Nucleic acid aptamer capable of specifically recognizing guaiacol and application of nucleic acid aptamer

Abstract

The invention relates to the field of biology, in particular to a nucleic acid aptamer capable of specifically recognizing guaiacol and application of the nucleic acid aptamer. Compared with a protein antibody, the nucleic acid aptamer provided by the invention has higher affinity specificity and no immunogenicity. The nucleic acid aptamer can be chemically synthesized, is small in molecular weight and stable in property, and can be specifically combined with guaiacol. In specific application, the nucleic acid aptamer takes guaiacol as a target, qualitative and quantitative rapid detection of guaiacol can be realized, the nucleic acid aptamer has the advantages of high detection sensitivity, high specificity, low cost and the like, and various biosensors for detecting guaiacol can be constructed on the basis of the nucleic acid aptamer. Therefore, the nucleic acid aptamer provided by the invention can solve the problem that a guaiacol detection method in the fruit juice industry at the present stage cannot give consideration to both accurate detection and rapid and simple detection to a certain extent.

Description

Technical Field

[0001] The present invention relates to the field of biology, and particularly to a nucleic acid aptamer that can specifically recognize guaiacol and its application. Background Art

[0002] Guaiacol (GUA) is a flavor substance with "smoky flavor", "medicinal flavor" and "disinfectant flavor", and its sensory threshold is very low, being 0.02 mg / L in water and 0.03 mg / L in 12% aqueous ethanol solution. Its structural formula is shown in Formula 1.

[0003]

[0004] Guaiacol is a metabolite after microbial contamination, and most of it is produced by Alicyclobacillus acidoterrestris and Alicyclobacillus acidocaldarius degrading vanillic acid. Alicyclobacillus acidoterrestris is extremely easy to grow and metabolize in fruit juice products. As its metabolite, guaiacol will not only affect the taste and flavor of fruit juice products, but also cause harm to human skin and mucous membranes. Therefore, the work of detecting the content of guaiacol in fruit juice products is particularly important.

[0005] At present, the methods for detecting guaiacol in the fruit juice industry mainly include instrumental analysis methods and enzyme-linked immunosorbent assay methods, etc. Among them, gas chromatography-mass spectrometry (GC-MS) combined with headspace solid-phase microextraction (HS-SPME) is the most common instrumental analysis method for detecting guaiacol pollutants. Although this method has high detection sensitivity, it usually requires expensive large-scale instruments, with high costs, and requires professional operators for analysis and detection. Therefore, it is difficult to meet the requirements for on-site, real-time and rapid detection of food. Enzyme-linked immunosorbent methods all rely on antibody-based detection kits. Although they are suitable for on-site detection, the preparation of antibodies requires animal experiments, the preparation process is relatively complex, and there are large batch differences. At present, there is little research on the detection of guaiacol in the fruit juice industry, and the existing detection methods have the problem of being unable to balance accurate detection and rapid and simple detection. Therefore, there is an urgent need to develop a sensitive and rapid and simple detection technology for guaiacol. Summary of the Invention

[0006] The object of the present invention is to provide a nucleic acid aptamer that can specifically recognize guaiacol and its application to solve the problems existing in the above-mentioned prior art. The present invention provides a nucleic acid aptamer that can specifically recognize guaiacol. In the specific detection process, by using this nucleic acid aptamer, the guaiacol in fruit juice can be detected by measuring the intensity of the fluorescence signal. The nucleic acid aptamer provided by the present invention has the advantages of high detection sensitivity, low cost and rapid detection. Therefore, it can, to a certain extent, solve the problem that the existing detection methods for guaiacol in the current fruit juice industry cannot balance accurate detection and rapid and simple detection.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a nucleic acid aptamer that can specifically recognize guaiacol, and the nucleotide sequence of the nucleic acid aptamer is shown as any one of the following:

[0009] (1) The nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2;

[0010] (2) A nucleotide sequence having more than 60% homology with the sequence shown in (1) and specifically recognizing guaiacol; as shown in SEQ ID NO.6 or SEQ ID NO.7;

[0011] (3) The complementary sequence of the sequence shown in (1) or (2);

[0012] (4) The RNA sequence transcribed from the sequence shown in (1) or (2).

