1.

[0277] (6) Place the conical flask in a shaking incubator at 30°C and set the rotation speed to 130 rpm.

[0278] Note: When the culture medium is LB, the above steps (3) to (5) are omitted.

[0279] (7) Take 600 μL / tube of the sample after 12 hours of feeding, add an equal volume of n-butanol to extract twice, combine the organic phases, blow dry the sample, add 100 μL of 80% methanol to redissolve it, and analyze the product by HPLC. The results of the influence of culture medium and carbon source on glycoside production are shown in Figure 2. Figure 5 C in Table 3.

[0280] Table 3

[0281]

[0282] The results showed that the optimum culture medium was M9 and the best carbon source was glucose.

[0283] 4.2.3 Optimization of optimal substrate concentration and feeding duration

[0284] In order to optimize the substrate concentration and feeding duration during feeding, an in vivo feeding experiment was conducted on the recombinant strain EA1 using phloretin as the substrate. The specific experimental procedures are as follows:

[0285] (1) Activation of strains: The bacterial suspension was activated in a solid medium containing ampicillin and chloramphenicol resistance by streaking method. A single clone was picked and inoculated into 2 mL of LB liquid medium and cultured in a 37°C incubator with shaking for 6 h.

[0286] (2) Inoculate into 10 mL of resistant LB medium at a ratio of 1:100, culture at 37°C, 110 rpm until OD600 is about 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and culture at 16°C for 16 h.

[0287] (3) Collect the induced cells in a 50 mL centrifuge tube and centrifuge at 3500 rpm for 10 min at 25°C. Discard the supernatant and repeat this step until all cells are collected.

[0288] (4) Add 30 mL of M9 medium to the centrifuge tube and gently shake the tube to resuspend the bacterial pellet. Centrifuge and discard the supernatant. Repeat this step twice.

[0289] (5) Add an appropriate amount of M9 medium containing the corresponding resistance to the centrifuge tube, gently shake the centrifuge tube to resuspend the bacterial pellet, and adjust the OD600 to 3.0. Aliquot 10 mL of the bacterial solution into each conical flask and add phloretin to the final concentrations of 0.6 mM, 0.9 mM, 1.2 mM, 1.8 mM, 2.4 mM, and 4.8 mM, respectively.

[0290] (6) Place the conical flask in a shaking incubator at 30°C and set the rotation speed to 130 rpm.

[0291] (7) Take 600 μL / tube of samples after 12 h, 48 h, and 96 h of feeding, add equal volume of n-butanol to extract twice, combine the organic phases, blow dry the samples, add 100 μL of 80% methanol to redissolve, and analyze the products by HPLC. The statistical results are as follows: Figure 5 The results showed that when the concentration of substrate phloretin was 2.4 mM and the feeding time was 48 h, the maximum production of product nothofagin was about 594.19 mg / L.

[0292] Example 5 Preparation of SGLT2 inhibitor analogue carbonyl glycoside compounds using PsCGT

[0293] 5.1 In vitro enzyme activity assay

[0294] Based on the structural characteristics of SGLT2 inhibitors, five small molecule substrates were designed, namely 1, 2, 3, 4, and 5, with chemical structures as follows Figure 6 As shown in B. The in vitro enzymatic activity of PsCGT against these substrates was determined, with the reaction system containing pET32a protein serving as the negative control. The reaction system (100 μL) was as follows:

[0295]

[0296] The components were mixed and reacted at 30°C for 1 hour. After the reaction, 100 μL of methanol was added or 1 M HCl was used to terminate the reaction. After centrifugation at 13,000 rpm for 10 minutes, the enzyme activity reaction was analyzed by HPLC (the experimental results are shown in Figure 6 C).

[0297] HPLC analysis was performed using a reverse phase column XDB-C18 (5 μm, 4.6 × 150 mm). When the substrate was phloretin, the HPLC liquid phase analysis conditions were: Phase A, water containing 0.1% formic acid; Phase B, methanol; Flow rate: 1 mL / min, Injection volume: 20 μL. The mobile phase was as follows:

[0298]

[0299] LC-MS was used to identify the enzyme activity product. The analytical method and analytical column were the same as above.

