MiR1134 for regulating and controlling wax content of citrus epidermis and stress resistance of citrus, short tandem target simulation molecule of miR1134 and application of miR1134 and short tandem target simulation molecule

Abstract

The invention provides miR1134 for regulating and controlling the wax content of citrus epidermis and the stress resistance of citrus as well as a short tandem target mimic molecule and application thereof, and relates to the technical field of biology. The invention provides miR1134 derived from Neuron navel orange, and the nucleotide sequence of the miR1134 is shown as SEQ ID NO: 1. The invention also provides a short tandem target mimic molecule for inhibiting the expression level of the miR1134, and the nucleotide sequence of the short tandem target mimic molecule is as shown in SEQ ID NO: 3. The short tandem target mimic molecule is introduced into a target plant through an STTM technology, and the citrus epidermis wax content is increased by inhibiting the expression level of miR1134, so that the drought tolerance and / or salt tolerance of citrus plants are / is enhanced. The invention lays a theoretical foundation and provides high-quality gene resources for cultivating new stress-tolerant citrus varieties.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to miR1134, its short tandem target mimic molecule, and application for regulating the epidermal wax content and stress resistance of citrus. Background Art

[0002] Citrus is one of the main fruit trees cultivated in southern China and has important economic value. The citrus industry mainly relies on outdoor cultivation at present, and abiotic stresses in the natural climate severely limit the growth, development, yield, quality, and geographical distribution of citrus. Epidermal wax is a hydrophobic barrier covering the epidermis of citrus terrestrial organs and has an important function of preventing non-stomatal water loss in citrus, so it is closely related to the resistance of citrus to abiotic stresses such as drought and high salt. Therefore, using modern genetic engineering breeding to increase the epidermal wax content of citrus and thus improve the drought and salt tolerance of citrus remains an important direction in breeding work.

[0003] The important role of plant miRNAs in post-transcriptional genetic regulation has been extensively studied and characterized in different plant species, including regulating plant growth, development, and responses to biotic and abiotic stresses. However, there are few reports on miRNA regulating citrus epidermal wax synthesis and thus improving its drought resistance, which hinders the breeding process of drought- and salt-tolerant citrus. Summary of the Invention

[0004] In view of this, the present invention provides miR1134 derived from Newhall navel orange, which can increase the epidermal wax content of citrus by negative regulation, thereby enhancing the drought tolerance and / or salt tolerance of citrus plants.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides miR1134 derived from Newhall navel orange, and its nucleotide sequence is as shown in SEQ ID NO:1.

[0007] The present invention provides a precursor of the miR1134, and its nucleotide sequence is as shown in SEQ ID NO:2.

[0008] The present invention provides the application of the miR1134 or the precursor of the miR1134 in regulating the stress resistance and / or leaf epidermal wax content of citrus plants.

[0009] Preferably, the regulation method is to interfere with the expression level of miR1134 to improve the stress resistance and / or leaf epidermal wax content of citrus plants;

[0010] The stress resistance includes drought resistance and / or salt resistance.

[0011] The present invention provides a short tandem target mimic molecule for inhibiting the expression level of miR1134, and the nucleotide sequence of the short tandem target mimic molecule is as shown in SEQ ID NO:3.

[0012] The present invention provides a gene derivative product of the short tandem target mimic molecule, including at least one of the following products: an expression cassette, a recombinant vector, and a recombinant bacterium.

[0013] The present invention provides the application of the short tandem target mimic molecule or the gene derivative product in improving the stress resistance and / or leaf epidermal wax content of citrus plants.

[0014] The present invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants, by transferring the short tandem target mimic molecule or the gene derivative product into citrus plants.

[0015] The present invention provides a method for breeding stress-resistant citrus plant varieties and / or citrus plant varieties with high leaf epidermal wax content, by detecting the expression level of miR1134 in a citrus plant to-be-detected sample:

[0016] Taking wild-type lemon as a reference, selecting citrus plants with a decreased expression level of miR1134 in the to-be-detected sample as breeding materials for breeding;

[0017] The stress resistance includes drought resistance and / or salt resistance.

[0018] Preferably, the detection reagent includes a forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO:4 and a reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO:5.

[0019] The present invention has the following advantages compared with the prior art:

[0020] The present invention provides a miR1134 derived from Newhall navel orange, and its nucleotide sequence is shown in SEQ ID NO:1. The miR1134 is a target for regulating the epidermal wax content of citrus plants. By negatively regulating, it can increase the epidermal wax content of citrus, thereby enhancing the drought tolerance and / or salt tolerance of citrus plants. An embodiment of the present invention compared the leaf wax content of plants with silenced miR1134 expression and wild-type plants. The results showed that the total wax content and the contents of fatty acids, aldehydes, primary alcohols, and alkanes in the detached leaves of plants with silenced miR1134 expression were significantly higher than those of wild-type plants, and the leaf water loss rate and chlorophyll leaching rate were significantly lower than those of wild-type plants. The present invention further compared the drought resistance and salt resistance of plants with silenced miR1134 expression and wild-type plants. The results showed that after drought and high-salt stress treatments, the wild-type plants showed severe leaf curling and drooping, the degree of leaf damage of plants with silenced miR1134 expression was less than that of wild-type plants, the contents of malondialdehyde and hydrogen peroxide in the leaves were significantly lower than those of wild-type plants, while the maximum photosynthetic efficiency of photosystem II, anti-superoxide anion, superoxide dismutase, peroxidase, and catalase activities in the leaves were significantly higher than those of wild-type plants. The present invention enriches the achievements in the existing miRNA field and provides high-quality gene resources for cultivating new citrus varieties with stress tolerance.

[0021] The present invention provides a short tandem target mimic molecule for inhibiting the expression level of miR1134, and the nucleotide sequence of the short tandem target mimic molecule is shown in SEQ ID NO:3. The short tandem target mimic molecule can target the miR1134 sequence and effectively inhibit the expression level of miR1134, thereby increasing the epidermal wax content of citrus and enhancing the drought tolerance and salt tolerance of citrus plants.

