Enzyme activity improved endo beta-1, 3-glucanase mutant

Abstract

The invention discloses an endo beta-1, 3-glucanase mutant with improved enzyme activity, and belongs to the technical field of gene engineering and enzyme engineering. According to the invention, a site-directed mutagenesis technology is utilized to carry out molecular modification on a wild type beta-1, 3-glucanase KfGH64 coding gene, and the enzyme activity of the obtained mutants T240I, S320T, N322A and H169G is improved by 1.09-1.58 times compared with the enzyme activity of the wild type beta-1, 3-glucanase. According to the invention, the catalytic activity of the beta-1, 3-glucanase is improved, and better use conditions are created for the beta-1, 3-glucanase in practical application.

Description

Technical Field

[0001] The present invention relates to an endo-β-1,3-glucanase mutant with improved enzyme activity, belonging to the technical fields of genetic engineering and enzyme engineering. Background Art

[0002] Endo-β-1,3-glucanase (EC 3.2.1.39) is an enzyme that specifically hydrolyzes β-1,3-glycosidic bonds and is widely present in microorganisms, plants, and some animals, participating in biological processes such as cell wall remodeling, pathogen defense, and carbon source metabolism. In the industrial field, due to its ability to efficiently degrade β-1,3-glucan, this enzyme is widely used in food processing (such as beer clarification, dough improvement), feed additives (enhancing fiber digestibility), bioenergy (pretreatment of lignocellulose), and the pharmaceutical field (treatment of fungal infections). For example, in beer brewing, this enzyme can significantly improve the wort filtration efficiency and enhance the product quality.

[0003] However, the catalytic efficiency of natural β-1,3-glucanase is relatively low and difficult to meet the high-efficiency requirements of large-scale industrial production. Through systematic analysis of the functional domains of wild-type endo-β-1,3-glucanase, the present invention designs and screens a multi-site mutant with a significant synergistic effect. The mutant has achieved a significant increase in specific activity, and its catalytic efficiency has increased substantially compared with the wild-type enzyme. This achievement not only solves the problem of low catalytic efficiency of natural enzymes but also provides strong technical support for the efficient development of enzyme preparations in industrial applications, having important application value and broad application prospects. Summary of the Invention

[0004] To solve the above problems, the present invention performs molecular modification on the β-1,3-glucanase gene (the nucleotide sequence is as shown in SEQ ID NO.1 and the amino acid sequence is as shown in SEQ ID NO.2) with the accession number CP001736 from K. flavida NBRC 14399, and uses site-directed mutagenesis technology to obtain a β-1,3-glucanase mutant with significantly improved specific enzyme activity.

[0005] The present invention provides a β-1,3-glucanase mutant, which is obtained by mutating one or more of the amino acids at positions 240, 320, 322, and 169 of the β-1,3-glucanase with the amino acid sequence as shown in SEQ ID NO.2.

[0006] In one embodiment, the mutant is obtained by mutating the threonine at position 240, serine at position 320, asparagine at position 322, or histidine at position 169 of the β-1,3-glucanase with the amino acid sequence as shown in SEQ ID NO.2.

[0007] In one embodiment, the mutant is obtained by mutating the 240th threonine of the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.2 into isoleucine, resulting in the mutant T240I, and the amino acid sequence is shown in SEQ ID NO.3.

[0008] In one embodiment, the mutant is obtained by mutating the 320th serine of the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.2 into threonine, resulting in the mutant S320T, and the amino acid sequence is shown in SEQ ID NO.4.

[0009] In one embodiment of the present invention, the mutant is obtained by mutating the 322nd asparagine of the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.2 into alanine, resulting in the mutant N322A, and the amino acid sequence is shown in SEQID NO.5.

[0010] In one embodiment, the mutant is obtained by mutating the 169th histidine of the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.2 into glycine, resulting in the mutant H169G, and the amino acid sequence is shown in SEQ ID NO.6

[0011] The present invention also provides a gene encoding the mutant.

[0012] In one embodiment, the nucleotide sequence of the gene is as shown in any one of SEQ ID NO.7-10.

[0013] The present invention also provides a recombinant plasmid carrying the gene.

[0014] In one embodiment, the recombinant plasmid includes, but is not limited to, pET series plasmids.

[0015] In one embodiment, the pET series plasmids include pET-28a or pET-22b.

[0016] The present invention also provides a recombinant microbial cell expressing the mutant.

[0017] In one embodiment, the recombinant microbial cell includes, but is not limited to, bacteria or fungi.

