miR1134 and its short tandem target mimic molecules for regulating citrus peel wax content and citrus stress resistance, and their applications.

By using miR1134 derived from Newhall navel orange and short tandem target mimic molecules to regulate the wax content of citrus peel, the problem of insufficient miRNA regulation of citrus peel wax synthesis in existing technologies was solved, resulting in a significant improvement in the drought and salt tolerance of citrus.

CN120192967BActive Publication Date: 2026-04-03JIANGXI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

There is a lack of existing research on miRNA-mediated regulation of citrus peel wax synthesis to improve drought and salt tolerance, which hinders the progress of citrus breeding.

Method used

Using miR1134 and its short tandem target mimic molecules derived from Newhall navel orange, the expression level of miR1134 was negatively regulated to increase the wax content of citrus peel and enhance its drought and salt tolerance.

Benefits of technology

It significantly increased the wax content of citrus peel, enhanced the drought and salt resistance of citrus, manifested as higher leaf wax content, lower leaf water loss rate and chlorophyll leaching rate, and stronger physiological indicators such as photosynthetic efficiency and antioxidant enzyme activity under drought and high salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192967B_ABST
    Figure CN120192967B_ABST
Patent Text Reader

Abstract

This invention provides a miR1134 and its short tandem target mimic molecule for regulating the wax content of citrus peel and its stress resistance, and its applications, relating to the field of biotechnology. This invention provides a miR1134 derived from Newhall navel orange, with the nucleotide sequence shown in SEQ ID NO:1. This invention also provides a short tandem target mimic molecule for inhibiting miR1134 expression, with the nucleotide sequence shown in SEQ ID NO:3. This invention introduces the short tandem target mimic molecule into target plants using STTM technology, thereby increasing the wax content of citrus peel by inhibiting miR1134 expression, thus enhancing the drought and / or salt tolerance of citrus plants. This invention lays a theoretical foundation and provides high-quality gene resources for breeding new stress-resistant citrus varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a miR1134 that regulates the wax content of citrus peel and the stress resistance of citrus, its short tandem target mimic molecule, and its applications. Background Technology

[0002] Citrus is one of the main fruit trees cultivated in southern my country and has significant economic value. Currently, the citrus industry is primarily based on outdoor cultivation, and abiotic stresses in the natural climate severely limit the growth, development, yield, quality, and geographical distribution of citrus. The epidermal wax layer, covering the epidermis of citrus terrestrial organs, is a hydrophobic barrier that plays a crucial role in preventing abiotic water loss and is therefore closely related to citrus's resistance to abiotic stresses such as drought and high salinity. Therefore, utilizing modern genetic engineering breeding to increase the epidermal wax content of citrus, thereby improving its drought and salt tolerance, remains an important direction in breeding work.

[0003] The crucial role of plant miRNAs in posttranscriptional genetic regulation has been extensively studied and characterized in various plant species, including their role in regulating plant growth, development, and responses to biotic and abiotic stresses. However, reports on miRNA regulation of citrus peel wax synthesis, thereby enhancing its drought resistance, are scarce, hindering the breeding progress of drought- and salt-tolerant citrus. Summary of the Invention

[0004] In view of this, the present invention provides a miR1134 derived from Newhall navel orange, which enhances the drought and / or salt tolerance of citrus plants by negatively regulating the wax content of citrus peel.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a miR1134 derived from Newhall navel oranges, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] The present invention provides a precursor of miR1134, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0008] This invention provides the application of miR1134 or its precursor in regulating stress resistance and / or leaf epidermal wax content in citrus plants.

[0009] Preferably, the regulation method is to interfere with the expression level of miR1134 to improve the stress resistance and / or leaf epidermal wax content of citrus plants;

[0010] The stress resistance includes drought resistance and / or salt resistance.

[0011] The present invention provides a short tandem target mimic molecule to inhibit the expression level of miR1134, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0012] The present invention provides a gene-derived product of the short tandem target mimic molecule, comprising at least one of the following products: expression cassette, recombinant vector, and recombinant bacteria.

[0013] This invention provides the application of the short tandem target mimic molecule or the gene derivative in improving the stress resistance and / or leaf epidermal wax content of citrus plants.

[0014] This invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants by transferring the short tandem target mimic molecule or the gene-derived product into citrus plants.

[0015] This invention provides a method for breeding stress-resistant varieties of citrus and / or citrus varieties with high wax content in leaf epidermis, and for detecting the expression level of miR1134 in citrus plant samples:

[0016] Using wild-type lemon as a reference, citrus plants with downregulated miR1134 expression in the test samples were selected as breeding materials for breeding.

[0017] The stress resistance includes drought resistance and / or salt resistance.

[0018] Preferably, the detection reagent includes a forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO:4 and a reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO:5.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] This invention provides a miR1134 derived from Newhall navel orange, with its nucleotide sequence shown in SEQ ID NO:1. The miR1134 is a target for regulating the wax content of citrus peels. By negatively regulating this wax content, it enhances the drought and / or salt tolerance of citrus plants. One embodiment of this invention compared the wax content of leaves from plants expressing silent miR1134 with that from wild-type plants. The results showed that the total wax content, as well as the contents of fatty acids, aldehydes, primary alcohols, and alkanes, in detached leaves from plants expressing silent miR1134 were significantly higher than those from wild-type plants, while the leaf water loss rate and chlorophyll leaching rate were significantly lower. This invention further compared the drought and salt tolerance of plants expressing silent miR1134 with those of wild-type plants. The results showed that after drought and high salt stress treatment, wild-type plants exhibited severe leaf curling and drooping. Plants expressing silent miR1134 showed less leaf damage than wild-type plants, with significantly lower levels of malondialdehyde (MDA) and hydrogen peroxide (HPO) in their leaves. However, the maximum photosynthetic efficiency of photosystem II, resistance to superoxide anion, and activities of superoxide dismutase (SOD), peroxidase, and catalase were all significantly higher in plants than in wild-type plants. This invention enriches existing research in the field of miRNA and provides high-quality gene resources for breeding stress-resistant new citrus varieties.

[0021] This invention provides a short tandem target mimic molecule that inhibits the expression level of miR1134, the nucleotide sequence of which is shown in SEQ ID NO:3. This short tandem target mimic molecule can target the miR1134 sequence, effectively inhibiting the expression level of miR1134, thereby increasing the wax content of citrus peel and enhancing the drought and salt tolerance of citrus plants.

[0022] This invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants by transferring the short tandem target mimic molecule or its gene derivative into citrus plants. The method of this invention can inhibit the expression level of miR1134 and increase the epidermal wax content of citrus plants, thereby enhancing drought and salt tolerance. Attached Figure Description

[0023] Figure 1 The graph shows the relative expression levels of miR1134 in leaves of different lines (STTM#1, STTM#2, STTM#3, STTM#4, STTM#5, STTM#6) of wild-type lemon (WT) and miR1134 silencing expression line.