[0022] The present invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants by transferring the short tandem target mimic molecule or the gene derivative product of the short tandem target mimic molecule into citrus plants. The method of the present invention can inhibit the expression level of miR1134, increase the epidermal wax content of citrus plants, and thereby enhance drought tolerance and salt tolerance. Description of the Drawings

[0023] Figure 1 It is a graph showing the relative expression levels of miR1134 in the leaves of wild-type lemon (WT) and different lines of miR1134-silenced lemon (STTM#1, STTM#2, STTM#3, STTM#4, STTM#5, STTM#6);

[0024] Figure 2Detection result graphs of water loss rate, chlorophyll leaching rate and wax content of in vitro leaves of wild-type lemon and two lemon lines with silenced miR1134 expression (STTM#1, STTM#2); where A is the water loss rate result, B is the chlorophyll leaching rate result, C is the wax component content result of the leaves, and D and E are the results of different carbon chain contents of the wax components in the leaves;

[0025] Figure 3 Phenotype and stress resistance physiological index detection result graphs of wild-type lemon (WT) and two lemon lines with silenced miR1134 expression (STTM#3, STTM#4) before and after drought stress; where A is the phenotype before and after drought stress, B is the maximum photosynthetic efficiency (Fv / Fm) of the leaves before and after drought stress, ** indicates that after drought treatment, the maximum photosynthetic efficiency of the transgenic lemon line leaves is extremely significantly higher than that of wild-type lemon (P<0.01), C is the malondialdehyde content of the leaves before and after drought stress, ** indicates that after drought treatment, the malondialdehyde content of the transgenic lemon line leaves is extremely significantly lower than that of wild-type lemon (P<0.05), D is the hydrogen peroxide content of the leaves before and after drought stress, ** indicates that after drought treatment, the hydrogen peroxide content of the transgenic lemon line leaves is extremely significantly lower than that of wild-type lemon (P<0.01); E is the anti-superoxide anion activity of the leaves before and after drought stress, * indicates that after drought treatment, the anti-superoxide anion activity of the transgenic lemon line leaves is significantly higher than that of wild-type lemon (P<0.05), F is the superoxide dismutase activity of the leaves before and after drought stress, ** indicates that after drought treatment, the superoxide dismutase activity of the transgenic lemon line leaves is extremely significantly higher than that of wild-type lemon (P<0.05), G is the peroxidase activity of the leaves before and after drought stress, * indicates that after drought treatment, the peroxidase activity of the transgenic lemon line leaves is significantly higher than that of wild-type lemon (P<0.05), H is the catalase activity of the leaves before and after drought stress, * indicates that after drought treatment, the catalase activity of the transgenic lemon line leaves is significantly higher than that of wild-type lemon (P<0.01);

[0026] Figure 4Phenotype and stress resistance physiological index detection results of wild-type lemon (WT) and two miR1134-silenced lemon lines (STTM#5, STTM#6) before and after high salt stress; among them, A is the phenotype before and after drought stress, B is the maximum photosynthetic efficiency (Fv / Fm) of leaves before and after drought stress, * indicates that after high salt treatment, the maximum photosynthetic efficiency of transgenic lemon lines is significantly higher than that of wild-type lemon (P<0.01), C is the malondialdehyde content of leaves before and after drought stress, * indicates that after high salt treatment, the malondialdehyde content of transgenic lemon lines is significantly lower than that of wild-type lemon (P<0.05); ** indicates that after high salt treatment, the malondialdehyde content of transgenic lemon lines is extremely significantly lower than that of wild-type lemon (P<0.01), D is the hydrogen peroxide content of leaves before and after drought stress, * indicates that after high salt treatment, the hydrogen peroxide content of transgenic lemon lines is significantly lower than that of wild-type lemon (P<0.05); ** indicates that after high salt treatment, the hydrogen peroxide content of transgenic lemon lines is extremely significantly lower than that of wild-type lemon (P<0.01); E is the anti-superoxide anion activity of leaves before and after drought stress; ** indicates that after high salt treatment, the anti-superoxide anion activity of transgenic lemon lines is extremely significantly higher than that of wild-type lemon (P<0.01), F is the superoxide dismutase activity of leaves before and after drought stress, * indicates that after high salt treatment, the superoxide dismutase activity of transgenic lemon lines is significantly higher than that of wild-type lemon (P<0.01), G is the peroxidase activity of leaves before and after drought stress, * indicates that after high salt treatment, the peroxidase activity of transgenic lemon lines is significantly higher than that of wild-type lemon (P<0.05), H is the catalase activity of leaves before and after drought stress, * indicates that after high salt treatment, the catalase activity of transgenic lemon lines is significantly higher than that of wild-type lemon (P<0.05) 。 Detailed implementation mode

[0027] The present invention provides a miR1134 derived from Newhall navel orange, and its nucleotide sequence is shown as SEQ ID NO:1 (AGAAGAAGAAGAAGAAGAUU).

[0028] The miR1134 of the present invention is a target for regulating the epidermal wax content of citrus plants, and enhances the drought tolerance and / or salt tolerance of citrus plants by negatively regulating to increase the epidermal wax content of citrus.

[0029] The present invention provides a precursor of miR1134 described in the above technical solution, and the nucleotide sequence is as shown in SEQ ID NO:2 (UUUUGACUGUGUUUUUUCUUUCUUUCUUUCUUUUGAUUAACU GUGGAUCAAAAUUAGUGUUUUAAGCUUUUACACAAUAGUGAUAAAUA AGAUAUUUGACAAAACAAAUUCUAAAAAAAACAUAUUUGACAAAAUUG CGAAAAAGA AG AAGAAGAAGAAGAAGAUU AUAGUUAUAG, where the underlined part is the miR1134 sequence).

[0030] In the present invention, the nucleotide sequence of the DNA molecule encoding the precursor of miR1134 is as shown in SEQ ID NO:6 (TTTTGACTGTGTTTTTTCTTTCTTTCTTTCTTTTGATTAACTG TGGATCAAAATTAGTGTTTTAAGCTTTTACACAATAGTGATAAATAAGATAT TTGACAAAACAAATTCTAAAAAAAACATATTTGACAAAATTGCGAAAAAGAAGAAGAAGAAGAAGAAGATTATAGTTATAG).

[0031] The present invention obtains a miR1134 silencing expression vector by short tandem target mimic (STTM) technology with the DNA molecule encoding the precursor of miR1134, and then introduces the miR1134 silencing expression vector into citrus plants to inhibit the expression level of miR1134, thereby increasing the citrus epidermal wax content and enhancing the drought tolerance and / or salt tolerance of citrus plants.

[0032] The present invention provides the use of the miR1134 or the precursor of miR1134 in regulating the stress resistance and / or leaf epidermal wax content of citrus plants.

[0033] In the present invention, the regulation method preferably is to interfere with the expression level of miR1134 to improve the stress resistance and / or leaf epidermal wax content of citrus plants. The stress resistance preferably includes drought resistance and / or salt resistance. The drought resistance refers to the adaptation and resistance ability of plants to drought. The drought preferably includes natural drought, more preferably no watering for 10 - 20 days, still more preferably no watering for 12 - 18 days, and most preferably no watering for 15 days. The salt resistance refers to the tolerance ability of plants to salt environment. The salt environment preferably includes saline irrigation, more preferably irrigating plants with 300 mmol / L NaCl, the irrigation frequency preferably being once every 3 days; the number of irrigation times preferably being 4 - 6 times, still more preferably 5 times; the irrigation amount preferably being 80 - 120 mL per plant, still more preferably 90 - 110 mL, and most preferably 100 mL.