[0300] 5.2 In vivo functional verification

[0301] To determine the in vivo catalytic function of PsCGT on these substrates, the recombinant strain E1 was fed with 1, 2, 3, 4, and 5 as substrates. The specific experimental procedures are as follows:

[0302] (1) Activation of the strain: Activate the bacterial suspension in a solid medium containing ampicillin resistance by streaking, pick a single colony and inoculate it into 2 mL of LB liquid medium, and culture it in a 37°C incubator with shaking for 6 h;

[0303] (2) Inoculate into 10 mL of resistant LB medium at a ratio of 1:100, culture at 37°C, 110 rpm until OD600 is approximately 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and culture at 16°C for 16 h;

[0304] (3) Add substrate to the bacterial solution at a concentration of 300 μM and continue culturing at 16°C for a period of time;

[0305] (4) Take 24h feeding samples, 600μL / tube, add equal volume of n-butanol to extract twice, combine the organic phases, blow dry the sample, add 100μL 80% methanol to redissolve, and analyze the product by HPLC.

[0306] 5.3 Preparation and separation of products

[0307] In order to produce the product described in 5.2, an in vivo feeding amplification experiment was conducted on the recombinant strain EA1 using 1, 2, 3, 4, and 5 as substrates. The specific experimental procedures are as follows:

[0308] (1) Activation of strains: The bacterial suspension was activated in a solid medium containing ampicillin and chloramphenicol resistance by streaking method. A single clone was picked and inoculated into 20 mL of LB liquid medium and cultured in a 37°C incubator with shaking for 16 h.

[0309] (2) Inoculate into 2 L of resistant LB medium at a ratio of 1:100, culture at 37°C, 110 rpm until OD600 is about 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and culture at 16°C for 16 h.

[0310] (3) Collect the induced cells in a 50 mL centrifuge tube and centrifuge at 3500 rpm for 10 min at 25°C. Discard the supernatant and repeat this step until all cells are collected.

[0311] (4) Add 50 mL of M9 medium to the centrifuge tube and gently shake the tube to resuspend the bacterial pellet. Centrifuge and discard the supernatant. Repeat this step twice.

[0312] (5) Add an appropriate amount of M9 medium containing the corresponding resistance to the centrifuge tube. Gently shake the centrifuge tube to resuspend the bacterial pellet and adjust the OD600 to 3.0. Aliquot 200 mL of the bacterial solution into each conical flask and add the substrate to a final concentration of 0.3 mM.

[0313] (6) Place the conical flask in a shaking incubator at 30°C and set the rotation speed to 130 rpm.

[0314] (7) After feeding for 48 h, the cells were extracted with an equal volume of ethyl acetate solution, repeated twice, and the supernatants were combined and dried by spin drying.

[0315] (8) The spin-dried product was resuspended in a small amount of a mixture of dichloromethane and methanol and passed through a silica gel column, eluting with a flowability ratio of dichloromethane to methanol = 5:1, using one tube per 4 ml. The eluates containing the product were combined, spin-dried, and structural analysis and confirmation were performed using HPLC, MS, and NMR.

[0316] Compound 1a: 1 H NMR (400MHz, Methanol-d4) δ7.87(s,2H),7.66(s,1H),6.02(s,1H),4.85(d,J=9.8Hz,1H),4.01(s,2H),3.88(d ,J=12.2Hz,1H),3.81(dd,J=4.6,12.2Hz,1H),3.61-3.53(m,1H),3.53-3.44(m,2H),3.43-3.38(m,1H).ESI-MS m / z:513.10[MH] - .

[0317] 1313C NMR (101 MHz, Methanol-d4) δ 157.35, 156.47, 156.36, 156.32, 147.51, 132.19, 131.87, 130.23, 126.44, 123.74, 119.92, 107.52, 104.31, 96.16, 82.55, 79.55, 77.63, 74.77, 71.06, 62.07, 29.37.

