The invention relates to a method based on 3apos; gene expression enhancement technology for UTR (Untranslated Region) functional element reprogramming
By reconstructing the translation regulatory elements in the 3'UTR region of the plant gene, the expression level of exogenous genes is improved, and the problem that the 3'UTR regulatory potential in the prior art is not fully utilized, achieving efficient gene expression enhancement.
Patent Information
- Application Number
- CN202510675802.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-05-23
AI Technical Summary
The existing technology has not fully tapped the regulatory potential of 3'UTR in plant genetic engineering, resulting in insufficient gene expression efficiency and difficult to meet the needs of crop trait improvement and recombinant protein production.
By reconstructing the translation regulatory elements (Omega, 6MΔT and N50-high) in the 3'UTR region of the target gene, a dual luciferase reporter vector was constructed, and plant protoplasts were transformed by PEG method to improve the expression level of exogenous genes.
It significantly improves the protein expression level of exogenous genes in plants, the effect is independent of transcriptional level regulation, provides an innovative path to solve the bottleneck of translation efficiency, and is easy to operate, without the need for complex promoters and 5'UTR sequence modification.
Smart Images

Figure CN120192970A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and plant genetic engineering, and in particular to a gene expression enhancement technology based on 3'UTR functional element reprogramming. Background Technology
[0002] In the field of plant genetic engineering, the expression efficiency of exogenous genes is a core factor determining the success of crop trait improvement and recombinant protein production. Current technological development mainly focuses on promoter optimization (such as strong constitutive or inducible promoters) and the optimized design of the 5'UTR (such as ribosome binding sites), while the regulatory potential of the 3'UTR has not been fully explored. Studies have shown that the 3'UTR has a crucial impact on gene expression at the posttranscriptional level by regulating mRNA stability (such as nuclease resistance mediated by polyA signal sequences), ribosome dissociation and recycling efficiency (affecting ribosome release after translation termination through structural motifs), and interaction networks with RNA-binding proteins (RBPs) (such as microRNA target sites regulating translational repression). For example, polyA signal sequences enhance expression persistence by prolonging mRNA half-life, while AU-rich elements may accelerate mRNA metabolic clearance by recruiting degradation complexes.
[0003] Although existing patented technologies (such as CN117230062A) have disclosed various translation-enhancing functions of 5'UTR sequences, significant technological gaps remain in engineered regulatory strategies targeting the 3'UTR. Omega sequences, as classic translation-enhancing elements, have previously been limited to applications in the 5'UTR region, with their sequence characteristics believed to play a role in optimizing translation initiation efficiency. However, the functional mechanisms of Omega sequences in the 3'UTR and their regulatory potential on gene expression have never been systematically studied. Summary of the Invention
[0004] In view of this, the present invention proposes a gene expression enhancement technology based on 3'UTR functional element reprogramming, which achieves efficient enhancement of the expression level of exogenous genes in plants by reconstructing translation regulatory elements (Omega, 6MΔT and N50-high) in the 3'UTR region of the target gene.
[0005] The technical solution of this invention is implemented as follows: This invention provides a gene expression enhancement technology based on 3'UTR functional element reprogramming, comprising the following steps: S1, the translation regulatory element is reconstructed in the 3'UTR region of the target gene to construct a dual-luciferase reporter vector; S2 uses a dual-luciferase reporter vector plasmid as plasmid DNA, transforms plant protoplasts using the PEG method, and then extracts the target protein.
[0006] Based on the above technical solutions, preferably, in step S1, the translation control element is one of Omega, 6MΔT, and N50-high.
[0007] Based on the above technical solutions, preferably, the nucleotide sequence of Omega is shown in SEQ ID NO.1.
[0008] Based on the above technical solutions, preferably, the nucleotide sequence of the 6MΔT is shown in SEQ ID NO.2.
[0009] Based on the above technical solutions, preferably, the nucleotide sequence of N50-high is shown in SEQ ID NO.3.
[0010] Based on the above technical solutions, preferably, in step S1, the target gene is an exogenous transgenic gene or an endogenous gene, and its expression product is a protein, non-coding RNA or a viral resistance element.
[0011] Based on the above technical solutions, preferably, in step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.