[0034] An embodiment of the present invention compared the leaf wax content of plants with silenced miR1134 expression and wild - type plants. The results showed that the total wax content and the contents of fatty acid, aldehyde, primary alcohol, and alkane components in the detached leaves of plants with silenced miR1134 expression were significantly higher than those of wild - type plants, and the leaf water loss rate and chlorophyll leaching rate were significantly lower than those of wild - type plants. The present invention further compared the drought resistance and salt resistance of plants with silenced miR1134 expression and wild - type plants. The results showed that after 15 days of no watering or 15 days of irrigation with 300 mmol / L NaCl, the wild - type plants showed severe leaf curling and drooping. The degree of leaf damage of plants with silenced miR1134 expression was less than that of wild - type plants, and the contents of malondialdehyde and hydrogen peroxide in the leaves were significantly lower than those of wild - type plants, while the maximum photosynthetic efficiency of photosystem II, anti - superoxide anion, superoxide dismutase, peroxidase, and catalase activities in the leaves were significantly higher than those of wild - type plants. It can be seen that compared with wild - type plants, plants with silenced miR1134 expression have higher leaf wax content, stronger drought tolerance, and salt tolerance.

[0035] The present invention provides a short tandem target mimic molecule for inhibiting the expression level of the miR1134, and the nucleotide sequence of the short tandem target mimic molecule is as shown in SEQ ID NO:3(

[0036] where the underlined part is the homologous recombination sequence on the pBI121 vector, the italic part is the reverse complementary sequence of the miR1134 sequence, the bold part is the introduced bridge sequence, and the lowercase part is the 48 - bp intermediate connecting sequence).

[0037] In the present invention, the short tandem target mimic molecule preferably adopts the short tandem targets mimic (STTM) technology that specifically inhibits the expression level of miR1134, and a sequence that can complementarily pair with the miR1134 sequence but cannot cleave its target gene is artificially synthesized. The short tandem target mimic molecule can inhibit the expression level of the miR1134, thereby increasing the citrus epidermal wax content and enhancing the drought tolerance and / or salt tolerance of citrus plants.

[0038] The present invention provides a gene derivative product of the short tandem target mimic molecule, including at least one of the following products: expression cassette, recombinant vector, and recombinant bacterium.

[0039] In the present invention, the expression cassette preferably includes the short tandem target mimic molecule and a promoter. The promoter preferably includes the 2×35S promoter (d35S). The short tandem target mimic molecule is transcribed under the drive of the 2×35S promoter (d35S), and the transcription product can effectively inhibit the expression level of miR1134.

[0040] In the present invention, the backbone vector of the recombinant vector preferably includes the pBI121 vector. The pBI121 vector preferably contains the d35S-pBI121 vector with the 2×35S promoter. The construction method of the d35S-pBI121 vector is preferably to insert the gene fragment of 35S into the multiple cloning sites of Xba I and BamH I of the pBI121 vector. The gene fragment of 35S is preferably amplified using primers with nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10 with the pBI121 vector plasmid as a template. In the embodiment of the present invention, the short tandem target mimic molecule is inserted into the multiple cloning sites of Sac I and BamH I of the d35S-pBI121 vector to obtain the recombinant vector (STTM1134). The present invention does not make special limitations on the construction method of the recombinant vector, and the common recombinant vector construction methods in the art can be used.

[0041] In the present invention, the recombinant bacterium preferably contains the recombinant vector. The host bacterium of the recombinant vector preferably includes Agrobacterium. The strain of Agrobacterium preferably includes the Agrobacterium strain GV3101. The recombinant bacterium inhibits the expression level of miR1134 in citrus plants by infecting citrus plants, thereby increasing the citrus leaf epidermal wax content and enhancing the drought tolerance and salt tolerance of citrus plants.

[0042] The present invention provides the application of the short tandem target mimic molecule or the gene derivative product in improving the stress resistance and / or leaf epidermal wax content of citrus plants. The stress resistance includes drought resistance and / or salt resistance.

[0043] The present invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants, by transferring the short tandem target mimic molecule or the gene derivative into citrus plants.

[0044] In the present invention, the stress resistance includes drought resistance and / or salt resistance. The preferred method for transfer preferably includes the Agrobacterium-mediated method. The Agrobacterium preferably includes Agrobacterium GV3101. The preferred site for Agrobacterium infection during transfer is the stem segment. After transfer, positive plants are preferably screened by a plate, and the medium used for plate screening is MS solid medium + indolebutyric acid 0.5 mg / L + cefamycin 500 mg / L + kanamycin 50 mg / L. After plate screening, it is preferably transferred to a rooting medium for culture, and the rooting medium is preferably 1 / 2 MS solid medium + 0.1 mg / L naphthylacetic acid + 1 g / L activated carbon, pH 5.8. After rooting culture, regenerated plants are preferably obtained through acclimatization. The regenerated plants are preferably subjected to molecular identification, and the primers for molecular identification preferably include the forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO: 4 and the reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO: 5. Transferring the short tandem target mimic molecule or the gene derivative into citrus plants in the present invention can effectively regulate the drought tolerance and salt tolerance of citrus.

[0045] The present invention provides a method for breeding stress-resistant varieties and / or high-wax-content leaf epidermal varieties of citrus plants, by detecting the expression level of miR1134 in a test sample of citrus plants:

[0046] Taking wild-type lemon as a reference, citrus plants with a decreased expression level of miR1134 in the test sample are selected as breeding materials for breeding;

[0047] The stress resistance includes drought resistance and / or salt resistance.

[0048] In the present invention, the reagents for detection preferably include the forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO: 4 and the reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO: 5.

[0049] In the present invention, the citrus plants preferably include at least one of the following categories: oranges, mandarins, grapefruits, and lemons, and more preferably include at least one of the following: sweet oranges, grapefruits, oranges, mandarins, citrons, lemons, and kumquats.

[0050] In an embodiment of the present invention, the wax content and stress resistance of wild lemons and lemons with a down-regulated expression level of miR1134 compared to wild-type lemons were compared. The results showed that, compared with wild-type plants, lemons with a down-regulated expression level of miR1134 had higher leaf wax content, stronger drought tolerance and salt tolerance. It can be seen that the method of the present invention can be used to breed citrus plants with stress resistance varieties and / or varieties with high wax content on the leaf epidermis.

[0051] To further illustrate the present invention, a miR1134 and its short tandem target mimic molecule for regulating citrus epidermal wax content and citrus stress resistance and their applications provided by the present invention will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] Example 1

[0053] Extraction method of DNA molecule encoding the precursor sequence of miR1134

[0054] (1) Extraction of plant genomic DNA

[0055] Extract the DNA of Newhall navel orange leaves using a plant genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). For the detailed steps, please refer to the instruction manual.