[0318] Compound 2a: 1 1H NMR (400 MHz, Methanol-d4) δ 7.39 (s, 1H), 7.30 (d, J = 8.2 Hz, 1H), 7.22 (d, J = 8.7 Hz, 1H), 5.99 (s, 1H), 4.85 (d, J = 9.8 Hz, 1H), 3.87 (d, J = 12.2 Hz, 1H), 3.83 (s, 2H), 3.80 (dd, J = 4.5, 12.1 Hz, 1H), 3.62 (t, J = 8.8 Hz, 1H), 3.53 - 3.44 (m, 2H), 3.42 - 3.38 (m, 1H). ESI-MS m / z: 445.05 [M-H] - .

[0319] 13 13C NMR (101 MHz, Methanol-d4) δ 157.37, 156.50, 156.05, 145.04, 132.34, 131.63, 130.73, 129.77, 129.64, 108.09, 104.25, 96.11, 82.54, 79.55, 77.63, 74.73, 71.09, 62.07, 28.70.

[0320] Compound 3a: 1 1H NMR (400 MHz, Methanol-d4) δ 7.01 - 6.96 (m, 2H), 6.89 (t, J = 8.8 Hz, 1H), 5.98 (s, 1H), 4.83 (overlapped, 1H), 3.88 (dd, J = 2.4, 12.1 Hz, 1H), 3.79 (s, 3H), 3.78 (s, 2H), 3.77 (d, J = 4.5 Hz, 1H), 3.64 (t, 1H, J = 8.8 Hz), 3.52 - 3.44 (m, 2H), 3.42 - 3.38 (m, 1H). ESI-MS m / z: 425.13 [M-H] - .

[0321] 1313C NMR (101 MHz, Methanol-d4) δ 157.36, 156.45, 155.74, 152.24, 146.50, 137.51, 125.30, 117.18 (d, J = 17.9 Hz), 114.44, 109.11, 104.27, 96.23, 82.57, 79.61, 77.71, 74.78, 71.16, 62.14, 56.89, 28.44.

[0322] Compound 4a: 1 1H NMR (400 MHz, Methanol-d4) δ 7.08 - 7.00 (m, 3H), 6.87 (d, J = 6.8 Hz, 1H), 5.98 (s, 1H), 4.85 (d, J = 9.8 Hz, 1H), 3.88 (d, J = 12.2 Hz, 1H), 3.81 (s, 2H), 3.79 (dd, J = 4.9, 12.3 Hz, 1H), 3.65 (t, J = 8.9 Hz, 1H), 3.52 - 3.44 (m, 2H), 3.41 - 3.38 (m, 1H), 2.24 (s, 3H). ESI-MS m / z: 391.14 [M-H] - .

[0323] 13 13C NMR (101 MHz, Methanol-d4) δ 157.44, 156.53, 155.61, 143.75, 138.12, 130.33, 128.64, 126.79, 126.72, 109.33, 104.18, 96.17, 82.55, 79.58, 77.68, 74.69, 71.14, 62.13, 29.27, 21.55.

[0324] Compound 5a: 1 1H NMR (400 MHz, Methanol-d4) δ 7.09 - 7.07 (m, 2H), 6.90 - 6.86 (m, 1H), 5.92 (s, 1H), 4.82 (d, J = 9.8 Hz, 1H), 3.99 (s, 2H), 3.87 (dd, J = 2.2, 12.1 Hz, 1H), 3.77 (dd, J = 4.8, 12.1 Hz, 1H), 3.61 - 3.56 (m, 1H), 3.47 - 3.42 (m, 2H), 3.40 - 3.35 (m, 1H). ESI-MS m / z: 429.08 [M-H] - .

[0325] 13C NMR (101MHz, Methanol-d4) δ164.73 (d, J = 248.0Hz), 157.79, 156.88, 155.81, 136.73, 129.51 (d, J = 17.2Hz), 128.05 (d, J = 9. 8Hz), 125.87 (d, J = 3.3Hz), 114.54 (d, J = 23.6Hz), 106.76, 104.05, 96.18, 82.63, 79.65, 77.72, 74.76, 71.15, 62.18, 21.70.