[0012] The gene expression enhancement technology based on 3'UTR functional element reprogramming of the present invention has the following advantages over the prior art: (1) This invention demonstrates through groundbreaking experiments that repositioning translation regulatory elements (Omega, 6MΔT and N50-high) to the 3'UTR region of the target gene significantly improves the protein expression level of exogenous genes in plants, and this effect is independent of transcriptional regulation. This reveals an innovative path for the functional reprogramming of 3'UTR elements and provides a new solution to the translation efficiency bottleneck in the existing technology.
[0013] (2) The target gene containing the Omega sequence in the 3'UTR of the present invention has a higher expression level than the general 3'UTR sequence.
[0014] (3) The operation of the present invention is simple and does not require complex promoter and 5'UTR sequence modification. It only requires inserting sequences such as Omega into the 3'UTR region of the target gene.
[0015] (4) The mechanism of action of this invention is that Omega and other sequences reduce the degradation effect of nucleases and prolong the half-life of mRNA by forming specific secondary structures, thereby enhancing the stability of mRNA to achieve the purpose of encoding more proteins. Since Omega and other translation regulatory elements located in the 5'UTR can enhance the expression of target genes in different plant species, this invention also tested the regulatory effect of Omega and other sequences located in the 3'UTR in different plants (such as Arabidopsis thaliana, tobacco, and rice). The results showed that Omega and other sequences located in the 3'UTR exhibited stable regulatory effects in Arabidopsis thaliana, tobacco, and rice species, indicating that they have broad applicability. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 The diagram shows the structure of a dual-luciferase vector containing the regulatory elements omega, 6MΔT, and N50-high inserted into the 3'UTR. Figure 2 A diagram showing how 3'UTRs containing various regulatory elements enhance the expression of target genes in Arabidopsis protoplasts; Figure 3 A diagram showing how 3'UTRs containing various regulatory elements enhance the expression of target genes in tobacco protoplasts; Figure 4 A diagram showing how 3'UTRs containing various regulatory elements enhance the expression of target genes in rice protoplasts. Detailed Implementation
[0018] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0019] The following are specific embodiments of the present invention, including experimental design, materials, and methods.
[0020] Example 1: Carrier Construction and Functional Verification I. Carrier Design like Figure 1As shown, a dual-luciferase reporter vector was constructed and named pSYB-Dual-LUC01-TBF1, containing FLUC (Firefly luciferase) driven by the Ubiquitin promoter and RLUC (Renilla luciferase) driven by the 35S promoter.
[0021] Construction of experimental vectors: The Omega, 6MΔT, and N50-high sequences were inserted into the 3'UTR region of the FLUC gene in the pSYB-Dual-LUC01-TBF1 vector, respectively. The constructed vectors were named pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR), and pSYB25-N50-high (3'UTR), respectively. Figure 1 (As shown).
[0022] The nucleotide sequences of Omega, 6MΔT, and N50-high are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.
[0023] SEQ ID NO. 1: GCCGGTCTAGAGTATTTTTACAACAATTACCAACAACAA CAAACAACAAACAACATTACAATTACTATTTACAATT.
[0024] SEQ ID NO. 2: ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAA CTTTCGATCTCTTGTAGATCTGTCTCAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCC.
[0025] SEQ ID NO. 3: CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAAC AATAGGCACACAT.
[0026] The nucleotide sequences of pSYB-Dual-LUC01-TBF1, pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR), and pSYB25-N50-high (3'UTR) are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively.
[0027] The specific steps for constructing the pSYB23-omega(3'UTR) vector are as follows: (1) PCR amplification of Omega sequence PCR reaction system: Nuclease-free Water 20μL, Biorun Pfu PCR Mix 25μL, E22557_0S1(+)(10 μM) 2μL, E22557_0S1(-)(10 μM) 2μL, template 1μL, total volume 50μL.
[0028] Primers for amplifying the Omega sequence: E22557_0S1(+): TAATTCTAGAGCGGCCGCGGATCCGCCGGTCTAGAGT ATTTTTACAAC; E22557_0S1(-): GTGATTTCAGCGAATTCACTAGTAATTGTAAATAGTAATTGTAATGTTGTTTGTTG.
[0029] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 sec, 50℃ for 30 sec, 72℃ for 10 sec, 30 cycles; 72℃ for 5 min, 16℃ for 30 min.