[0024] Figure 2Figure 1 shows the results of water loss rate, chlorophyll leaching rate and wax content of detached leaves of wild-type lemon and two miR1134 silent expression lemon lines (STTM#1, STTM#2); where A is the water loss rate, B is the chlorophyll leaching rate, C is the wax content of the leaves, and D and E are the contents of different carbon chains of the wax components in the leaves.

[0025] Figure 3 Figure 1 shows the phenotypic and stress resistance physiological indicators of wild-type lemon (WT) and two miR1134-silenced lemon lines (STTM#3, STTM#4) before and after drought stress. Figure 2 shows the phenotypic results before and after drought stress; Figure 3 shows the maximum photosynthetic efficiency (Fv / Fm) of leaves before and after drought stress (** indicates that the maximum photosynthetic efficiency of leaves in transgenic lemon lines was significantly higher than that in wild-type lemon after drought treatment (P<0.01); Figure 4 shows the malondialdehyde (MDA) content of leaves before and after drought stress (** indicates that the MDA content of leaves in transgenic lemon lines was significantly lower than that in wild-type lemon after drought treatment (P<0.05); Figure 5 shows the hydrogen peroxide (HPO) content of leaves before and after drought stress (** indicates that the HPO content of leaves in transgenic lemon lines was significantly lower than that in wild-type lemon after drought treatment (P<0.05)). 0.01); E represents the superoxide anion resistance activity of leaves before and after drought stress, * indicates that the superoxide anion resistance activity of transgenic lemon leaves was significantly higher than that of wild-type lemon after drought treatment (P<0.05); F represents the superoxide dismutase activity of leaves before and after drought stress, ** indicates that the superoxide dismutase activity of transgenic lemon leaves was extremely significantly higher than that of wild-type lemon after drought treatment (P<0.05); G represents the peroxidase activity of leaves before and after drought stress, * indicates that the peroxidase activity of transgenic lemon leaves was significantly higher than that of wild-type lemon after drought treatment (P<0.05); H represents the catalase activity of leaves before and after drought stress, * indicates that the catalase activity of transgenic lemon leaves was significantly higher than that of wild-type lemon after drought treatment (P<0.01).

[0026] Figure 4Figure 1 shows the phenotypic and stress resistance physiological indicators of wild-type lemon (WT) and two miR1134-silenced lemon lines (STTM#5, STTM#6) before and after high salt stress. Figure 2 shows the phenotypic results before and after drought stress; Figure 3 shows the maximum photosynthetic efficiency (Fv / Fm) of leaves before and after drought stress (* indicates that the maximum photosynthetic efficiency of transgenic lemon lines was significantly higher than that of wild-type lemon after high salt treatment (P<0.01); Figure 4 shows the malondialdehyde (MDA) content of leaves before and after drought stress (* indicates that the MDA content of transgenic lemon lines was significantly lower than that of wild-type lemon after high salt treatment (P<0.05); Figure 5 shows that the MDA content of transgenic lemon lines was significantly lower than that of wild-type lemon after high salt treatment (P<0.01); Figure 6 shows the hydrogen peroxide (HPO) content of leaves before and after drought stress (* indicates that the HPO content of transgenic lemon lines was significantly lower than that of wild-type lemon after high salt treatment (P<0.05)). 5); ** indicates that after high salt treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.01); E represents the superoxide anion resistance activity of leaves before and after drought stress; ** indicates that after high salt treatment, the superoxide anion resistance activity of leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.01); F represents the superoxide dismutase activity of leaves before and after drought stress; * indicates that after high salt treatment, the superoxide dismutase activity of leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.01); G represents the peroxidase activity of leaves before and after drought stress; * indicates that after high salt treatment, the peroxidase activity of leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.05); H represents the catalase activity of leaves before and after drought stress; * indicates that after high salt treatment, the catalase activity of leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.05). 。 Detailed Implementation

[0027] This invention provides a miR1134 derived from Newhall navel oranges, with the nucleotide sequence shown in SEQ ID NO:1 (AGAAGAAGAAGAAGAAGAUU).

[0028] The miR1134 described in this invention is a target for regulating the wax content of citrus peel. By negatively regulating the wax content of citrus peel, the drought resistance and / or salt resistance of citrus plants can be enhanced.

[0029] This invention provides a precursor of miR1134 as described in the above technical solution, with the nucleotide sequence as shown in SEQ ID NO:2(UUUUGACUGUGUUUUUUCUUUCUUUCUUUCUUUUGAUUAACU GUGGAUCAAAAUUAGUGUUUUAAGCUUUUACACAAUAGUGAUAAAUA AGAUAUUUGACAAAACAAAUUCUAAAAAAAACAUAUUUGACAAAAUUG CGAAAAAGA AG AAGAAGAAGAAGAAGAUU AUAGUUAUAG (where the underlined part is the miR1134 sequence) is shown.

[0030] In this invention, the nucleotide sequence of the DNA molecule used to encode the precursor of miR1134 is as shown in SEQ ID NO:6(TTTTGACTGTGTTTTTTCTTTCTTTCTTTTTCTTTTGATTAACTG TGGATCAAAATTAGTGTTTTAAGCTTTTACACAATAGTGATAAATAAGATAT TTGACAAAACAAATTCTAAAAAAAACATATTTGACAAAATTGCGAAAAAGAAGAAGAAGAAGAAGAAGATTATAGTTATAG).

[0031] This invention obtains a miR1134 silencing expression vector by using the short tandem target mimic (STTM) technology to obtain the DNA molecule encoding the precursor of miR1134. The miR1134 silencing expression vector is then introduced into citrus plants to inhibit the expression level of miR1134, thereby increasing the wax content of citrus peel and enhancing the drought resistance and / or salt resistance of citrus plants.

[0032] This invention provides the application of miR1134 or its precursor in regulating stress resistance and / or leaf epidermal wax content in citrus plants.

[0033] In this invention, the preferred method of regulation is to interfere with the expression level of miR1134 to improve the stress resistance and / or leaf epidermal wax content of citrus plants. The stress resistance preferably includes drought resistance and / or salt resistance. Drought resistance refers to the plant's ability to adapt to and resist drought. The drought preferably includes natural drought, more preferably 10–20 days without watering, more preferably 12–18 days without watering, and most preferably 15 days without watering. Salt resistance refers to the plant's tolerance to saline environments. The saline environment preferably includes salt water irrigation, more preferably irrigating the plants with 300 mmol / L NaCl. The irrigation frequency is preferably once every 3 days; the number of irrigations is preferably 4–6 times, more preferably 5 times; and the irrigation amount is preferably 80–120 mL per plant, more preferably 90–110 mL, and most preferably 100 mL.