[0013] Further preferably, the dissociation constant Kd value of the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.1 of the present invention is 47.97 ± 18.55 nmol / L. At the same time, this nucleic acid aptamer has good specificity for guaiacol. By predicting the secondary structure of this nucleic acid aptamer, it can be known that its secondary structure contains a typical stem-loop structure, and the binding of this nucleic acid aptamer to the target depends on the secondary structure of this nucleic acid aptamer. Usually, the formation of the stem-loop structure is the structural basis of the affinity of the nucleic acid aptamer. Therefore, this nucleic acid aptamer has good stability and can be truncated and optimized.

[0014] Further preferably, the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.2 of the present invention can be obtained by truncating the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.1. The dissociation constant Kd value of this nucleic acid aptamer is 46.77 ± 3.84 nmol / L. Compared with the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.1, its binding affinity is not much different, and this nucleic acid aptamer can well distinguish other negative small molecule targets, such as chlorogenic acid, epicatechin, ferulic acid, vanillic acid, vanillin, etc., and it has good specificity for guaiacol. By predicting the secondary structure of this nucleic acid aptamer, it can be known that its secondary structure also contains a typical stem-loop structure. Usually, the formation of the stem-loop structure is the structural basis of the affinity of the nucleic acid aptamer. Therefore, the nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.2 also has good stability.

[0015] Preferably, a label is bound to the 5'-end of the nucleotide sequence of the nucleic acid aptamer;

[0016] The marker includes one or more of a fluorescent marker, a radioactive substance, a therapeutic substance, biotin, digoxin, a small peptide, siRNA, and an enzyme.

[0017] Preferably, a fluorescent marker is bound to the 5'-end of the nucleotide sequence of the aptamer.

[0018] More preferably, the fluorescent label includes a fluorescent group and / or a nano luminescent material.

[0019] More preferably, the fluorescent marker includes a FAM fluorescent group.

[0020] By adding the above-mentioned marker, the aptamer of the present invention can realize the rapid qualitative and quantitative detection of guaiacol, and at the same time has the advantages of low cost, high specificity, and wide application range. The aptamer provided by the present invention can be used as a small molecule metabolite recognition molecule in the fields of food processing, food management, and nutrition planning. Thus, the aptamer provided by the present invention has a wide range of uses.

[0021] Preferably, the nucleotide sequence of the aptamer is modified; the modification includes one or more of phosphorylation, methylation, amination, thiolation, replacing oxygen with sulfur, replacing oxygen with selenium, and isotopic labeling;

[0022] and / or, the nucleotide sequence of the aptamer is derivatized; the derivatization includes derivatizing the backbone of the nucleotide sequence into a phosphorothioate backbone sequence or a peptide nucleic acid.

[0023] In the present invention, the nucleotide sequence of the aptamer can be modified. After the aptamer is modified with different molecular groups, various biosensors can be constructed for detecting guaiacol in food.

[0024] The present invention provides the application of the above-mentioned aptamer in the preparation of a guaiacol detection kit, a guaiacol molecular probe, or an aptamer biosensor.

[0025] The present invention provides a guaiacol detection kit, and the kit includes the above-mentioned aptamer.

[0026] The present invention provides an aptamer biosensor, and the aptamer biosensor includes the above-mentioned aptamer.

[0027] The present invention provides the application of the above-mentioned aptamer, the above-mentioned guaiacol detection kit, or the above-mentioned aptamer biosensor in the detection of guaiacol.

[0028] The present invention provides a method for detecting guaiacol, which includes the following steps:

[0029] Mix the above-mentioned nucleic acid aptamer with graphene oxide, carry out the first light-shielded reaction, add the sample to be tested, carry out the second light-shielded reaction, and centrifuge to measure the fluorescence value of the supernatant;

[0030] Calculate the concentration of guaiacol according to the standard curve.

[0031] Preferably, the concentration of the nucleic acid aptamer is 98 - 102 nM.

[0032] More preferably, the concentration of the nucleic acid aptamer is 100 nM.