[0030] Electrophoresis was performed on a 1.5% agarose gel at a 5 V / cm electric field for 20 minutes. After confirmation by UV imaging, the target band Omega (76 bp) was excised and purified by gel extraction. DNA purification was performed using a column gel extraction kit, and the recovered product (labeled as rDNA01) was obtained by elution with 40 μL of sterile deionized water. After verifying fragment integrity and Nanodrop nucleic acid concentration by 1% agarose gel electrophoresis, the purified DNA fragment was ligated into a linearized vector treated with restriction endonucleases for in vitro recombination experiments.
[0031] (2) Enzyme digestion of vector Enzyme digestion system: Nuclease-free water 12 μL, 10*Buffer 2 μL, BamH I 1μL, Spe I 1μL, pSYB-Dual-LUC01-TBF1 4μL, Total 20μL.
[0032] Enzyme digestion conditions: 37℃ for 1 hour.
[0033] The vector digest was purified using a PCR purification kit (the purified product was labeled Vector(D)1) for use in the next recombinant reaction.
[0034] Recombination reaction Recombinant reaction system: Nuclease-free Water 10 μL, Biorun 2*EasyClone Mix 10 μL, rDNA01 5 μL, Vector(D)1 5 μL, Total 20 μL.
[0035] Recombination conditions: 37℃ for 30 min.
[0036] The ligation product was then transformed into competent cells, and the specific steps are as follows: Under ice bath conditions, add 50 μL DH5α Add 5 μL of ligation product to a pre-chilled suspension of competent cells, mix gently, and incubate on ice for 30 min. Heat shock at 42°C for 90 seconds, then immediately incubate on ice for 2 min to terminate the reaction. Add 500 μL of sterile LB broth (antibiotic-free), and incubate at 37°C with shaking for 1 h to restore the cells. Spread 100 μL of the bacterial culture evenly onto Kans resistant plates (50 μg / mL), and incubate upside down at 37°C for 12–16 h. Pick positive single clones for subsequent experiments.
[0037] The specific steps for constructing the pSYB24-6MΔT(3'UTR) vector are as follows: (1) PCR amplification of the 6MΔT sequence The amounts of each component in the PCR reaction system are the same as those in the pSYB23-omega(3'UTR) vector.
[0038] Primers for amplifying the 6MΔT sequence: E22558_0S1(+):TAATTCTAGAGCGGCCGCGGATCCATTAAAGGTTTATACCTTCCCAGGT; E22558_0S1(-):GTGATTTCAGCGAATTCACTAGTGGCTAAAATTAAAGTTCCAAACAGA.
[0039] The reaction conditions were the same as those for the pSYB23-omega(3'UTR) vector.
[0040] Electrophoresis was performed on a 1.5% agarose gel at a 5 V / cm electric field for 20 minutes. After confirmation by UV imaging, a 6 MΔT (117 bp) sample of the target band was excised for gel purification. DNA purification was performed using a column-based gel extraction kit, and the recovered product (labeled as rDNA02) was obtained by elution with 40 μL of sterile deionized water. After verifying fragment integrity and Nanodrop nucleic acid concentration by 1% agarose gel electrophoresis, the purified DNA fragment was ligated into a linearized vector treated with restriction endonucleases for in vitro recombination experiments.
[0041] (2) Enzyme digestion of vector The enzyme digestion system is the same as that of the pSYB23-omega(3'UTR) vector.
[0042] Enzyme digestion conditions: 37℃ for 1 hour.
[0043] The vector digest was purified using a PCR purification kit (the purified product was labeled Vector(D)2) for use in the next recombinant reaction.
[0044] Recombination reaction The specific steps of the recombination reaction are the same as those for the construction of the pSYB23-omega(3'UTR) vector.
[0045] The specific steps for constructing the pSYB25-N50-high(3'UTR) vector are as follows: (1) PCR amplification of N50-high sequence The volumes of each component in the PCR reaction system were the same as those in the pSYB23-omega(3'UTR) vector.
[0046] Primers for amplifying the N50-high sequence: E22559_0S1(+):TTCTAGAGCGGCCGCGGATCCGGGCAGCCTAACTACGGG; E22559_0S1(-):GTGATTTCAGCGAATTCACTAGTATGTGGTGCCTATTGTTTGAGCTTC.