[0326] Example 6 In vitro SGLT2 inhibitory activity assay of prepared compounds

[0327] 6.1 Construction and amplification of overexpression plasmids

[0328] 6.1.1 Primer Design

[0329] The plasmid pLV3-CMV-SLC5A2 (human)-3×FLAG-Fluc-Puro containing the human full-length SGLT2 cDNA (Genbank Number: NM_003041.4) sequence was purchased from Wuhan Hewu Biotechnology Co., Ltd.

[0330] Bioxm 2.6 software was used to find the ORF of SGLT2 and design enzyme primers;

[0331] Enzyme digestion primers:

[0332] SGLT2-EcoR IF: GGAATTCATGGAGGAGCACACAGAGGC (SEQ ID NO: 23)

[0333] SGLT2-Xho IR: CCGCTCGAGTTAGGCATAGAAGCCCCAGAGGAACAC (SEQ ID NO: 24)

[0334] 6.1.2 Full-length amplification of target gene

[0335] The gene was amplified using plasmid pLV3-CMV-SLC5A2(human)-3×FLAG-Fluc-Puro as a template and SGLT2-EcoRI-F / SGLT2-XhoI-R as primers.

[0336] The amplification system and amplification procedure are as follows:

[0337]

[0338] Add the above components to a 200 μL imported PCR tube, mix well, centrifuge at low speed, and amplify according to the following procedure:

[0339] ①94℃, 5min;

[0340] ②94℃, 30s;

[0341] ③56℃, 30s;

[0342] ④72℃, 1min;

[0343] ⑤Go to②,30cycles;

[0344] ⑥72℃, 10min.

[0345] The PCR reaction products were detected by agarose gel electrophoresis, and the target bands were cut and recovered:

[0346] The PCR products were separated by agarose gel electrophoresis (1.5%, w / v, g / 100 mL) and the target fragments were recovered using the Mei5bio gel recovery kit. The steps are as follows:

[0347] (1) After the above PCR products were subjected to agarose gel electrophoresis, the target band was quickly cut out under ultraviolet light and placed in a 1.5 mL centrifuge tube for recovery.

[0348] (2) Add 100 μL of membrane binding buffer MB and place in a 50°C metal bath to completely dissolve it.

[0349] (3) Column equilibration: Place the adsorption column in a collection tube, add 500 μL of column equilibration solution BL, let it stand at room temperature for 5 min, then centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0350] (4) The sol solution was transferred to an adsorption column, allowed to stand at room temperature for 5-10 min, and then centrifuged at 13,000 rpm for 30 s. The filtrate was discarded.

[0351] (5) Add 600 μL of MW rinse solution to the adsorption column. Centrifuge at 13,000 rpm for 30 seconds and discard the filtrate.

[0352] (6) Repeat step (5) and discard the filtrate.

[0353] (7) Centrifuge at 13,000 rpm for 2 min to remove as much excess rinse solution as possible.

[0354] (9) Place the adsorption column in a new 1.5 mL centrifuge tube and leave it at room temperature until the ethanol evaporates.

[0355] (10) Add 30 μL of ddH 2 O to the adsorption membrane, let it stand at room temperature for 5-10 min, centrifuge at 13,000 rpm for 2 min, collect the DNA solution and store it at -20°C before use.

[0356] 6.1.3 Enzyme Digestion

[0357] The vector pCDNA3-HA and the gel-recovered fragments were digested with EcoR I and Xho I, respectively. The enzyme digestion system is as follows:

[0358]

[0359] Incubate at 37°C for 3 h. After the reaction, add 2 μL of 10× Loading buffer, perform agarose gel electrophoresis, and cut out the target band for gel recovery using the same method as above.

[0360] 6.1.4 Connection

[0361] Use DNA Ligation Kit AG11801 to connect the target fragment to the vector:

[0362]

[0363] After the above components are mixed evenly, the connection is carried out at 16°C overnight.