[0034] One embodiment of the present invention compared the wax content of leaves from plants expressing silent miR1134 with that of wild-type plants. The results showed that the total wax content, as well as the contents of fatty acids, aldehydes, primary alcohols, and alkane components, in detached leaves of plants expressing silent miR1134 were significantly higher than those of wild-type plants, while the leaf water loss rate and chlorophyll leaching rate were significantly lower. The present invention further compared the drought resistance and salt tolerance of plants expressing silent miR1134 with those of wild-type plants. The results showed that after 15 days without watering or 15 days of irrigation with 300 mmol / L NaCl, wild-type plants exhibited severe leaf curling and drooping. The degree of leaf damage in plants expressing silent miR1134 was less than that in wild-type plants, and the contents of malondialdehyde and hydrogen peroxide in the leaves were significantly lower than those in wild-type plants. However, the maximum photosynthetic efficiency of photosystem II, resistance to superoxide anion, and the activities of superoxide dismutase, peroxidase, and catalase in the leaves were all significantly higher in plants expressing silent miR1134 than in wild-type plants. It is evident that, compared with wild-type plants, plants that silently express miR1134 have higher leaf wax content and stronger drought and salt tolerance.

[0035] This invention provides a short tandem target mimic molecule that inhibits the expression level of miR1134, the nucleotide sequence of which is shown in SEQ ID NO:3 (

[0036] The underlined part is the homologous recombination sequence on the pBI121 vector, the italic part is the reverse complementary sequence of the miR1134 sequence, the bold part is the introduced bridging sequence, and the lowercase part is the 48bp linker sequence in the middle.

[0037] In this invention, the short tandem target mimic molecule preferably employs short tandem target mimic (STTM) technology, which specifically inhibits the expression level of miR1134. A sequence is artificially synthesized that can complement the miR1134 sequence but cannot cleave the target gene. The short tandem target mimic molecule can inhibit the expression level of miR1134, thereby increasing the wax content of citrus peel and enhancing the drought and / or salt tolerance of citrus plants.

[0038] The present invention provides a gene-derived product of the short tandem target mimic molecule, comprising at least one of the following products: expression cassette, recombinant vector, and recombinant bacteria.

[0039] In this invention, the expression cassette preferably includes the short tandem target mimic molecule and a promoter. The promoter preferably includes a 2×35S promoter (d35S). The short tandem target mimic molecule is transcribed under the drive of the 2×35S promoter (d35S), and the transcription product can effectively suppress the expression level of miR1134.

[0040] In this invention, the backbone vector of the recombinant vector preferably includes the pBI121 vector. The pBI121 vector is preferably a d35S-pBI121 vector containing a 2×35S promoter. The preferred method for constructing the d35S-pBI121 vector is to insert a 35S gene fragment into the multiple cloning sites of Xba I and BamH I in the pBI121 vector. The 35S gene fragment is preferably amplified using primers with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10, using the pBI121 vector plasmid as a template. In an embodiment of this invention, the short tandem target mimic molecule is inserted into the multiple cloning sites of Sac I and BamH I in the d35S-pBI121 vector to obtain the recombinant vector (STTM1134). This invention does not impose any special limitations on the construction method of the recombinant vector; any commonly used recombinant vector construction method in the art can be used.

[0041] In this invention, the recombinant bacteria preferably contain the recombinant vector. The host bacteria of the recombinant vector preferably include Agrobacterium. The strain of Agrobacterium preferably includes Agrobacterium strain GV3101. The recombinant bacteria inhibit the expression level of miR1134 in citrus plants by infecting them, thereby increasing the wax content of citrus leaf epidermis and enhancing the drought and salt tolerance of citrus plants.

[0042] This invention provides the application of the aforementioned short tandem target mimic molecules or the aforementioned gene-derived products in improving the stress resistance and / or leaf epidermal wax content of citrus plants. The stress resistance includes drought resistance and / or salt tolerance.

[0043] This invention provides a method for improving the stress resistance and / or leaf epidermal wax content of citrus plants by transferring the short tandem target mimic molecule or the gene-derived product into citrus plants.

[0044] In this invention, the stress resistance includes drought resistance and / or salt resistance. The method of introduction preferably includes Agrobacterium-mediated transformation. The Agrobacterium preferably includes Agrobacterium GV3101. The site of Agrobacterium infection during introduction is preferably a stem segment. After introduction, positive plants are preferably selected by plate culture. The plate selection medium is MS solid medium + indolebutyric acid 0.5 mg / L + cephalosporin 500 mg / L + kanamycin 50 mg / L. After plate selection, the plants are preferably transferred to rooting medium, preferably 1 / 2 MS solid medium + 0.1 mg / L naphthaleneacetic acid + 1 g / L activated carbon, pH 5.8. After rooting culture, regenerated plants are preferably obtained through hardening-off. The regenerated plants are preferably molecularly identified. The primers for molecular identification preferably include the forward primer miR1134-F with the nucleotide sequence shown in SEQ ID NO:4 and the reverse primer miR1134-R with the nucleotide sequence shown in SEQ ID NO:5. This invention transfers the short tandem target mimic molecules or the gene-derived products into citrus plants, which can effectively regulate the drought and salt tolerance of citrus.

[0045] This invention provides a method for breeding stress-resistant varieties of citrus and / or varieties with high wax content in leaf epidermis, and for detecting the expression level of miR1134 in citrus samples:

[0046] Using wild-type lemon as a reference, citrus plants with downregulated miR1134 expression in the test samples were selected as breeding materials for breeding.

[0047] The stress resistance includes drought resistance and / or salt resistance.

[0048] In this invention, the detection reagent preferably includes a forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO:4 and a reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO:5.

[0049] In this invention, the citrus plants preferably include at least one of the following categories: citrus, mandarin, pomelo, and lemon, and more preferably include at least one of the following: sweet orange, pomelo, mandarin, citrus, citron, lemon, and kumquat.

[0050] This invention compared the wax content and stress resistance of wild lemons and lemons with downregulated miR1134 expression levels compared to wild-type lemons. The results showed that, compared to wild-type plants, lemons with downregulated miR1134 expression levels had higher leaf wax content, stronger drought resistance, and salt tolerance. Therefore, the method of this invention can be used to breed stress-resistant varieties of citrus and / or varieties with high leaf epidermal wax content.

[0051] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a miR1134 and its short tandem target mimic molecules for regulating the wax content of citrus peel and the stress resistance of citrus, as well as their applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0052] Example 1

[0053] Methods for extracting the precursor sequence of miR1134 from DNA molecules

[0054] (1) Extraction of plant genomic DNA

[0055] DNA was extracted from Newhall navel orange leaves using a plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). Detailed steps are described in the instruction manual.