[0056] (2) PCR amplification

[0057] Using the genomic DNA extracted in step (1) as a template, perform a PCR reaction according to the system described in Table 1:

[0058] Table 1 PCR amplification system (50 μL)

[0059]

[0060]

[0061] Forward primer F: 5’-TTTTGACTGTGTTTTTTC-3’ (SEQ ID NO:7);

[0062] Reverse primer R: 5’-CTATAACTATAATCTTCT-3’ (SEQ ID NO:8).

[0063] The PCR amplification program can be found in the instruction manual of the used high-fidelity PCR mix (Beijing Kangrun Chengye Biotechnology Co., Ltd.).

[0064] The amplified target fragment was separated by 1.5% agarose gel electrophoresis, and a band with a molecular weight of approximately 176 bp was obtained. The gel block containing the target gene was cut off with a clean blade on a UV projection gel cutting table and placed into a 2 mL centrifuge tube. The product was recovered using an Agarose Gel DNA Recovery Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0065] (3) Ligation and transformation of the target fragment with the sequencing vector

[0066] The target fragment was ligated with the sequencing vector using the pClone007 BluntVectorKit kit (Beijing Tsingke Biotechnology Co., Ltd.), and the ligation product was transformed into Escherichia coli Trans5α competent cells (Beijing TransGen Biotech Co., Ltd.). The detailed steps are shown in the instruction manual. Single colonies were picked for colony PCR detection. The PCR primers, reaction system, and program were the same as those in step (2). Positive colonies were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0067] Example 2

[0068] Construction method of the miR1134 silencing expression vector

[0069] The silencing expression of miR1134 was achieved using the short tandem targets mimic (STTM) technology that can specifically inhibit a certain miRNA, that is, a sequence that can complementarily pair with the mature sequence of a specific miRNA but cannot cleave its target gene was artificially synthesized and transcribed under the drive of the 2×35S promoter (d35S). The transcription product can effectively inhibit the expression level of the miRNA.

[0070] (1) Design of the short tandem target mimic molecule sequence

[0071] First, the two mature sequences of miR1134 were reverse-complemented, three bases "ACG" were added between the 10th and 11th bases at the cleavage site of miR1134, and then the two fragments were connected with a 48-bp sequence that can form a hairpin structure by itself. Then, 22-bp sequences upstream and downstream of the BamH I and Sac I restriction enzyme cleavage sites on the pBI121 vector were added to the 5' and 3' ends of the whole sequence for subsequent homologous recombination reactions. The finally designed short tandem target mimic molecule sequence is as follows:

[0072]

[0073] (SEQ ID NO:3)

[0074] The underlined part is the homologous recombination sequence on the pBI121 vector, the italic part is the reverse complementary sequence of the miR1134 sequence, the bold part is the introduced bridging sequence, and the lowercase part is the 48-bp intermediate linker sequence. Sangon Biotech (Shanghai) Co., Ltd. synthesized the short tandem target mimic molecule according to the sequence.

[0075] (2) Construction of the d35S-pBI121 vector

[0076] Amplification primers were designed according to the 35S sequence on the pBI121 vector, and Xba I and BamH I restriction enzyme sites and protective bases were added to the 5' ends of the primers respectively. The primer sequences are as follows:

[0077] Forward primer F-35S: 5'-ATGCTCTAGAAGATTAGCCTTTTCAATTTCAG-3' (SEQ ID NO:9);

[0078] Reverse primer R-35S: 5'-CGCGGATCCCGTGTTCTCTCCAAATGAAATG-3' (SEQ ID NO:10).

[0079] Using the pBI121 vector plasmid as a template, the 35S sequence was amplified with a high-fidelity PCRmix system. The amplified product was separated by 1% agarose gel electrophoresis, gel-extracted and ligated to a sequencing vector, then transformed into Escherichia coli Trans5α competent cells. Single colonies were picked for PCR detection, and positive colonies were selected and sent to a biological company for sequencing (the method refers to Example 1).

[0080] The plasmid of the above positive colonies was extracted using a plasmid miniprep kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the positive colony plasmid and the pBI121 empty vector were double-digested with Xba I and BamH I respectively. The digestion system is as follows:

[0081] Table 2 Digestion reaction system (50 μL)

[0082] Component Volume Plasmid DNA 25 μL <![CDATA[10×FuniCut TM Buffer]]> 5 μL XbaI 2.5 μL BamHI 2.5 μL <![CDATA[ddH2O]]> 15 μL Total 50 μL

[0083] The digestion procedure refers to the instruction manual of the rapid restriction endonuclease used (Yeasen Biotech Co., Ltd.). The double-digested product was separated by 1% agarose gel electrophoresis, and the 35S fragment and the linear pBI121 vector were recovered. The two recovered fragments were subjected to a ligation reaction according to the system in Table 3:

[0084] Table 3 Ligation reaction system (10 μL)

[0085]

[0086]

[0087] Connect for 16 h at 16 °C.

[0088] Transform the ligation product into competent Escherichia coli Trans5α cells and pick monoclonal colonies. Design a pair of primers before and after the expected constructed d35S:

[0089] Forward primer F-d35S: 5’-TATGCTTCCGGCTCGTATG-3’ (SEQ ID NO:11);

[0090] Reverse primer R-d35S: 5’-ATCCAGACTGAATGCCCAC-3’ (SEQ ID NO:12).

[0091] Perform PCR detection with the above primers, select positive colonies and send them to a biological company for sequencing (the method refers to Example 1). Resuscitate the positive clone bacterial solution with accurate sequencing verification and extract the plasmid.

[0092] (3) Construction of miR1134 silencing expression vector

[0093] After ligating the short tandem target mimic synthesized in step (1) onto the pUC19 vector, transform Escherichia coli, pick single colonies and perform PCR detection with the universal primer M13 to obtain positive bacterial solutions.

[0094] Forward primer M13-F: TGTAAAACGACGGCCAGT (SEQ ID NO:13);

[0095] Reverse primer M13-R: CAGGAAACAGCTATGACC (SEQ ID NO:14).

[0096] Design a pair of amplification primers according to the designed short tandem target mimic molecule sequence:

[0097] Forward primer F-STTM: 5’-ATTTGGAGAGAACACGGGATC-3’ (SEQ ID NO:15);

[0098] Reverse primer R-STTM: 5’-CGATCGGGGAAATTCGAG-3’ (SEQ ID NO:16).