[0018] In one embodiment, the microorganism is Escherichia coli.

[0019] In one embodiment, the Escherichia coli uses Escherichia coli BL21(DE3) as the host and pET-28a as the vector.

[0020] The present invention also provides a method for improving the enzyme activity and / or thermal stability of β-1,3-glucanase, which method comprises mutating the threonine at position 240, serine at position 320, asparagine at position 322 or valine-serine at position 169 of the β-1,3-glucanase having the amino acid sequence as shown in SEQ ID NO.2.

[0021] In one embodiment, the method is to mutate the threonine at position 240 of the β-1,3-glucanase having the amino acid sequence as shown in SEQ ID NO.2 to isoleucine, the serine at position 320 to threonine, or mutate the asparagine at position 322 to alanine, or mutate the histidine at position 169 to glycine.

[0022] The present invention also provides a method for preparing β-1,3-gluco-oligosaccharide, which method uses β-glucan as a substrate and catalyzes the formation of β-1,3-gluco-oligosaccharide by using the above-mentioned β-1,3-glucanase mutant.

[0023] In one embodiment, the method is to react the β-1,3-glucanase mutant in a reaction system containing β-glucan at 50-70 °C for at least 10 min.

[0024] The present invention also provides the application of the above-mentioned β-1,3-glucanase mutant, or the above-mentioned gene, or the above-mentioned recombinant plasmid, or the above-mentioned recombinant microorganism, or the above-mentioned method in the production of β-1,3-gluco-oligosaccharide.

[0025] Beneficial effects:

[0026] The present invention performs molecular modification on the β-1,3-glucanase derived from K. flavida NBRC 14399 as the parental enzyme, mutates the amino acids at positions 240, 320, 322 or 169, and obtains a series of mutants with improved enzyme activity. The enzyme activities of the series of β-1,3-glucanase mutants provided by the present invention are significantly improved compared with the wild enzyme. The mutated enzymes still maintain a moderate pH, and the enzyme activities can reach 109.54 U / mg, 110.03 U / mg, 121.38 U / mg and 157.83 U / mg, which are 1.09-1.58 times higher than that of the wild-type enzyme activity.

[0027] The catalytic constant (kcat) of the mutant T240I constructed by the present invention is increased from 101.18 s -1 of the wild type to 272.95 s -1 , which improves the rate of enzyme converting the substrate. The Km is decreased from 3.10 mL·s -1 ·mg -1 to 2.54 mL·s -1 ·mg -1, it increases the affinity between the enzyme and the substrate, and consequently, improves the catalytic efficiency (kcat / Km). The present invention optimizes and improves the catalytic ability of the enzyme, creating better application conditions for the enzyme in practical applications. Description of the Drawings

[0028] Figure 1 It is the construction map of the recombinant plasmid.

[0029] Figure 2 It is the relative enzyme activity of the wild-type enzyme KfGH64 and the mutant enzyme.

[0030] Figure 3 It is the conversion rate of the wild-type enzyme KfGH64 and the mutant enzyme at different reaction times. Detailed Embodiments

[0031] The present invention will be further described below in conjunction with the drawings in the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0032] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products or can be prepared by known methods.

[0033] Materials and Reagents: The restriction endonucleases, Dpn I enzyme, PCR reagents, etc. used were all purchased from TaKaRa Biotechnology Company; the primers were purchased from AnShengDa Biotechnology Co., Ltd.; the plasmid extraction kit, genomic extraction kit, agarose purification kit, E.coil DH5α, and E.coil BL21(DE3) strains were all purchased from Sangon Biotech (Shanghai) Co., Ltd.; other reagents were all analytical pure reagents purchased domestically or abroad.

[0034] The following are the media involved in the following examples:

[0035] The media were all prepared using ddH2O and sterilized at 121°C for 15 - 20 min after preparation.

[0036] LB liquid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L.

[0037] LB solid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L, Agar powder 15 g / L.

[0038] The following are the detection methods involved in the following examples:

[0039] β-1,3-glucanase enzyme activity detection method:

[0040] Enzyme activity assay conditions: The reaction system includes 50 μL of the purified fermentation broth or supernatant diluted 30 times, and 950 μL of curdlan polysaccharide solution with a concentration of 40 mg / mL (pH = 5.5). The reaction is carried out at 55 °C for 10 min, and the enzyme is inactivated by boiling for 20 min. After centrifugation, the product concentration is determined by the DNS method.

[0041] Enzyme activity definition: Under the above reaction conditions, the amount required to produce 1 μmol of glucose per minute.