[0056] (2) PCR amplification

[0057] Using the genomic DNA extracted in step (1) as a template, PCR reactions were performed according to the system described in Table 1:

[0058] Table 1. PCR amplification system (50 μL)

[0059]

[0060]

[0061] Upstream primer F: 5'-TTTTGACTGTGTTTTTTC-3' (SEQ ID NO:7);

[0062] Downstream primer R: 5'-CTATAACTATAATCTTCT-3' (SEQ ID NO:8).

[0063] The PCR amplification procedure is described in the instruction manual of the ultra-fidelity PCR mix used (Beijing Kangrun Chengye Biotechnology Co., Ltd.).

[0064] The amplified target fragment was separated by 1.5% agarose gel electrophoresis, yielding a band with a molecular weight of approximately 176 bp. The gel block containing the target gene was cut off with a clean blade on a UV projection cutting stage and placed into a 2 mL centrifuge tube. The product was recovered using an agarose gel DNA recovery kit (Tiangen Biotech (Beijing) Co., Ltd.).

[0065] (3) Ligation and transformation of the target fragment to the sequencing vector

[0066] The target fragment was ligated to the sequencing vector using the pClone007 BluntVectorKit kit (Beijing Qingke Biotechnology Co., Ltd.). The ligation product was then transformed into *E. coli* Trans5α competent cells (Beijing TransGen Biotechnology Co., Ltd.). Detailed steps are described in the instruction manual. Single colonies were picked for colony PCR detection, using the same primers, system, and procedure as in step (2). Positive colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0067] Example 2

[0068] Construction method of miR1134 silencing expression vector

[0069] The silencing expression of miR1134 employs short tandem target mimic (STTM) technology, which can specifically inhibit a specific miRNA. This involves artificially synthesizing a sequence that is complementary to the mature sequence of a specific miRNA but cannot cleave the target gene. Transcription is then performed under the drive of a 2×35S promoter (d35S), and the transcription product can effectively inhibit the expression level of the miRNA.

[0070] (1) Design of short tandem target-mimicking molecular sequences

[0071] First, the two mature sequences of miR1134 were reverse-complemented. Then, three bases "ACG" were added between the 10th and 11th bases of miR1134 at its cleavage site. Next, a 48bp sequence capable of forming a hairpin structure was used to connect these two fragments. Finally, 22bp sequences located upstream and downstream of the BamHI and SacI restriction sites on the pBI121 vector were added to the 5' and 3' ends of the entire sequence, respectively, to facilitate subsequent homologous recombination. The final designed short tandem target mimic molecule sequence is as follows:

[0072]

[0073] (SEQ ID NO:3)

[0074] The underlined portion represents the homologous recombination sequence on the pBI121 vector, the italicized portion represents the reverse complementary sequence of the miR1134 sequence, the bold portion represents the introduced bridging sequence, and the lowercase portion represents the 48 bp connecting sequence. Sangon Biotech (Shanghai) Co., Ltd. synthesized short tandem target mimic molecules based on these sequences.

[0075] (2) Construction of the d35S-pBI121 vector

[0076] Amplification primers were designed based on the 35S sequence of the pBI121 vector, and Xba I and BamHI restriction sites and protective bases were added to the 5' ends of the primers, respectively. The primer sequences are as follows:

[0077] Upstream primer F-35S: 5'-ATGCTCTAGAAGATTAGCCTTTTCAATTTCAG-3' (SEQ ID NO: 9);

[0078] Downstream primer R-35S: 5'-CGCGGATCCCGTGTTCTCTCCAAATGAAATG-3' (SEQ ID NO:10).

[0079] Using pBI121 vector plasmid as a template, the 35S sequence was amplified using the ultra-fidelity PCR mix system. The amplified product was separated by 1% agarose gel electrophoresis, recovered from the gel, and ligated into the sequencing vector. The product was then transformed into E. coli Trans5α competent cells, and single clones were picked for PCR detection. Positive colonies were sent to a biotechnology company for sequencing (method as described in Example 1).

[0080] The plasmids of the above positive colonies were extracted using a plasmid miniprep kit (Tiangen Biotech (Beijing) Co., Ltd.), and double-digested with the pBI121 empty vector using Xba I and BamHI, respectively. The digestion system is as follows:

[0081] Table 2. Reaction system for enzyme digestion (50 μL)

[0082] Element volume plasmid DNA 25μL <![CDATA[10×FuniCut TM Buffer]]> 5μL XbaI 2.5μL BamHI 2.5μL <![CDATA[ddH2O]]> 15μL total 50μL

[0083] The restriction enzyme digestion procedure is as per the instructions of the rapid restriction endonuclease used (Yisheng Biotechnology (Shanghai) Co., Ltd.). The products after double digestion were separated by 1% agarose gel electrophoresis. The 35S fragment and the linear pBI121 vector were recovered. The two recovered fragments were then ligated according to the system in Table 3.

[0084] Table 3. Connection reaction system (10 μL)

[0085]

[0086]

[0087] Connect at 16℃ for 16 hours.

[0088] The ligation product was transformed into *E. coli* Trans5α competent cells, and single clones were selected. A pair of primers was designed before and after the expected d35S phase.

[0089] Upstream primer F-d35S: 5'-TATGCTTCCGGCTCGTATG-3' (SEQ ID NO:11);

[0090] Downstream primer R-d35S: 5'-ATCCAGACTGAATGCCCAC-3' (SEQ ID NO:12).

[0091] PCR detection was performed using the primers described above, and positive colonies were selected and sent to a biotechnology company for sequencing (method as described in Example 1). The positive clones that were verified to be accurate by sequencing were then revived, and plasmids were extracted.

[0092] (3) Construction of miR1134 silencing expression vector

[0093] After the short tandem target mimic molecule synthesized in step (1) was linked to the pUC19 vector, it was transformed into Escherichia coli. Single colonies were picked and PCR was performed using universal primer M13 to obtain positive bacterial solutions.

[0094] Upstream primer M13-F: TGTAAAACGACGGCCAGT (SEQ ID NO:13);

[0095] Downstream primer M13-R: CAGGAAACAGCTATGACC (SEQ ID NO:14).

[0096] Design a pair of amplification primers based on the designed short tandem target simulated molecular sequence:

[0097] Upstream primer F-STTM: 5'-ATTTGGAGAGAACACGGGATC-3' (SEQ ID NO:15);

[0098] Downstream primer R-STTM: 5'-CGATCGGGGAAATTCGAG-3' (SEQ ID NO:16).