[0099] Using the above-mentioned positive bacterial solution as a template, amplify the short tandem target mimic molecule sequence with a high-fidelity PCRmix system, separate the amplified product by 1% agarose gel electrophoresis, recover the gel, and store it for later use. Double-digest the d35S-pBI121 vector obtained in step (2) with Sac I and BamH I, separate the double-digested product by 1% agarose gel electrophoresis, recover the linear d35S-pBI121 vector, ligate the recovered short tandem target mimic molecule sequence with the linear d35S-pBI121 vector, transform the ligation product into Escherichia coli, perform PCR detection with the above primers, select positive colonies and send them to a biological company for sequencing, and name the correctly sequenced positive plasmid STTM1134.

[0100] (4) Agrobacterium transformation of STTM1134

[0101] Transfer the constructed vector STTM1134 into Agrobacterium tumefaciens GV3101 (Shanghai Weidi Biotechnology Co., Ltd.). For the detailed steps, see the instruction manual. Pick a single colony, perform PCR detection with the primers in step (3), add 20% glycerol to the positive bacterial solution and mix well. The obtained bacterial solution is the Agrobacterium tumefaciens strain containing the STTM1134 vector plasmid, and store it at -80 °C for later use.

[0102] Example 3

[0103] Preparation method of transgenic lemon with miR1134 silenced expression

[0104] (1) Sowing

[0105] Take out the seeds from lemon fruits, wash them with double-distilled water, dry them, and peel off the seed coats of the dried seeds. Then, soak them in 75% ethanol for 40 - 60 s on a clean bench, disinfect them with 1% sodium hypochlorite for 20 min, then wash them 4 times with sterile water, and make a cross on the seeds with a sterile blade. Sow the treated seeds on a sterilized MS solid medium (Qingdao Haibo Biotechnology Co., Ltd.) on a clean bench, culture them in the dark at 26 ± 2 °C for about 25 d. When the etiolated hypocotyls grow to about 20 cm, culture them under light (16 h light / 8 h dark) for about 7 d. Select the seedlings with a diameter of about 1.5 - 2.0 mm as transgenic explant materials, and cut their hypocotyls obliquely into internode stem segments about 1 cm long for later use.

[0106] (2) Preparation of Agrobacterium infection solution

[0107] Agrobacterium containing the STTM1134 vector plasmid stored at -80°C was aspirated into YEB liquid medium (Beijing Solarbio Science & Technology Co., Ltd.) containing 50 mg / L kanamycin and 20 mg / L rifampicin, and cultured with shaking at 28°C and 200 r / min until the OD600 of the bacterial liquid was about 1.0, then further cultured until the OD600 was about 0.7. After centrifugation, the supernatant was removed, and the cells were resuspended with a resuspension solution (MS liquid medium + 2.5 mg / L 6-benzylaminopurine + 0.5 mg / L indolebutyric acid + 100 μmol / L acetosyringone), and cultured with shaking at 28°C and 200 r / min for 30 min before being used for infection.

[0108] (3) Stem segment transformation

[0109] The prepared stem segments were soaked in the Agrobacterium infection solution for 15 min. After drying the bacteria on the surface of the stem tip with sterile filter paper, they were placed horizontally on the co-culture medium (MS solid medium + 2.5 mg / L 6-benzylaminopurine + 0.5 mg / L indolebutyric acid + 100 μmol / L acetosyringone) and cultured in the dark at 28°C for 3 d. The stem segments on the co-culture medium were dried with sterile filter paper to remove the bacterial liquid on the surface of the stem tip, and then placed horizontally on the selection medium (MS solid medium + 0.5 mg / L indolebutyric acid + 500 mg / L cefotaxime + 50 mg / L kanamycin) for resistance screening and bud induction, and cultured until the new buds grew to about 1 cm. Subculture was carried out about every 20 d during this period. When the new buds grew to about 1 cm in height, the small bud clusters were cut off, and the lower morphological ends were inserted into the rooting medium (1 / 2MS solid medium + 0.1 mg / L naphthaleneacetic acid + 1 g / L activated carbon, pH 5.8) for rooting culture. After the regenerated lemon plants took root, the sealing film of the tissue culture flask was removed for acclimatization for 1 - 2 d, and then the regenerated plants were taken out of the medium, the roots were rinsed with tap water, and the residual agar attached to the roots was washed away. Then, they were transplanted into nutrient pots filled with nutrient soil, the pot mouths were covered with breathable sealing film, and the sealing film was removed after about 14 d, and they continued to grow in the culture room (25°C, 16 h light / 8 h dark, relative humidity 80%).

[0110] (4) Identification of positive lemon transformed plants

[0111] Lemon leaves were placed in a 2 mL centrifuge tube, an appropriate amount of liquid nitrogen was added, and the leaves were ground with a 1 mL pipette tip with a flattened end pre-cooled with liquid nitrogen. The leaf DNA was extracted by the CTAB method, and the specific method was as follows:

[0112] ① Add 650 μL of 2×CTAB extraction buffer: β-mercaptoethanol (Beijing Solarbio Science & Technology Co., Ltd.) (volume ratio 99:1) mixture to the 2 mL centrifuge tube containing the sample, shake well, and place in a 65°C water bath for 60 min;

[0113] ② Add 650 μL of chloroform:isoamyl alcohol (Xilong Scientific Co., Ltd.) (volume ratio 24:1), extract for 2 - 3 min, mix well, centrifuge at 12000 rpm for 5 min;

[0114] ③ Pipette approximately 600 μL of the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol (Xilong Scientific Co., Ltd.), invert the tube up and down to mix well, let it stand for 10 min, centrifuge at 12000 rpm for 2 min;

[0115] ④ Remove the supernatant, add 900 μL of 75% ethanol, invert the tube up and down to mix well, centrifuge at 12000 rpm for 1 min, and remove the supernatant;

[0116] ⑤ Treat the precipitate with a rotary evaporator under V - AL conditions for 10 min;

[0117] ⑥ Add 50 μL of ddH2O to the centrifuge tube and place it in a 4°C refrigerator overnight.

[0118] Design primers based on the 35S sequence on the STTM1134 vector:

[0119] Forward primer 35S - F: 5’ - TAACAGAACTCGCCGTAAAGAC - 3’ (SEQ ID NO:17);

[0120] Reverse primer R - STTM: 5’ - CGATCGGGGAAATTCGAG - 3’ (SEQ ID NO:16).

[0121] Using the extracted DNA above as a template, perform PCR amplification to identify positive lemon transgenic plants. The PCR system is halved and the procedure is the same as in step (2) of Example 1.