[0364] 6.1.5 Conversion

[0365] Take out the Escherichia coli DH5α competent cells (50 μL) stored at -80°C and thaw them on ice, add 5 μL of the ligation product, gently pipette to mix, and place on ice for 30 minutes; after heat shock at 42°C for 45 seconds, then quickly place on ice for 2 minutes, add 500 μL of antibiotic-free LB liquid culture medium, incubate at 37°C with shaking for 1 hour, take 200 μL of the transformation solution and apply it to LB solid culture medium containing 100 μg / mL ampicillin resistance, and culture at 37°C for 12 hours.

[0366] LB medium components (1 L): 1 g yeast extract, 2 g tryptone, 2 g NaCl, dissolved in water and then adjusted to 200 mL. Agar (1.2%) was added to the solid medium and sterilized by high-pressure steam (121°C for 20 min).

[0367] 6.1.6 Identification of recombinant positive clones

[0368] Randomly select five single colonies in 200 μL LB medium (containing 100 μg / mL ampicillin) and culture at 37°C with shaking for 3 hours. Perform colony PCR using SGLT2-EcoRI-F / SGLT2-XhoI-R primers and the bacterial suspension as a template. The system is as follows:

[0369]

[0370] Amplification procedure:

[0371] ①94℃, 5min;

[0372] ②94℃, 30s;

[0373] ③55℃, 30s;

[0374] ④72℃, 1min;

[0375] ⑤Go to②,30cycles;

[0376] ⑥72℃, 10min.

[0377] After colony PCR, perform agarose gel electrophoresis. Positive clones are identified as those that amplify a band of the target fragment size. Clones that amplify a band of the appropriate size are sent to Sangon Biotech Co., Ltd. for sequencing. Positive clones are stored by adding 70 μL DMSO to 930 μL of bacterial solution, mixing thoroughly, and storing at -80°C.

[0378] 6.1.7 Extraction of SGLT2-pCDNA3 Plasmid

[0379] Use the plasmid miniprep kit Mei5bio to extract the plasmid:

[0380] (1) Streak the existing strain SGLT2-pCDNA3-DH5α onto an LB plate containing ampicillin resistance and grow a single colony at 37°C for 12 hours. Pick the single colony and place it in 6 mL of LB medium containing ampicillin resistance and culture it at 37°C at 110 rpm for 10 hours.

[0381] (2) Place the adsorption column in a collection tube, add 500 μL of buffer BL to the adsorption column, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and set aside for use.

[0382] (3) Centrifuge the bacterial solution at 12,000 rpm for 1 min at room temperature, discard the supernatant, collect the bacteria, and discard the supernatant as much as possible.

[0383] (4) Add 250 μL of solution I to the centrifuge tube containing the bacterial pellet and vortex until the bacteria are completely suspended.

[0384] (5) Add 250 μL of solution II to the centrifuge tube and gently invert it 6-8 times to fully lyse the bacteria.

[0385] (6) Add 350 μL of solution III to the centrifuge tube and immediately mix by inverting. A flocculent precipitate will form. Let stand for 2 minutes and then centrifuge at 12,000 rpm for 5 minutes.

[0386] (7) Transfer the supernatant collected in the previous step to the treated adsorption column (the adsorption column is placed in the collection tube). Centrifuge at 12,000 rpm for 1 minute and discard the waste liquid in the collection tube.

[0387] (8) Add 500 μL of buffer WB2 to the adsorption column, centrifuge at 12,000 rpm for 45 s, and discard the waste liquid in the collection tube.

[0388] (9) Repeat step (8).

[0389] (10) Discard the filtrate, place the adsorption column in a collection tube, and centrifuge at 12,000 rpm for 2 min to remove the remaining rinse solution in the adsorption column.

[0390] (11) Place the adsorption column in a clean 1.5 mL centrifuge tube. After evaporating the ethanol, add 30 μL of distilled water to the middle part of the adsorption membrane. Let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm for 2 min to collect the plasmid solution into the centrifuge tube.