[0047] The PCR reaction conditions were the same as those for the pSYB23-omega(3'UTR) vector.
[0048] Electrophoresis was performed on a 1.5% agarose gel at 5 V / cm for 20 minutes. After confirmation by UV imaging, the target band N50-high (50 bp) was excised for gel recovery and purification. DNA purification was performed using a column-based gel extraction kit, and the recovered product (labeled as rDNA03) was obtained by elution with 40 μL of sterile deionized water. After verifying fragment integrity and Nanodrop nucleic acid concentration by 1% agarose gel electrophoresis, the purified DNA fragment was ligated into a linearized vector treated with restriction endonucleases for in vitro recombination ligation experiments.
[0049] (2) Enzyme digestion of vector The enzyme digestion system is the same as that of the pSYB23-omega(3'UTR) vector.
[0050] Enzyme digestion conditions: 37℃ for 1 hour.
[0051] The vector digests were purified using a PCR purification kit (the purified product was labeled Vector(D)3) for use in the next recombination reaction.
[0052] Recombination reaction The specific steps of the recombination reaction are the same as those for the construction of the pSYB23-omega(3'UTR) vector.
[0053] II. Preparation of Arabidopsis protoplasts 1. Tissue preparation: Select 3-4 week old Arabidopsis plants and use a sterile scalpel to longitudinally cut the leaves along the midrib into tissue strips 0.5-1 mm wide. At a ratio of 1.5 g fresh weight leaf / 10 mL enzymatic hydrolysate, quickly immerse the tissue strips in pre-cooled compound enzymatic hydrolysate (containing 1.5% cellulase R10 + 0.4% analyte R10).
[0054] Enzymatic hydrolysate components: Cellulase R10 1.5%, Macerozyme R10 0.4%, Mannitol 0.4 M, KCl 20 mM, MES (pH 5.7) 10 mM.
[0055] Adjust the pH of the above enzymatic hydrolysate to 5.8, heat at 55°C for 10 min, mix by inverting three times, cool to room temperature, and then add the following solutions: CaCl2 (final concentration 10 mM) and BSA (Sigma A-6793) (final concentration 0.1%). Add ddH2O to 10 mL, filter through a 0.22 μm filter membrane for sterilization, and use immediately.
[0056] Enzymatic hydrolysis Vacuum permeation: Place the sample in a vacuum desiccator and apply a pressure of -0.08 MPa for 30 min to promote enzyme permeation.
[0057] Isothermal digestion: Transfer to a 26℃ isothermal shaker and digest at 60 rpm in the dark for 3-4 hours. The protoplast release rate was monitored using an inverted microscope and found to be over 80%.
[0058] III. Protoplast Purification 1. Termination of reaction: Add an equal volume of W5 termination buffer to the enzyme digestion system and manually vortex horizontally (amplitude 5 cm, frequency 2 Hz) for 10 s to terminate enzyme activity.
[0059] W5 solution composition: NaCl 154 mM, CaCl2 125 mM, KCl 2 mM, MES 2 mM.
[0060] Adjust the pH of the above W5 solution to 5.7-5.8, and finally add ddH2O to 100 mL; sterilize by filtration through a 0.22 μm filter membrane, and store at 4℃.
[0061] Collection by filtration: The tissue was filtered through a 75 μm nylon sieve into a 50 mL conical centrifuge tube and rinsed with 10 mL of W5 buffer to remove any remaining tissue.
[0062] Gradient purification Primary centrifugation: Centrifuge horizontally at 100×g for 3 min to collect protoplasts; Cold shock treatment: The precipitate was resuspended in 5 mL of W5 buffer and then placed on ice for 30 min; Second centrifugation: After centrifugation under the same conditions, the solution was replaced with MMG suspension (final volume ≈ 2 × 10⁻⁶). 5 (cells / mL).
[0063] MMG solution composition: Mannitol 0.4 M, MgCl2·6H2O 15 mM, MES 4 mM.
[0064] Adjust the pH of the above MMG solution to 5.7-5.8, and finally add ddH2O to 10 mL; sterilize by filtration through a 0.22 μm filter membrane, and store at 4℃.