[0099] Using the above-mentioned positive bacterial culture as a template, the short tandem target mimic molecular sequence was amplified using the ultra-fidelity PCR mix system. The amplified product was separated by 1% agarose gel electrophoresis, and the gel was recovered and stored for later use. The d35S-pBI121 vector obtained in step (2) was double-digested with Sac I and BamHI. The double-digested product was separated by 1% agarose gel electrophoresis, and the linear d35S-pBI121 vector was recovered. The recovered short tandem target mimic molecular sequence was ligated to the linear d35S-pBI121 vector, and the ligation product was transformed into E. coli. PCR detection was performed using the above primers, and positive colonies were selected and sent to a biotechnology company for sequencing. The positive plasmid with correct sequencing was named STTM1134.

[0100] (4) Agrobacterium-mediated transformation of STTM1134

[0101] Transform the constructed vector STTM1134 into Agrobacterium GV3101 (Shanghai Weidi Biotechnology Co., Ltd.). For detailed steps, please refer to the instruction manual. Pick a single colony and perform PCR detection using the primers from step (3). Add 20% glycerol to the positive bacterial solution and mix well. The resulting bacterial solution is the Agrobacterium strain containing the STTM1134 vector plasmid. Store it at -80℃ for later use.

[0102] Example 3

[0103] Preparation method of transgenic lemon with silent miR1134 expression

[0104] (1) Sowing

[0105] Seeds were extracted from lemon fruits, washed with double-distilled water, and dried. The seed coats were then removed from the dried seeds. The seeds were then soaked in 75% ethanol for 40-60 seconds on a clean bench, followed by sterilization with 1% sodium hypochlorite for 20 minutes. They were then washed four times with sterile water, and a cross was made on each seed with a sterile blade. The treated seeds were sown on sterile MS solid medium (Qingdao Haibo Biotechnology Co., Ltd.) on a clean bench and cultured in the dark at 26±2℃ for approximately 25 days. When the yellowed epicotyl reached approximately 20 cm in length, they were cultured in light (16 h light / 8 h dark) for approximately 7 days. Seedlings with a diameter of approximately 1.5–2.0 mm were selected as transgenic explants, and their epicotyls were obliquely cut into internode segments approximately 1 cm long for later use.

[0106] (2) Preparation of Agrobacterium infection solution

[0107] Agrobacterium containing the STTM1134 vector plasmid, stored at -80℃, was transferred to YEB liquid medium (Beijing Solarbio Science & Technology Co., Ltd.) containing 50 mg / L kanamycin and 20 mg / L rifampin. The medium was cultured at 28℃ and 200 rpm with shaking until the OD600 of the bacterial culture reached approximately 1.0. After further expansion culture, the OD600 was reduced to approximately 0.7. After centrifugation, the supernatant was discarded, and the bacterial cells were resuspended in MS liquid medium (MS liquid medium + 2.5 mg / L 6-benzylaminopurine + 0.5 mg / L indolebutyric acid + 100 μmol / L acetylsylgenone). The culture was then cultured at 28℃ and 200 rpm for 30 min with shaking before being used for infection.

[0108] (3) Stem segment transformation

[0109] The prepared stem segments were immersed in Agrobacterium infection solution for 15 min. After blotting the bacterial cells on the stem tip with sterile filter paper, they were placed horizontally on co-culture medium (MS solid medium + 2.5 mg / L 6-benzylaminopurine + 0.5 mg / L indolebutyric acid + 100 μmol / L acetylsyringone) and incubated in the dark at 28°C for 3 days. The stem segments on the co-culture medium were blotted dry with sterile filter paper and then placed horizontally on selection medium (MS solid medium + 0.5 mg / L indolebutyric acid + 500 mg / L cephalosporin + 50 mg / L kanamycin) for resistance selection and shoot induction. The culture was continued until the new shoots grew to about 1 cm, with subculture every 20 days. When the new shoots grew to about 1 cm in height, the small shoot clusters were cut off, and the morphological lower end was inserted into rooting medium (1 / 2 MS solid medium + 0.1 mg / L naphthaleneacetic acid + 1 g / L activated carbon, pH 5.8) for rooting culture. After the regenerated lemon plants have rooted, remove the sealing film from the tissue culture bottle to harden them off for 1-2 days. Then, remove the regenerated plants from the culture medium and rinse the roots with tap water to wash away any residual agar. Next, transplant them into nutrient pots filled with potting soil, covering the pot opening with breathable sealing film. After about 14 days, remove the sealing film and continue growing them in a culture room (25℃, 16h light / 8h darkness, 80% relative humidity).

[0110] (4) Identification of positive lemon transformants

[0111] Lemon leaves were placed in a 2mL centrifuge tube, and an appropriate amount of liquid nitrogen was added. The leaves were then ground using a 1mL pipette tip pre-cooled with liquid nitrogen and with the end flattened. DNA was extracted from the leaves using the CTAB method, as follows:

[0112] ① Add 650 μL of 2×CTAB extraction buffer: β-mercaptoethanol (Beijing Solarbio Science & Technology Co., Ltd.) (volume ratio 99:1) mixture to a 2 mL centrifuge tube containing the sample, shake to mix, and place in a 65℃ water bath for 60 min;

[0113] ② Add 650 μL of chloroform:isoamyl alcohol (Xilong Scientific Co., Ltd.) (volume ratio 24:1), extract for 2-3 min, mix well, and centrifuge at 12000 rpm for 5 min;

[0114] ③ Pipette about 600 μL of supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol (Xilong Scientific Co., Ltd.), mix by inverting, let stand for 10 min, and centrifuge at 12000 rpm for 2 min.

[0115] ④ Remove the supernatant, add 900 μL of 75% ethanol, mix by inverting, centrifuge at 12000 rpm for 1 min, and remove the supernatant.

[0116] ⑤ The precipitate was treated with a rotary evaporator under V-AL conditions for 10 min;

[0117] ⑥ Add 50 μL of ddH2O to the centrifuge tube and place it in a refrigerator at 4°C overnight.

[0118] Primers were designed based on the 35S sequence on the STTM1134 vector:

[0119] Upstream primer 35S-F: 5'-TAACAGAACTCGCCGTAAAGAC-3' (SEQ ID NO:17);

[0120] Downstream primer R-STTM: 5'-CGATCGGGGAAATTCGAG-3' (SEQ ID NO:16).

[0121] Using the extracted DNA as a template, PCR amplification was performed to identify positive lemon transformed plants. The PCR system was halved, and the procedure was the same as step (2) in Example 1.