[0042] Among them, the enzyme activity calculation formula for β-1,3-glucanase is as follows:

[0043]

[0044] The buffers involved in the following examples are as follows:

[0045] Phosphate buffer (PB): 50 mmol / L, pH 7.0;

[0046] Binding Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.0;

[0047] Washing Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.0, 20 mmol / L imidazole;

[0048] Elution Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.0, 500 mmol / L imidazole;

[0049] Dialysis buffer: 50 mmol / L PB, pH 7.0, 10 mmol / L EDTA.

[0050] Example 1: Design of β-1,3-glucanase mutation sites

[0051] Multiple sequence alignment was combined with the online servers FireProt (https: / / loschmidt.chemi.muni.cz / fireprotweb / example) and HotSpot Vizard (https: / / loschmidt.chemi.muni.cz / hotspotwizard / ?action=help&) to select mutation sites; the SWISS-MODEL software was used to simulate the protein structure of β-1,3-glucanase to obtain the tertiary structure model of β-1,3-glucanase. The amino acid sites to be mutated were determined to be threonine at position 240, serine at position 320, asparagine at position 322, histidine at position 169, tyrosine at position 208, and proline at position 365.

[0052] Example 2: Site-directed mutagenesis of β-1,3-glucanase and construction of recombinant plasmid and recombinant Escherichia coli

[0053] (1) Construction of wild-type plasmid

[0054] The β-1,3-glucanase encoding gene with the nucleotide sequence shown in SEQ ID NO.1 was constructed between the NdeI and BamHI restriction sites of the plasmid vector pET-28a to obtain a recombinant plasmid, which was named pET-28a-fGH64.

[0055] (2) Construction of mutant plasmid

[0056] Primers were designed based on the gene encoding KfGH64 from K. flavida NBRC 14399 shown in SEQ ID NO.1, and site-directed mutagenesis was performed using the pET-28a-KfGH64 constructed in step (1) as a template to construct mutant plasmids:

[0057] T240I-F: CCCTTACAGTA ATT CCTTTCACTGATCAGCCGAATAT;

[0058] T240I-R: AGG AAT TACTGTAAGGGTTTGGGTCGAGTATT;

[0059] S320T-F: CCAACCAGAT ACA TCCAATGTAGATTTTTATAAAGACGTGG;

[0060] S320T-R: TGGA TGT ATCTGGTTGGTTAGGATTAGTCAGC;

[0061] N322A-F: GATTCATCC GCT GTAGATTTTTATAAAGACGTGGTCACTAAT;

[0062] N322A-R: TCTAC AGC GGATGAATCTGGTTGGTTAGGATT;

[0063] H169G-F: AGTGACCGGC GGT TTGAAGCCAGGCGGGTATAA;

[0064] H169G-R: TTCAA ACC GCCGGTCACTTTGGTCGTTCCATCT。

[0065] Among them, the underlined part represents the codons corresponding to serine at position 320, threonine at position 240, asparagine at position 322, and histidine at position 169 encoded by the mutant genes.

[0066] Table 1 PCR Amplification System

[0067]

[0068] After PCR amplification, add 2 μL of DpnⅠ restriction endonuclease (10 U / μL) to the reaction solution and incubate at 37 °C for 2 h to eliminate the template. Transform the PCR product into E.coil DH5α cells, spread on an LB plate, pick single colonies into LB liquid medium, extract the plasmid, and obtain the correct single-point mutant plasmid pET-28a-KfGH64 through sequencing S320T 、pET-28a-KfGH64 T240I 、pET-28a-KfGH64 N322A 、pET-28a-KfGH64 H169G 。Transform the successfully constructed mutant plasmid and the wild-type plasmid in step (1) into E.coil BL21(DE3) respectively to obtain the single-point mutant strain BL21(DE3) / pET-28a-KfGH64 S320T 、BL21(DE3) / pET-28a-KfGH64 T240I 、BL21(DE3) / pET-28a-KfGH64 N322A 、BL21(DE3) / pET-28a-KfGH64 H169G and the strain BL21(DE3) / pET-28a-KfGH64 expressing the wild-type enzyme.

[0069] Example 3: Expression and Purification of Wild Enzyme and Mutant Enzyme

[0070] The specific steps are as follows:

[0071] (1) Separate single colonies of BL21(DE3) / pET-28a-KfGH64 and each mutant strain prepared in Example 2 and inoculate them into LB liquid medium containing 50 μg / mL kanamycin. After culturing at 37 °C and 200 r / min for 12 h, transfer them to LB medium containing 50 μg / mL kanamycin and culture at 37 °C and 200 r / min until the OD 600 is in the range of 0.6 - 0.8. Add 1 mmol / L IPTG and induce at 16 °C and 200 r / min for 24 h, then collect the fermentation broth.