[0391] 6.2 Cell transfection

[0392] HEK293T cells were cultured at 37°C and 5% (volume fraction) CO2. Cells were transiently transfected using Sewell Biotech's PEI 40K Transfection Reagent. For single-well transfection in a 12-well plate, 0.5 μg of DNA was added to 100 μL of Opti-MEM medium per well, mixed, and then 1.5 μg of transfection reagent was added, mixed, and allowed to stand at room temperature for 15 minutes to form the transfection complex. Cells were seeded in a 12-well plate at a density of 1 × 10 cells per well. 5 / 1mL, add the above transfection complex, and culture at 37°C and 5% (volume fraction) CO2 for 36h.

[0393] 6.3 Western Blot Detection of SGLT2 Protein Expression

[0394] (1) After cell transfection, when the cell density reaches 80-90%, the cells are collected and disrupted using an ultrasonic cytometer to collect the protein.

[0395] (2) Add 40 μg of protein sample to each well, load the sample, and perform SDS-PAGE gel electrophoresis.

[0396] (3) After electrophoresis, remove excess gel and place a sponge, filter paper, gel, NC membrane, filter paper, and sponge on the electrophoresis chuck in the order shown. Place the electrophoresis chuck in transfer buffer, place on ice, and rotate at a constant voltage of 36V for 120 minutes.

[0397] (4) The NC membrane was placed in 5% skim milk powder and shaken slowly at 20 rpm on a shaker at room temperature for 1 h. Then, the membrane was rinsed three times with PBST at 80 rpm on a shaker for 5 min each time.

[0398] (5) Place the NC membrane in the HA and GAPDH antibody incubation solutions, respectively, and incubate overnight on a shaker at 4°C at 20 rpm. Rinse three times with PBST on a shaker at 80 rpm for 5 min each time.

[0399] (6) Add horseradish peroxidase-labeled secondary antibody corresponding to the primary antibody and incubate on a shaker at room temperature at 20 rpm for 2 h. Rinse three times with PBST on a shaker at 80 rpm for 5 min each time.

[0400] (7) Add ECL chemiluminescent colorimetric solution and develop the color using a gel imaging system. The grayscale of the HA-SGLT2 protein band in the untransfected group (WT) was significantly lower than that in the HA-SGLT2 transfected group, and the expression level of GAPDH as an internal reference was similar. Figure 17 .

[0401] 6.4SGLT2 Glucose Transport Assay

[0402] (1) Cells were seeded in 12-well plates (100,000 cells / well) and cultured at 37°C and 5% (volume fraction) CO2. After 24 hours, cells were treated with low-glucose serum-free DMEM medium for 2 hours.

[0403] (2) Wash once with uptake buffer. Add uptake buffer containing 2-NBDG (50 μM) and the target compound at a final concentration of 10 μM for glucose uptake and incubate at 37°C for 40 min. The uptake buffer contains 120 mM NaCl, 4.7 mM KCl, 1.2 mM MgCl2, 2.2 mM CaCl2, 10 mM HEPES, pH 7.4.

[0404] (3) Wash the cells twice with pre-cooled stop solution (uptake buffer containing 0.5 mM phlorizin), mix the cells by pipetting, transfer 100 μL into a 96-well transparent black-walled plate, and use a fluorescence microplate reader to detect the intracellular 2-NBDG content (Ex / Em: 485 / 535 nm).

[0405] (4) Collect all cells and transfer them into a 1.5 mL centrifuge tube for centrifugation. Remove the stop solution and add 50 μL of cell lysis solution. After reacting for 10 minutes, ultrasonic lysis was performed and centrifuged at 130,000 rpm for 15 minutes. The protein concentration was determined using a BCA kit. The results showed that compounds 1a, 2a, and 3a had a relatively significant inhibitory effect on SGLT2 glucose transport, among which 1a had the most significant effect, which was similar to the positive control dapagliflozin. Figure 18 .

[0406] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art, after reading this description, may make various modifications to the technical solution or replace some of the technical features with equivalents. Any modifications, equivalent replacements, or improvements made within the spirit and principles of the present invention shall be deemed to fall within the scope of protection of the present invention.

Claims

1. A pea C-glycosyltransferase PsCGT, whose amino acid sequence is shown in SEQ ID NO:

1.