[0122] (5) Identification of miR1134 expression level in leaves of positive transgenic lemon lines

[0123] The expression level of miR1134 in leaves of wild-type lemon and positive transgenic lemon lines was detected by real-time quantitative PCR (qPCR). Total RNA was first extracted from leaves of wild-type and transgenic lemons using a total RNA extraction kit (Promega (Beijing) Biotechnology Co., Ltd.), detailed according to the manufacturer's instructions. miRNA stem-loop primers were designed based on the miRNA first-strand cDNA synthesis (stem-loop method) kit (Sangon Biotech (Shanghai) Co., Ltd.) instructions and the mature miR1134 sequence to synthesize cDNA. The primer sequence was: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAATC TT-3' (SEQ ID NO:18). Then, qPCR was performed using a miRNA quantitative PCR kit (dye method) (Sangon Biotech (Shanghai) Co., Ltd.), following the manufacturer's instructions. The qPCR primer sequences are as follows:

[0124] Upstream primer miR1134-F: 5'-CGTCGCGAGAAGAAGAAGAAG-3' (SEQ ID NO:4);

[0125] Downstream primer miR1134-R: 5'-AGTGCAGGGTCCGAGGTATT-3' (SEQ ID NO:5).

[0126] Using the U6 gene as an internal control, the U6 primer sequence is as follows:

[0127] Upstream primer U6-F: 5'-TTGGGACGATACACAGAAAATTAG-3' (SEQ ID NO:19);

[0128] Downstream primer U6-R: 5'-GATTTGTGCGTGTCATTCCTGTC-3' (SEQ ID NO:20).

[0129] qPCR results showed that the expression level of miR1134 in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons. Figure 1 (and Table 4).

[0130] Table 4. Expression levels of miR1134

[0131] genotype relative expression level WT 1.01±0.17 STTM#1 0.18±0.03** STTM#2 0.29±0.04** STTM#3 0.31±0.08** STTM#4 0.23±0.02** STTM#5 0.26±0.06** STTM#6 0.34±0.07**

[0132] Note: ** indicates that the relative expression level in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.01).

[0133] Example 4

[0134] Silent expression of miR1134 increases the wax content of transgenic lemon leaf epidermis.

[0135] (1) Detection of leaf water loss rate and chlorophyll permeability

[0136] Wild-type (WT) and two transgenic lemon lines (STTM#1 and STTM#2) were placed in the dark for 12 hours. Leaves were cut and weighed immediately. The leaves were placed in the dark and weighed every 1 hour at room temperature (0-8 hours). The water loss rate was equal to the ratio of the leaf weight loss at a certain time point to the initial fresh weight of the leaf. Each treatment was set up with 3-5 replicates, and the experiment was repeated 3 times.

[0137] Wild-type and two transgenic lemon lines were placed in darkness for 12 hours. Leaves were cut and immediately immersed in 50 mL of 80% ethanol solution (v / v) in glass tubes. The absorbance of the leachate was measured at 2, 4, 6, 8, 10, 12, and 24 hours. The entire procedure was performed under low light conditions. The absorbance of the leachate at 647 nm and 664 nm was measured using a UV spectrophotometer. The total chlorophyll micromolar amount (M) in the leachate was calculated as 7.93(A664) + 19.53(A647). The chlorophyll leaching rate at each time point was calculated using the 24-hour chlorophyll leaching amount as a reference.

[0138] (2) Leaf wax composition analysis (GC-FID)

[0139] GC-FID was used to determine the waxy components and content on the surface of leaves of transformed plants. Leaves of the same age and size from wild-type and transgenic lemon lines were placed in 20 mL gas chromatograph vials. During extraction, 10 mL of chromatographically pure n-hexane was added twice consecutively, shaken for 30 s, and then the n-hexane solutions were combined into a new 20 mL vial. Samples could be processed immediately or stored long-term at 4°C. Using a precision pipette tip, 100 μL of 50 μg / mL n-tetracosane was added to the sample as an internal standard, and the mixture was shaken to mix. Under nitrogen evaporation at 50°C, the n-hexane solvent was dried using nitrogen gas, and then 50 μL of the derivatization reagent BSTFA was added, shaken to mix, and derivatized at 100°C for 15-30 min. After the derivatization vial cooled to room temperature, an appropriate volume of n-hexane was added, and the sample was shaken to dissolve. Finally, the sample was transferred to a GC loading vial for analysis.

[0140] An Agilent 8890 gas chromatograph with a DB-5 column was used. The method for measuring leaf wax content was as follows: Carrier gas: helium, constant flow mode, 1 mL / min. Detector: Flame ionization detector (FID), 300℃; Air:H2:He = 400:30:25. Injector: 300℃, splitless mode, injection volume 1 μL. Column temperature program: Initially, hold at 80℃ for 2 min, then increase to 200℃ at 40℃ / min, hold for 2 min. Next, increase to 270℃ at 10℃ / min, hold for 2 min. Finally, increase to 320℃ at 2℃ / min, hold for 10 min. Each peak was quantified using an internal standard and qualitatively analyzed using standards.

[0141] Experimental results show that:

[0142] Water loss rate of detached leaves of lemon (STTM#1, STTM#2) with miR1134 silent expression lines ( Figure 2 The chlorophyll leaching rate (as shown in Tables A and 5) was significantly lower than that of wild-type lemon (WT). Figure 2 (See Table B and Table 6).

[0143] Table 5. Water loss rate of detached leaves (%)

[0144] time WT STTM#1 STTM#2 0h 0.00±0.00 0.00±0.00 0.00±0.00 1h 16.64±0.21 13.71±0.55** 12.84±0.13** 2h 19.69±0.39 16.31±0.07** 15.56±0.23** 3h 20.38±0.23 17.04±0.30** 16.49±0.42** 4h 21.07±0.10 17.71±0.25** 17.10±0.60** 5h 21.59±0.04 18.18±0.23** 17.63±0.46** 6h 21.88±0.08 18.51±0.42** 17.93±0.74**

[0145] Note: ** indicates that the water loss rate of leaves of transgenic lemon lines was significantly lower than that of wild-type lemons (P<0.01).

[0146] Table 6 Chlorophyll leaching rate (%) from detached leaves

[0147] time WT STTM#1 STTM#2 0h 0.00±0.00 0.00±0.00 0.00±0.00 2h 24.74±1.20 22.49±1.33 23.34±1.46 4h 36.42±1.45 35.58±2.85 35.97±4.35 6h 43.80±1.91 39.96±0.18 39.52±2.71 8h 55.79±2.20 47.39±0.69* 44.28±1.15** 10h 62.06±2.03 56.34±1.35* 55.97±1.70* 12h 68.71±0.73 63.27±0.88** 62.71±1.73*

[0148] Note: * indicates that the chlorophyll leaching rate of the leaves of the transgenic lemon line was significantly lower than that of the wild-type lemon (P<0.05); ** indicates that the chlorophyll leaching rate of the leaves of the transgenic lemon line was extremely significantly lower than that of the wild-type lemon (P<0.01).