[0072] (2) Directly measure the enzyme activity of the fermentation broth. The results show that the enzyme activity in the fermentation broth of the wild enzyme is 14.07 U / mL, the enzyme activity in the fermentation broth of S320T is 24.29 U / mL, the enzyme activity in the fermentation broth of T240I is 19.31 U / ml, the enzyme activity in the fermentation broth of N322A is 18.04 U / mL, and the enzyme activity in the fermentation broth of H169G is 9.57 U / mL.

[0073] (3) After centrifuging the collected fermentation broth at 6000 r / min and 4 °C for 10 min, discard the supernatant, wash it twice with phosphate buffer, add 15 mL phosphate buffer to suspend the cells, and ultrasonically disrupt for 15 min (power 30%, disrupt for 1 s, intermittent for 2 s). Centrifuge at 4 °C and 8000 r / min for 10 min, collect the supernatant, which is the crude enzyme solution, and filter it through a 0.22 μm aqueous membrane. Pre-equilibrate the Ni 2+ chelating sepharose resin column with Binding Buffer; add the crude enzyme solution and equilibrate it with BindingBuffer and Washing Buffer respectively; elute the enzyme with Elution Buffer, recover it; dialyze the recovered enzyme solution in dialysis buffer and store it in a 4 °C refrigerator.

[0074] Respectively detect the specific activity of the obtained pure enzyme solution. Under this condition, define the enzyme activity of the original enzyme as 100%, and plot the relative enzyme activity percentage against the mutant types to evaluate the enzyme activity. The results are as Figure 2 follows. Compared with the specific enzyme activity of 100.18 U / mg of the wild enzyme KfGH64, the specific enzyme activities of the mutants T240I, S320T, N322A, and H169G are 109.540 U / mg, 110.03 U / mg, 121.38 U / mg, and 157.83 U / mg respectively.

[0075] Example 4: Determination of kinetic parameters of wild enzyme and mutant enzyme

[0076] Prepare β-1,3-glucan with a substrate concentration of 0.01689 mM to 0.54 mM using an acetic acid-sodium acetate solution (50 mM, pH = 5.5) for a standard enzyme reaction, establish the kinetic characterization of the β-1,3-glucanase KfGH64 mutant. Using the double-reciprocal method, the obtained parameters include the enzyme's affinity (Km), catalytic constant (kcat), and catalytic efficiency (kcat / Km). For the wild type, they are 32.67 mg·mL -1 、101.18 s -1 、3.10 mL·s -1 ·mg -1 ; for the mutant T240I, they are 1.45 mg·mL -1 、272.95 s -1 、2.54 mL·s -1 ·mg -1 . The affinity of the mutant T240I enzyme is less than that of the wild type, indicating that the affinity of T240I for the substrate curdlan and the binding degree of the substrate to the enzyme active site are tighter. The maximum catalytic rate Vmax of the mutant T240I is 0.6349

[0077] μmol·min -1 ·mg -1 , which is higher than the maximum catalytic rate Vmax (0.2353 μmol·min -1 ·mg -1 ) of the wild type for β-1,3-glucan. In summary, the mutant T240I has strong catalytic activity for β-1,3-glucan and has the potential for application in the production of β-1,3-oligosaccharides.