[0122] (5) Identification of miR1134 expression level in the leaves of positive transgenic lemon lines

[0123] The expression levels of miR1134 in the leaves of wild-type lemons and positive transgenic lemon lines were detected by real-time fluorescence quantitative PCR (qPCR). First, a total RNA extraction kit (Promega (Beijing) Biotechnology Co., Ltd.) was used to extract the total RNA from the leaves of wild-type and transgenic lemons. The detailed steps are shown in the instruction manual. According to the miRNA first-strand cDNA synthesis (stem-loop method) kit (Sangon Biotech (Shanghai) Co., Ltd.) instruction manual and the mature sequence of miR1134, miRNA stem-loop primers were designed for cDNA synthesis to obtain cDNA. Primer sequence: 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAATC TT-3’ (SEQ ID NO:18). Then, a miRNA fluorescence quantitative PCR kit (dye method) (Sangon Biotech (Shanghai) Co., Ltd.) was used for qPCR. The system and procedure were referred to the instruction manual. The qPCR primer sequences are as follows:

[0124] Forward primer miR1134-F: 5’-CGTCGCGAGAAGAAGAAGAAG-3’ (SEQ ID NO:4);

[0125] Reverse primer miR1134-R: 5’-AGTGCAGGGTCCGAGGTATT-3’ (SEQ ID NO:5).

[0126] The U6 gene was used as an internal reference. The U6 primer sequences are:

[0127] Forward primer U6-F: 5’-TTGGGACGATACACAGAAAATTAG-3’ (SEQ ID NO:19);

[0128] Reverse primer U6-R: 5’-GATTTGTGCGTGTCATTCCTGTC-3’ (SEQ ID NO:20).

[0129] The qPCR results showed that the expression level of miR1134 in the leaves of transgenic lemon lines was significantly lower than that of wild-type lemons ( Figure 1 and Table 4).

[0130] Table 4 Expression levels of miR1134

[0131] Genotype Relative expression level WT 1.01±0.17 STTM#1 0.18±0.03** STTM#2 0.29±0.04** STTM#3 0.31±0.08** STTM#4 0.23±0.02** STTM#5 0.26±0.06** STTM#6 0.34±0.07**

[0132] Note: ** indicates that the relative expression level of miR1134 in the leaves of transgenic lemon lines was extremely significantly lower than that of wild-type lemons (P<0.01).

[0133] Example 4

[0134] Silencing of miR1134 increases the epicuticular wax content in transgenic lemon leaves

[0135] (1) Detection of leaf water loss rate and chlorophyll permeability

[0136] The wild type (WT) and two transgenic lemon lines (STTM#1 and STTM#2) were placed in the dark for 12 h. Leaves were cut and immediately weighed. The leaves were then placed in the dark and weighed every 1 h at room temperature (0 - 8 h). The water loss rate was equal to the ratio of the reduced mass of the leaf at a certain time point to the fresh weight of the starting leaf. Each treatment had 3 - 5 replicates, and the experiment was repeated 3 times.

[0137] The wild type and two transgenic lemon lines were placed in the dark for 12 h. Leaves were cut and immediately immersed in 50 mL of 80% ethanol solution (v / v) in a glass tube. Then, the absorbance values of the leaching solution were measured at 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, and 24 h respectively. The whole operation process was carried out under low light. The absorbance values of the leaching solution at 647 nm and 664 nm were measured using a UV - visible spectrophotometer. The total micromole amount of chlorophyll (M) in the leaching solution = 7.93(A664)+19.53(A647). The chlorophyll leaching rate at each time point was calculated with the chlorophyll leaching amount at 24 h as a reference.

[0138] (2) Analysis of leaf wax components (GC - FID)

[0139] GC - FID was used to determine the wax components and contents on the leaf surfaces of transgenic plants. Leaves of the wild type and transgenic lemon lines with the same seedling age and consistent area were placed into 20 mL gas chromatography glass sample bottles. When extracting, 10 mL of chromatographically pure n - hexane was added continuously twice, shaken for 30 s, and then the n - hexane solutions were combined into a new 20 mL sample bottle. The samples could be processed immediately or stored in a 4℃ refrigerator for a long time. 100 μL of 50 μg / mL n - tetracosane was added as an internal standard to the sample using a precision pipette tip, and shaken well. Under the heating condition of 50℃ in a nitrogen evaporator, the solvent n - hexane was dried with nitrogen, and then 50 μL of derivatization reagent BSTFA was added, shaken well, and derivatized at 100℃ for 15 - 30 min. After the derivatization bottle cooled to room temperature, an appropriate volume of n - hexane was added to shake and dissolve the sample, and finally the sample was transferred to a GC sample vial for sample injection analysis.

[0140] The Agilent 8890 gas chromatograph was used with a DB-5 chromatographic column. The method for measuring leaf wax is as follows: Carrier gas: helium, flow rate 1 mL / min in constant flow mode. Detector: flame ionization detector (FID), 300 °C; Air:H2:He = 400:30:25. Injection port: 300 °C, splitless mode, injection volume 1 μL. Chromatographic column temperature program: start at 80 °C and hold for 2 min, then increase to 200 °C at 40 °C / min and hold for 2 min. Then increase to 270 °C at 10 °C / min and hold for 2 min. Finally, increase to 320 °C at 2 °C / min and hold for 10 min. Each peak was quantified using an internal standard and qualitatively analyzed using a reference standard.

[0141] The experimental results showed that:

[0142] The water loss rate ( Figure 2 in Table 5) and chlorophyll leaching rate of the detached leaves of miR1134-silenced lemon (STTM#1, STTM#2) were significantly lower than those of wild-type lemon (WT) ( Figure 2 in Table 6).

[0143] Table 5 Water loss rate of detached leaves (%)

[0144] Time WT STTM#1 STTM#2 0h 0.00±0.00 0.00±0.00 0.00±0.00 1h 16.64±0.21 13.71±0.55** 12.84±0.13** 2h 19.69±0.39 16.31±0.07** 15.56±0.23** 3h 20.38±0.23 17.04±0.30** 16.49±0.42** 4h 21.07±0.10 17.71±0.25** 17.10±0.60** 5h 21.59±0.04 18.18±0.23** 17.63±0.46** 6h 21.88±0.08 18.51±0.42** 17.93±0.74**

[0145] Note: ** indicates that the water loss rate of the leaves of the transgenic lemon lines is extremely significantly lower than that of wild-type lemon (P < 0.01).

[0146] Table 6 Chlorophyll leaching rate of detached leaves (%)

[0147] Time WT STTM#1 STTM#2 0h 0.00±0.00 0.00±0.00 0.00±0.00 2h 24.74±1.20 22.49±1.33 23.34±1.46 4h 36.42±1.45 35.58±2.85 35.97±4.35 6h 43.80±1.91 39.96±0.18 39.52±2.71 8h 55.79±2.20 47.39±0.69* 44.28±1.15** 10h 62.06±2.03 56.34±1.35* 55.97±1.70* 12h 68.71±0.73 63.27±0.88** 62.71±1.73*

[0148] Note: * indicates that the chlorophyll leaching rate of the leaves of the transgenic lemon lines is significantly lower than that of wild-type lemon (P < 0.05); ** indicates that the chlorophyll leaching rate of the leaves of the transgenic lemon lines is extremely significantly lower than that of wild-type lemon (P < 0.01).