[0149] GC-FID wax content analysis showed that the total wax content of leaves from the miR1134 silent expression lines (STTM#1 and STTM#2) was significantly higher than that of wild-type lemons. The main components of lemon leaf wax were fatty acids, aldehydes, primary alcohols, and alkanes, and their contents in the leaves of the miR1134 silent expression lines were all significantly higher than those in wild-type lemons. Figure 2(See Table 7). The contents of C24-C28 fatty acids, C28-C30 aldehydes, C26-C32 primary alcohols, and C27-C33 alkane components in transgenic lemon leaves were significantly higher than those in wild-type lemons. Figure 2 (See Tables D, E, and 8).

[0150] Table 7. Wax component content of leaves (μg dm³) -2 )

[0151]

[0152] Note: ** indicates that the wax content of leaves of transgenic lemon lines is significantly higher than that of wild-type lemons (P<0.01).

[0153] Table 8. Content of different carbon chains in the waxy components of leaves (μg dm) -2 )

[0154]

[0155] Note: * indicates a significant difference in carbon chain content between the waxy components of transgenic lemon leaves and wild-type lemon leaves (P<0.05); ** indicates an extremely significant difference in carbon chain content between the waxy components of transgenic lemon leaves and wild-type lemon leaves (P<0.01).

[0156] The results above indicate that silencing miR1134 expression can significantly increase the total wax content and the content of fatty acids, aldehydes, primary alcohols and alkane components in lemon leaves.

[0157] Example 5

[0158] Silencing miR1134 expression enhances drought and salt tolerance in transgenic lemons.

[0159] (1) Drought and high salt stress treatment

[0160] Wild-type lemons (WT) with uniform growth and four transgenic lemon lines (STTM#3 to STTM#6) were selected and subjected to drought (STTM#3 and STTM#4) and high-salt (STTM#5 and STTM#6) treatments, respectively.

[0161] Drought soil culture treatment: Wild-type lemons and two transgenic lemon lines (STTM#3 and STTM#4) were subjected to natural drought (no watering) for 15 days, and then photographs and stress resistance physiological indicators were tested.

[0162] High-salt soil cultivation treatment: Wild-type and transgenic lemons were simultaneously irrigated with 300 mmol / L NaCl, 100 mL per tree each time, once every 3 days, for a total of 15 days. Phenotypic photos and stress resistance physiological indicators were then measured.

[0163] (2) Maximum photosynthetic efficiency (Fv / Fm) of leaf photosystem II, malondialdehyde (MDA) and hydrogen peroxide (H2O2) content, and resistance to superoxide anion (anti-O2). ·- Determination of the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT)

[0164] Fv / Fm ratios in lemon leaves of two genotypes before and after drought and high-salt treatments were measured using a chlorophyll fluorometer (PAM-2000, Germany), along with MDA, H2O2 content and anti-O2 levels. ·- The activity assays for SOD, POD, and CAT used MDA (A003), H2O2 (A064), and anti-O2 produced by Nanjing Jiancheng Bioengineering Institute. ·- The detection kits for (A052), SOD (A001), POD (A084), and CAT (A007) were used for testing. Detailed procedures are described in the instruction manual. Experimental results are shown below. Figures 3-4 See Tables 9 to 22.

[0165] Table 9. Maximum photosynthetic efficiency of leaves before and after drought stress (Fv / Fm)

[0166] WT STTM#3 STTM#4 Before processing 0.82±0.01 0.81±0.01 0.81±0.01 After processing 0.53±0.06 0.69±0.03* 0.70±0.02*

[0167] Note: ** indicates that after drought treatment, the maximum photosynthetic efficiency of the leaves of the transgenic lemon line was significantly higher than that of the wild-type lemon (P<0.01).

[0168] Table 10. Malondialdehyde (MDA) content in leaves before and after drought stress (nmol mg) -1 prot)

[0169] WT STTM#3 STTM#4 Before processing 4.35±0.44 4.27±0.51 4.14±0.48 After processing 8.43±0.31 5.84±0.57** 5.91±0.78**

[0170] Note: ** indicates that after drought treatment, the malondialdehyde content in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.05).

[0171] Table 11 Hydrogen peroxide content (H2O2 content, mmol g) in leaves before and after drought stress -1 prot)

[0172] WT STTM#3 STTM#4 Before processing 55.68±3.42 58.75±1.19 56.21±5.04 After processing 181.74±10.60 112.59±12.97** 111.87±13.39**

[0173] Note: ** indicates that after drought treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.01).

[0174] Table 12. Anti-superoxide anion activity of leaves before and after drought stress (Anti-O2) - Activity, U g-1 prot)

[0175] WT STTM#3 STTM#4 Before processing 56.43±5.87 59.66±8.69 57.78±6.62 After processing 71.93±7.85 99.14±9.48* 101.13±9.65*

[0176] Note: * indicates that after drought treatment, the superoxide anion resistance activity of the leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.05).

[0177] Table 13 Superoxide dismutase (SOD) activity (U g) in leaves before and after drought stress -1 FW)

[0178] WT STTM#3 STTM#4 Before processing 90.43±15.91 122.23±23.82 104.56±19.23 After processing 323.58±31.89 471.24±36.05** 491.02±32.17**

[0179] Note: ** indicates that after drought treatment, the superoxide dismutase activity in the leaves of transgenic lemon lines was significantly higher than that in wild-type lemons.

[0180] (P<0.05)

[0181] Table 14 Peroxidase activity (POD activity, U g) in leaves before and after drought stress -1 FW)

[0182] WT STTM#3 STTM#4 Before processing 457.00±43.31 449.67±44.46 460.67±59.54 After processing 531.33±46.69 666.33±52.00* 676.67±61.71*

[0183] Note: * indicates that after drought treatment, the peroxidase activity in the leaves of transgenic lemon lines was significantly higher than that in wild-type lemons (P<0.05).

[0184] Table 15. Catalase activity (CAT activity, U mg) in leaves before and after drought stress. -1 prot)

[0185] WT STTM#3 STTM#4 Before processing 18.54±1.41 20.71±1.56 21.89±2.00 After processing 24.90±2.97 35.67±3.38* 37.28±4.62*

[0186] Note: * indicates that after drought treatment, the catalase activity in the leaves of transgenic lemon lines was significantly higher than that in wild-type lemons (P<0.01).

[0187] Table 16 Maximum photosynthetic efficiency of leaves before and after high salt stress (Fv / Fm)

[0188] WT STTM#5 STTM#6 Before processing 0.84±0.01 0.84±0.01 0.84±0.01 After processing 0.30±0.09 0.55±0.10* 0.55±0.07*

[0189] Note: * indicates that after high salt treatment, the maximum photosynthetic efficiency of the leaves of the transgenic lemon line was significantly higher than that of the wild-type lemon (P<0.01).