[0078] Example 5: Application of the mutant enzyme in hydrolyzing β-glucan

[0079] To compare the ability of the recombinant enzyme to biocatalytically convert β-1,3-glucan into β-1,3-gluco-oligosaccharides at the optimal pH and optimal temperature, with an enzyme addition amount of 500 U / g, use a 50 mM pH 5.5 acetic acid-sodium acetate buffer to prepare and dissolve a high concentration (4% w / v) of β-1,3-glucan for the enzyme reaction. Preheat the substrate in a 70°C water bath shaker for 4 h before the reaction. Set the reaction temperature at 50°C, the rotation speed at 200 r / min per minute, sample at intervals, and monitor the progress of the bioconversion reaction. Determine the total sugar content in the supernatant by centrifugation to reflect the change of β-1,3-gluco-oligosaccharides in the sample. Use the supernatant of 4% (w / v) β-1,3-glucan without adding enzyme before the reaction as a blank control. The results are as Figure 3As shown in the figure. When the enzyme addition amount is 500 U / g and β-1,3-glucan at 40 g / L is used as the substrate, the wild type can produce 29.26 g / L of β-1,3-glucooligosaccharide. The conversion rate increases rapidly within 1 h and reaches the equilibrium state at 2 h of reaction, and the equilibrium conversion rate is 73.16%; the mutant T240I can produce 30.20 g / L of β-1,3-glucooligosaccharide, reaches the equilibrium state at 1.5 h of reaction, and the equilibrium conversion rate is 75.50%; the mutant H169G can produce 25.30 g / L of β-1,3-glucooligosaccharide, reaches the equilibrium state at 2.5 h of reaction, and the equilibrium conversion rate is 65.30%; the mutant S320T can produce 29.24 g / L of β-1,3-glucooligosaccharide, reaches the equilibrium state at 3 h of reaction, and the equilibrium conversion rate is 73.10%; the mutant N322A can produce 25.48 g / L of β-1,3-glucooligosaccharide, reaches the equilibrium state at 2 h of reaction, and the equilibrium conversion rate is 63.70%.

[0080] Comparative Example 1:

[0081] According to the same strategy as in Examples 1 to 3, the conserved sites S208 and G365 screened for Example 1 were used to construct plasmids pET-28a-KfGH64 S208Y 、pET-28a-KfGH64 G365P expressing mutants respectively, and recombinant bacteria BL21(DE3) / pET-28a-KfGH64 S208Y 、BL21(DE3) / pET-28a-KfGH64 G365P were constructed; the recombinant bacteria were cultured according to the same method as in Example 3, and the specific enzyme activities of the crude enzyme solution and the purified enzyme were detected respectively. The results showed that almost no crude enzyme activity and specific enzyme activity of S208Y and G365P could be detected, indicating that the mutants S208Y and G365P lost their enzyme activities. S208Y and G365P are important residues for the enzyme to have catalytic ability. After mutation, the enzyme activity did not increase but was lost instead.

[0082] S208Y-F: AGCACCC TAC TATGGTGTAGAAATCGGCGCTC;

[0083] S208Y-R: CACCATA GTA GGGTGCTAAAGCGCGCAAAACT;

[0084] G365P-F: ACATGAT CCT AACCCTCAACAAGCCTATATCACC;

[0085] G365P-R: GAGGGTT AGGATCATGTACAAGTGACTCGTGGGC。

[0086] Although the present invention has been disclosed above in its preferred embodiments, it is not intended to limit the present invention. Any person skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A β-1,3-glucanase mutant, which has at least one of the following mutations on the basis of the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.2: (1) Mutating the histidine at position 169 to glycine; (2) Mutating the threonine at position 240 to isoleucine; (3) Mutating the serine at position 320 to threonine; (4) Mutating the asparagine at position 322 to alanine.

2. A gene encoding the β-1,3-glucanase mutant according to claim 1.

3. A recombinant plasmid carrying the gene according to claim 2.

4. A recombinant microbial cell expressing the β-1,3-glucanase mutant according to claim 1 or containing the recombinant plasmid according to claim 3.

5. The recombinant microbial cell according to claim 4, wherein, Using fungi or bacteria as the expression host.

6. The recombinant microorganism according to claim 5, wherein Using Escherichia coli as the expression host.

7. A recombinant Escherichia coli, characterized in that, Using Escherichia coli BL21(DE3) as the expression host and pET-28a as the expression vector to express the β-1,3-glucanase mutant according to claim 1.

8. A method for improving the enzyme activity of β-1,3-glucanase, characterized in that, Mutating the threonine at position 240 to isoleucine; mutating the serine at position 320 to threonine; mutating the asparagine at position 322 to alanine; or mutating the histidine at position 169 to glycine in the β-1,3-glucanase with the amino acid sequence shown in SEQ ID NO.

2.

9. A method for preparing β-1,3-glucooligosaccharide, characterized in that, Using the β-1,3-glucanase mutant according to claim 1 or the recombinant microbial cell according to any one of claims 4 to 6 as a catalyst to catalytically prepare β-1,3-gluco-oligosaccharide using β-glucan as a substrate.

10. Use of the β-1,3-glucanase mutant according to claim 1, the gene according to claim 2, the recombinant plasmid according to claim 3, the recombinant microorganism according to any one of claims 4 to 6, the recombinant Escherichia coli according to claim 7, or the method according to any one of claims 8 to 9 in the preparation of a product containing β-1,3-gluco-oligosaccharide.

Images