[0065] IV. Transient transformation of Arabidopsis protoplasts 1. Protoplast cell treatment Discard the W5 solution after it has been left to stand on ice for 30 minutes (the cells have settled naturally and do not require centrifugation).
[0066] Add 100 μL of MMG solution to each sample, and adjust the cell density under a microscope (add more MMG if the density is too high) to ensure that the cells are rounded.
[0067] PEG transfection Pre-cooled (4°C) protoplast suspension was mixed with PEG4000 solution in the following ratio: 100 μL cells + 110 μL PEG4000. PEG was slowly added to the inner wall of the tube cap, the tube was inverted to mix, and the mixture was incubated in a 23°C water bath for 15 min.
[0068] PEG4000 (40% v / v): PEG4000 (40%) 2 g, Mannitol (0.2 M) 1.25 mL, CaCl2 (100mM) 500 μL, H2O to make up to 5 mL.
[0069] Termination and Washing Add 1 mL of W5 solution and mix gently. Centrifuge at 300 rpm for 2 min at 4°C and discard the supernatant. Repeat the washing process 2-3 times.
[0070] Protoplast Culture and Detection The culture system was placed in a constant temperature and light incubator at 23℃ (light intensity 80 μmol·m⁻²·s⁻¹, humidity 60%) and cultured for 16-18 h. Cells were lysed and total protein was extracted. The enzyme activities of FLUC and RLUC were detected by microplate reader.
[0071] V. Results Analysis like Figure 2 As shown, the FLUC / RLUC enzyme activities in the three experimental groups expressing pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR), and pSYB25-N50-high (3'UTR) protoplasts in Arabidopsis thaliana were significantly increased compared with the control group pSYB-Dual-LUC01-TBF1.
[0072] The results showed that the three regulatory elements located in the 3'UTR, Omega, 6MΔT and N50-high, could significantly increase the expression level of the target protein.
[0073] Example 2: Validation of a multi-plant system Referring to Example 1, the above experiment was repeated in tobacco protoplasts and rice protoplasts. The results showed that the three regulatory elements located in the 3'UTR, Omega, 6MΔT, and N50-high, could all increase the expression level of the target protein. Figure 3 and Figure 4 ).
[0074] The results confirmed that the three regulatory elements Omega, 6MΔT and N50-high located in the 3'UTR enhance the expression of the target gene in a species-wide manner.
[0075] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for enhancing gene expression based on reprogramming of 3'UTR functional elements, characterized in that: It includes the following steps: S1. Reconstruct the translation regulatory element in the 3' UTR region of the target gene to construct a dual-luciferase reporter vector; The translation regulatory element is one of Omega, 6MΔT, and N50-high; S2. Use the dual-luciferase reporter vector plasmid as plasmid DNA, transform plant protoplasts by the PEG method, and then extract the target protein.
2. The method for enhancing gene expression based on reprogramming of 3'UTR functional elements according to claim 1, wherein: The nucleotide sequence of the said Omega is shown in SEQ ID NO.
1.
3. The method for enhancing gene expression based on reprogramming of 3'UTR functional elements as claimed in claim 1, wherein: The nucleotide sequence of the said 6MΔT is shown in SEQ ID NO.
2.
4. The method for enhancing gene expression based on reprogramming of 3'UTR functional elements according to claim 1, wherein: The nucleotide sequence of the said N50-high is shown in SEQ ID NO.
3.
5. A method for enhancing gene expression based on reprogramming of 3'UTR functional elements according to claim 1, characterized in that: In step S1, the target gene is an exogenously introduced transgene or an endogenous gene, and its expression product is a protein, non-coding RNA, or a virus resistance element.
6. The method for enhancing gene expression based on reprogramming of 3'UTR functional elements as claimed in claim 1, wherein: In step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.
Citation Information
Patent Citations
Artificial optimization design 5UTR sequence for improving translation expression of exogenous gene
CN117230062A
COVID-19 virus nucleic acid quality control product and application thereof
CN112111607A
5 '-UTR sequence derivative based on SARS-CoV-2 and application of 5'-UTR sequence derivative in enhancement of plant gene translation expression
CN119286861A
Signal peptide for enhancing protein expression of cell-free system and application of signal peptide in D2P
CN119529023A
The invention relates to 5apos; uTR (Untranslated Region) element and application thereof in improving expression quantity of target gene of plant
CN119709749A