[0149] GC-FID wax content analysis showed that the total wax content of the leaves of miR1134-silenced lemon (STTM#1, STTM#2) was significantly higher than that of wild-type lemon; the main components of lemon leaf wax are fatty acids, aldehydes, primary alcohols, and alkanes, and their contents in the leaves of miR1134-silenced lemon were all significantly higher than those of wild-type lemon ( Figure 2C and Table 7). The contents of C24-C28 fatty acids, C28-C30 aldehydes, C26-C32 primary alcohols and C27-C33 alkanes in the transgenic lemon leaves were significantly higher than those in the wild-type lemon ( Figure 2 C, D and Table 8).

[0150] Table 7 Wax component contents in leaves (μg dm -2 )

[0151]

[0152] Note: ** indicates that the wax component contents in the leaves of the transgenic lemon lines were extremely significantly higher than those in the wild-type lemon (P < 0.01).

[0153] Table 8 Different carbon chain contents of wax components in leaves (μg dm -2 )

[0154]

[0155] Note: * indicates that there were significant differences in the different carbon chain contents of wax components between the leaves of the transgenic lemon lines and the wild-type lemon leaves (P < 0.05); ** there were extremely significant differences in the different carbon chain contents of wax components between the leaves of the transgenic lemon lines and the wild-type lemon leaves (P < 0.01).

[0156] The above results indicate that the silencing of miR1134 can significantly increase the total wax amount and the contents of fatty acids, aldehydes, primary alcohols and alkanes in lemon leaves.

[0157] Example 5

[0158] Silencing of miR1134 improves the drought and salt tolerance of transgenic lemon

[0159] (1) Drought and high salt stress treatments

[0160] Wild-type lemon (Wild type, WT) and four transgenic lemon lines (STTM#3 to STTM#6) with consistent growth were selected and subjected to drought (STTM#3 and STTM#4) and high salt (STTM#5, STTM#6) treatments, respectively.

[0161] Drought soil culture treatment: After 15 days of natural drought (without watering) treatment of wild-type lemon and two transgenic lemon lines (STTM#3 and STTM#4), photos were taken and stress resistance physiological indexes were detected.

[0162] High salt soil culture treatment: Wild-type and transgenic lemons were watered with 300 mmol / L NaCl at the same time, 100 mL per plant each time, and watered every 3 days for a total of 15 days. Phenotype photos were taken and stress resistance physiological indexes were detected.

[0163] (2) Determination of the maximum photosynthetic efficiency (Fv / Fm), malondialdehyde (MDA) and hydrogen peroxide (H2O2) contents, and anti-superoxide anion (anti-O2 ·- ), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities in the photosystem II of leaves

[0164] The Fv / Fm of the leaves of two lemon genotypes before and after drought and high-salt treatments was detected using a chlorophyll fluorometer (PAM-2000, Germany), and the contents of MDA and H2O2 and the activities of anti-O2 ·- , SOD, POD, and CAT were detected using detection kits for MDA (A003), H2O2 (A064), anti-O2 ·- (A052), SOD (A001), POD (A084), and CAT (A007) produced by Nanjing Jiancheng Bioengineering Institute. The detailed steps are shown in the instruction manual. The experimental results are shown in Figures 3 - 4 and Tables 9 - 22.

[0165] Table 9 Maximum photosynthetic efficiency (Fv / Fm) of leaves before and after drought stress

[0166] WT STTM#3 STTM#4 Before treatment 0.82±0.01 0.81±0.01 0.81±0.01 After treatment 0.53±0.06 0.69±0.03* 0.70±0.02*

[0167] Note: ** indicates that after drought treatment, the maximum photosynthetic efficiency of the leaves of transgenic lemon lines was extremely significantly higher than that of wild-type lemon (P < 0.01).

[0168] Table 10 Malondialdehyde content (MDA content, nmol mg -1 prot) of leaves before and after drought stress

[0169] WT STTM#3 STTM#4 Before treatment 4.35±0.44 4.27±0.51 4.14±0.48 After treatment 8.43±0.31 5.84±0.57** 5.91±0.78**

[0170] Note: ** indicates that after drought treatment, the malondialdehyde content of the leaves of transgenic lemon lines was extremely significantly lower than that of wild-type lemon (P < 0.05).

[0171] Table 11 Hydrogen peroxide content (H2O2 content, mmol g -1 prot) of leaves before and after drought stress

[0172] WT STTM#3 STTM#4 Before treatment 55.68±3.42 58.75±1.19 56.21±5.04 After treatment 181.74±10.60 112.59±12.97** 111.87±13.39**

[0173] Note: ** indicates that after drought treatment, the hydrogen peroxide content of the leaves of transgenic lemon lines was extremely significantly lower than that of wild-type lemon (P < 0.01).

[0174] Table 12 Anti-superoxide anion activity (Anti-O2 - activity, U g-1 prot)

[0175] WT STTM#3 STTM#4 Before treatment 56.43±5.87 59.66±8.69 57.78±6.62 After treatment 71.93±7.85 99.14±9.48* 101.13±9.65*

[0176] Note: * indicates that after drought treatment, the superoxide anion resistance activity of the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P<0.05).

[0177] Table 13 Superoxide dismutase activity (SOD activity, U g -1 FW)

[0178] WT STTM#3 STTM#4 Before treatment 90.43±15.91 122.23±23.82 104.56±19.23 After treatment 323.58±31.89 471.24±36.05** 491.02±32.17**

[0179] Note: ** indicates that after drought treatment, the superoxide dismutase activity of the leaves of the transgenic lemon lines was extremely significantly higher than that of the wild-type lemon.

[0180] (P<0.05)

[0181] Table 14 Peroxidase activity (POD activity, U g -1 FW)

[0182] WT STTM#3 STTM#4 Before treatment 457.00±43.31 449.67±44.46 460.67±59.54 After treatment 531.33±46.69 666.33±52.00* 676.67±61.71*

[0183] Note: * indicates that after drought treatment, the peroxidase activity of the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P<0.05).

[0184] Table 15 Catalase activity (CAT activity, U mg -1 prot)

[0185] WT STTM#3 STTM#4 Before treatment 18.54±1.41 20.71±1.56 21.89±2.00 After treatment 24.90±2.97 35.67±3.38* 37.28±4.62*

[0186] Note: * indicates that after drought treatment, the catalase activity of the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P<0.01).