2. A gene encoding the pea C-glycosyltransferase PsCGT according to claim 1, whose nucleotide sequence is shown in SEQ ID NO:

2.

3. A recombinant expression vector or recombinant cell containing the coding gene according to claim 2; Preferably, the recombinant cell is a host cell transformed with a recombinant expression vector; preferably, the host cell is Escherichia coli.

4. A mutant of pea C-glycosyltransferase PsCGT according to claim 1, characterized in that: Based on pea C-glycosyltransferase PsCGT, comprising at least one of the following mutations: Y87F, F149I, L181P, I377H, A85P / I377H, Y87F / I377H, I192L / I377H, K336E / I377H; Preferably, the mutant comprises at least the I377H mutation based on the pea C-glycosyltransferase PsCGT.

5. Use of the pea C-glycosyltransferase PsCGT according to claim 1 or the mutant according to claim 4 in a C-glycosylation reaction.

6. A method for catalyzing C-glycosylation reaction, characterized in that: Using the pea C-glycosyltransferase PsCGT according to claim 1 or the mutant according to claim 4 as a catalyst and UDP-sugar as a glycosyl donor to convert phloroglucinol compounds into their C-glycosylated products; Preferably, the UDP-sugar is UDP-glucose; Preferably, the phloroglucinol compound is phloretin or a compound represented by formula I; Preferably, the C-glycosylation reaction is to catalyze phloretin to produce Nothofagin; Alternatively, catalysis Generate its C-glycosylated product Wherein, R is a substituent on the benzene ring, the number of which is one or more, and R is selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl; Preferably, R is selected from hydrogen, fluorine, chlorine, methyl, methoxy and trifluoromethyl; Preferably, R is one or two. When R is two, they are defined as R1 and R2 respectively, and R1 and R2 are the same or different. Preferably, the substitution position of R is numbered clockwise with the carbon atom of the benzene ring connected to the methylene group as 1, and when R is one, the substitution position of R is 2, 3 or 4; when R is two, the positions of the two substituents are selected from 3 and 4, 3 and 5, 4 and 5, and 2 and 6; Preferably, Formula I is selected from the following structures: Preferably, formula II is selected from the following compounds:

7. A compound selected from the group consisting of: The compound shown in formula II; A pharmaceutically acceptable salt of the compound represented by formula II; in, R is a substituent on the benzene ring, the number of which is one or more, and R is selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl; Preferably, R is selected from hydrogen, fluorine, chlorine, methyl, methoxy and trifluoromethyl; Preferably, R is one or two. When R is two, they are defined as R1 and R2 respectively, and R1 and R2 are the same or different. Preferably, formula II is selected from the following compounds:

8. A method for preparing a compound of formula II, characterized in that: The method comprises using the compound of formula I as a raw material and UDP-sugar as a glycosyl donor, and carrying out a C-glycosylation reaction under the catalysis of pea C-glycosyltransferase PsCGT or the mutant of claim 4 as described in claim 1 to prepare the compound of formula II; wherein the structures of formula I and formula II are as follows: Wherein, R is a substituent on the benzene ring, the number of which is one or more, and R is selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl; Preferably, R is selected from hydrogen, fluorine, chlorine, methyl, methoxy and trifluoromethyl; Preferably, R is one or two. When R is two, they are defined as R1 and R2 respectively, and R1 and R2 are the same or different. Preferably, the substitution position of R is numbered clockwise with the carbon atom of the benzene ring connected to the methylene group as 1, and when R is one, the substitution position of R is 2, 3 or 4; when R is two, the positions of the two substituents are selected from 3 and 4, 3 and 5, 4 and 5, and 2 and 6; Preferably, the UDP-sugar is UDP-glucose.

9. A pharmaceutical composition comprising the compound of formula II according to claim 7; or further comprising at least one pharmaceutically acceptable excipient.

10. Use of the compound according to claim 7 or the pharmaceutical composition according to claim 9 in the preparation of hypoglycemic drugs; Preferably, the drug is a SGLT-2 inhibitor.

Images