[0190] Table 17 Malondialdehyde (MDA) content in leaves before and after high salt stress (nmol mg) -1 prot)

[0191] WT STTM#5 STTM#6 Before processing 4.27±0.69 4.63±1.00 4.47±1.09 After processing 7.32±0.66 5.17±0.70* 4.83±0.41**

[0192] Note: * indicates that after high salt treatment, the malondialdehyde content in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.05); ** indicates that after high salt treatment, the malondialdehyde content in the leaves of transgenic lemon lines was significantly, extremely, lower than that in wild-type lemons (P<0.01).

[0193] Table 18 Hydrogen peroxide content (H2O2 content, mmol g) in leaves before and after high salt stress -1 prot)

[0194] WT STTM#5 STTM#6 Before processing 49.95±3.29 42.56±8.24 41.74±6.05 After processing 114.64±9.57 82.17±8.17* 84.64±4.63**

[0195] Note: * indicates that after high salt treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was significantly lower than that in wild-type lemons (P<0.05); ** indicates that after high salt treatment, the hydrogen peroxide content in the leaves of transgenic lemon lines was extremely significantly lower than that in wild-type lemons (P<0.01).

[0196] Table 19. Anti-superoxide anion activity of leaves before and after high salt stress (Anti-O2) - Activity, U g -1 prot)

[0197] WT STTM#5 STTM#6 Before processing 25.68±3.73 30.30±2.26 28.08±4.48 After processing 30.32±3.15 51.36±5.35** 49.71±2.98**

[0198] Note: ** indicates that after high salt treatment, the superoxide anion resistance activity of the leaves of transgenic lemon lines was significantly higher than that of wild-type lemons (P<0.01).

[0199] Table 20 Superoxide dismutase (SOD) activity (U g) in leaves before and after high salt stress -1 FW)

[0200] WT STTM#5 STTM#6 Before processing 229.38±55.76 268.79±26.89 256.96±29.57 After processing 411.46±21.67 543.88±50.88* 553.34±62.97*

[0201] Note: * indicates that after high salt treatment, the superoxide dismutase activity in the leaves of transgenic lemon lines was significantly higher than that in wild-type lemons (P<0.01).

[0202] Table 21 Peroxidase activity (POD activity, U g) in leaves before and after high salt stress -1 FW)

[0203] WT STTM#5 STTM#6 Before processing 447.33±39.72 448.33±46.31 444.33±40.38 After processing 547.67±43.52 686.67±61.17* 695.67±65.42*

[0204] Note: * indicates that after high salt treatment, the peroxidase activity in the leaves of transgenic lemon lines was significantly higher than that in wild-type lemons (P<0.05).

[0205] Table 22 Catalase activity (CAT activity, U mg) in leaves before and after high salt stress -1 prot)

[0206] WT STTM#5 STTM#6 Before processing 19.58±2.18 21.87±1.62 22.09±2.11 After processing 25.98±2.47 32.39±1.00* 32.98±2.27*

[0207] Note: * indicates that after high-salt treatment, the catalase activity in the leaves of the transgenic lemon lines was significantly higher than that of the wild-type lemon (P < 0.05).

[0208] The experimental results showed that:

[0209] Before drought and high-salt stress treatments, there were no significant phenotypic differences between the wild-type lemon (WT) and the miR1134-silenced lemon lines (STTM#3 to STTM#6); after drought and high-salt stress treatments, the wild-type lemon (WT) showed severe leaf curling and drooping, and the leaf damage of the miR1134-silenced lemon lines was less than that of the wild-type ( Figure 3 in A and Figure 4 in A).

[0210] Before drought and high-salt stress treatments, there were no significant differences in the stress resistance physiological indexes between the wild-type lemon (WT) and the miR1134-silenced lemon lines (STTM#3 to STTM#6); after drought and high-salt stress treatments, the contents of malondialdehyde (MDA) and hydrogen peroxide (H2O2) in the leaves of the miR1134-silenced lemon lines were significantly lower (0.01 < P < 0.05) than those of the wild-type lemon, while the maximum photosynthetic efficiency (Fv / Fm) of photosystem II, the anti-superoxide anion (anti-O2 ·- ), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities in the leaves were significantly higher than those of the wild-type lemon ( Figure 3 in B-H and Figure 4 in B-H).

[0211] In summary, compared with the wild-type lemon, the miR1134-silenced lemon lines have stronger drought tolerance and salt tolerance.

[0212] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments, and other embodiments can be obtained according to these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A miR1134 derived from Newhall navel oranges, characterized in that, The nucleotide sequence is shown in SEQ ID NO:

1.

2. A precursor of miR1134 according to claim 1, the nucleotide sequence of which is shown in SEQ ID NO:

2.

3. The application of miR1134 of claim 1 or the precursor of miR1134 of claim 2 in regulating stress resistance and / or leaf epidermal wax content in citrus plants. The regulation method is to inhibit the expression level of miR1134 to improve the stress resistance and / or leaf epidermal wax content of citrus plants; The stress resistance refers to drought resistance and / or salt resistance, and the citrus plant is lemon.

4. A short tandem target mimic molecule that inhibits the expression level of miR1134 as claimed in claim 1, characterized in that, The nucleotide sequence of the short tandem target mimic molecule is shown in SEQ ID NO:

3.

5. A product comprising the short tandem target mimic molecule of claim 4, wherein the product is at least one of the following: an expression cassette, a recombinant vector, and a recombinant bacterium.

6. A plant cell comprising the product of claim 5, wherein the plant is a lemon.

7. The application of the short tandem target mimic molecule of claim 4 or the product of claim 5 in improving the stress resistance and / or leaf epidermal wax content of citrus plants. The stress resistance refers to drought resistance and / or salt resistance, and the citrus plant is lemon.

8. A method for improving the stress resistance and / or leaf epidermal wax content of citrus plants, characterized in that, The short tandem target mimic molecule of claim 4 or the product of claim 5 is transferred into citrus plants; The stress resistance refers to drought resistance and / or salt resistance, and the citrus plant is lemon.

9. A method for breeding stress-resistant varieties of citrus and / or citrus varieties with high wax content in leaf epidermis, characterized in that, Detection of the expression level of miR1134 as described in claim 1 in test samples of citrus plants: Using wild-type lemon as a reference, citrus plants with downregulated miR1134 expression in the test samples were selected as breeding materials for breeding. The stress resistance refers to drought resistance and / or salt resistance, and the citrus plant is lemon.

10. The method according to claim 9, characterized in that, The detection reagents include a forward primer miR1134-F with a nucleotide sequence as shown in SEQ ID NO:4 and a reverse primer miR1134-R with a nucleotide sequence as shown in SEQ ID NO:5.

Citation Information

Patent Citations

  • Plant genome modification using guide RNA / Cas endonuclease systems and methods of use

    CN105916987A

  • MiRNA related to citrus plant resistance and leaf epidermis wax content and application thereof

    CN118374498A