[0187] Table 16 Maximum photosynthetic efficiency (Fv / Fm) of leaves before and after high-salt stress

[0188] WT STTM#5 STTM#6 Before treatment 0.84±0.01 0.84±0.01 0.84±0.01 After treatment 0.30±0.09 0.55±0.10* 0.55±0.07*

[0189] Note: * indicates that after high-salt treatment, the maximum photosynthetic efficiency of the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P<0.01).

[0190] Table 17 Malondialdehyde content (MDA content, nmol mg -1 prot)

[0191] WT STTM#5 STTM#6 Before treatment 4.27±0.69 4.63±1.00 4.47±1.09 After treatment 7.32±0.66 5.17±0.70* 4.83±0.41**

[0192] Note: * indicates that after high-salt treatment, the malondialdehyde content in the leaves of transgenic lemon lines was significantly lower than that of wild-type lemon (P<0.05); ** indicates that after high-salt treatment, the malondialdehyde content in the leaves of transgenic lemon lines was extremely significantly lower than that of wild-type lemon (P<0.01).

[0193] Table 18 Hydrogen peroxide content in leaves before and after high-salt stress (H2O2 content, mmol g -1 prot)

[0194] WT STTM#5 STTM#6 Before treatment 49.95±3.29 42.56±8.24 41.74±6.05 After treatment 114.64±9.57 82.17±8.17* 84.64±4.63**

[0195] Note: * indicates that after high-salt treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was significantly lower than that of wild-type lemon (P<0.05); ** indicates that after high-salt treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was extremely significantly lower than that of wild-type lemon (P<0.01).

[0196] Table 19 Anti-superoxide anion activity in leaves before and after high-salt stress (Anti-O2 - activity, U g -1 prot)

[0197] WT STTM#5 STTM#6 Before treatment 25.68±3.73 30.30±2.26 28.08±4.48 After treatment 30.32±3.15 51.36±5.35** 49.71±2.98**

[0198] Note: ** indicates that after high-salt treatment, the anti-superoxide anion activity in the leaves of transgenic lemon lines was extremely significantly higher than that of wild-type lemon (P<0.01).

[0199] Table 20 Superoxide dismutase activity in leaves before and after high-salt stress (SOD activity, U g -1 FW)

[0200] WT STTM#5 STTM#6 Before treatment 229.38±55.76 268.79±26.89 256.96±29.57 After treatment 411.46±21.67 543.88±50.88* 553.34±62.97*

[0201] Note: * indicates that after high-salt treatment, the superoxide dismutase activity in the leaves of transgenic lemon lines was significantly higher than that of wild-type lemon (P<0.01).

[0202] Table 21 Peroxidase activity in leaves before and after high-salt stress (POD activity, U g -1 FW)

[0203] WT STTM#5 STTM#6 Before treatment 447.33±39.72 448.33±46.31 444.33±40.38 After treatment 547.67±43.52 686.67±61.17* 695.67±65.42*

[0204] Note: * indicates that after high-salt treatment, the peroxidase activity in the leaves of transgenic lemon lines was significantly higher than that of wild-type lemon (P<0.05).

[0205] Table 22 Catalase activity in leaves before and after high-salt stress (CAT activity, U mg -1 prot)

[0206] WT STTM#5 STTM#6 Before treatment 19.58±2.18 21.87±1.62 22.09±2.11 After treatment 25.98±2.47 32.39±1.00* 32.98±2.27*

[0207] Note: * indicates that after high-salt treatment, the catalase activity in the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P < 0.05).

[0208] The experimental results showed that:

[0209] Before the drought and high-salt stress treatments, there were no significant phenotypic differences between the wild-type lemon (WT) and the miR1134-silenced lemon lines (STTM#3 to STTM#6); after the drought and high-salt stress treatments, the wild-type lemon (WT) showed severe leaf curling and drooping, and the degree of leaf damage in the miR1134-silenced lemon lines was less than that of the wild-type ( Figure 3 in A and Figure 4 in A).

[0210] Before the drought and high-salt stress treatments, there were no significant differences in the stress resistance physiological indexes between the wild-type lemon (WT) and the miR1134-silenced lemon lines (STTM#3 to STTM#6); after the drought and high-salt stress treatments, the contents of malondialdehyde (MDA) and hydrogen peroxide (H2O2) in the leaves of the miR1134-silenced lemon lines were significantly lower (0.01 < P < 0.05) than those of the wild-type lemon, while the maximum photosynthetic efficiency (Fv / Fm) of photosystem II, the anti-superoxide anion (anti-O2 ·- ), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities in the leaves were significantly higher than those of the wild-type lemon ( Figure 3 in B - H and Figure 4 in B - H).

[0211] In summary, compared with the wild-type lemon, the miR1134-silenced lemon lines have stronger drought tolerance and salt tolerance.

[0212] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments can be obtained based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A miR1134 from Newhall navel orange, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. A precursor of miR1134 according to claim 1, wherein the nucleotide sequence is shown in SEQ ID NO:

2.

3. Use of the miR1134 described in claim 1 or the precursor of miR1134 described in claim 2 in regulating the stress resistance and / or leaf epidermal wax content of citrus plants.

4. The use according to claim 3, characterized in that: The regulation method is to interfere with the expression level of miR1134 to improve the stress resistance of citrus plants and / or the wax content of leaf epidermis; The stress resistance includes drought resistance and / or salt resistance.

5. A short tandem target mimicking molecule for inhibiting the expression level of miR1134 described in claim 1, characterized in that: The nucleotide sequence of the short tandem target mimicking molecule is shown in SEQ ID NO:

3.

6. A gene-derived product of the short tandem target mimicking molecule according to claim 5, comprising at least one of the following products: an expression cassette, a recombinant vector and a recombinant bacterium.

7. Use of the short tandem target mimicking molecule according to claim 5 or the gene-derived product according to claim 6 in improving the stress resistance and / or leaf epidermal wax content of citrus plants.

8. A method for improving the stress resistance and / or wax content of leaf epidermis of citrus plants, characterized in that: The short tandem target mimicking molecule of claim 5 or the gene-derived product of claim 6 is introduced into citrus plants.

9. A method for breeding stress-resistant citrus varieties and / or citrus varieties with high wax content on leaf epidermis, characterized in that: Detecting the expression level of miR1134 described in claim 1 in a citrus plant sample to be tested: Taking the wild type lemon as a reference, citrus plants with downregulated expression of miR1134 in the tested samples were selected as breeding materials for breeding; The stress resistance includes drought resistance and / or salt resistance.

10. The method according to claim 9, characterized in that: The detection reagent includes a forward primer miR1134-F whose nucleotide sequence is shown in SEQ ID NO:4 and a reverse primer miR1134-R whose nucleotide sequence is shown in SEQ ID NO:5.

Images