[0033] More preferably, a label is bound to the 5'-end of the nucleotide sequence of the nucleic acid aptamer.

[0034] More preferably, the label includes one or more of a fluorescent label, a radioactive substance, a therapeutic substance, biotin, digoxin, a small peptide, siRNA, and an enzyme.

[0035] More preferably, a fluorescent label is bound to the 5'-end of the nucleotide sequence of the nucleic acid aptamer.

[0036] More preferably, the fluorescent label includes a fluorescent group and / or a nano-luminescent material.

[0037] More preferably, the fluorescent label includes a FAM fluorescent group.

[0038] Graphene oxide (GO) has good water solubility, and also has advantages such as a large surface area, good conductivity, and easy surface modification. There can be a tight connection between GO and the nucleic acid aptamer through the hydrophobic interaction between the base and GO and the π-π stacking interaction, and it has a strong distance-dependent fluorescence quenching ability, which is widely used in the binding analysis of nucleic acid aptamers and targets. After labeling the FAM fluorescent group at the end of the nucleic acid aptamer probe, the guaiacol in the juice can be detected by measuring the intensity of the fluorescence signal, and the fluorescence signal increases with the increase of guaiacol. Specifically, when there is no guaiacol, the fluorescently labeled nucleic acid aptamer is adsorbed by GO and undergoes fluorescence resonance energy transfer to quench its fluorescence signal; while when there is guaiacol, due to the strong interaction between the aptamer and guaiacol to form a complex, it dissociates from GO, and the fluorescence recovers after increasing the distance. It has been verified that the detection method constructed with the nucleic acid aptamer provided by the present invention that can specifically recognize guaiacol can detect guaiacol, and the lowest detection limit of guaiacol is 0.072 μg / mL; the standard curve of this detection method is: y = 124.99ln(x) + 142.94, R 2 = 0.996.

[0039] The present invention discloses the following technical effects:

[0040] The nucleic acid aptamer provided by the embodiment of the present invention can specifically recognize guaiacol, has higher affinity specificity compared with protein antibodies, and has no immunogenicity; moreover, the nucleic acid aptamer has the advantages of being chemically synthesizable, having a small molecular weight, being stable in nature, and being able to specifically bind guaiacol. The nucleic acid aptamer provided by the present invention targets guaiacol, can realize the rapid detection of the qualitative and quantitative determination of guaiacol, has the advantages of low cost, high specificity and wide application range, and various biosensors for detecting guaiacol can also be constructed based on the nucleic acid aptamer. And, the present invention screened the nucleic acid aptamer of guaiacol by a non-immobilized method, which can take into account the advantages of accurate detection and rapid and simple detection, and effectively overcomes the steric hindrance effect of the traditional method and the conformational change defect caused by target immobilization. This method can be screened in vitro, and this method has the advantages of short screening period, simple operation and low cost in the screening process; the nucleic acid aptamer screened by this method has the advantages of strong stability, convenient synthesis, easy labeling of various modification groups and long-term storage and use. It can be seen that when detecting using the nucleic acid aptamer provided by the present invention, the guaiacol in the juice can be detected by measuring the intensity of the fluorescence signal, which has the advantages of high detection sensitivity, low cost and rapid detection. The lowest detection limit of this nucleic acid aptamer is 0.072 μg / mL. In summary, the nucleic acid aptamer provided by the present invention can, to a certain extent, solve the problem that the current detection methods for guaiacol in the juice industry cannot take into account both accurate detection and rapid and simple detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0042] Figure 1 It is the GO-SELEX screening flow chart provided by the embodiment of the present invention;

[0043] Figure 2 It is the change diagram of the recovery rate and enrichment rate during the screening process of the nucleic acid aptamer provided by the embodiment of the present invention;

[0044] Figure 3 It is the secondary structure prediction diagram of SEQ ID NO.1 and SEQ ID NO.2 provided by the embodiment of the present invention; wherein, A is the secondary structure prediction diagram of SEQ ID NO.1; B is the secondary structure prediction diagram of SEQ ID NO.2;

[0045] Figure 4Nonlinear fitting curve graphs for detecting the affinity of SEQ ID NO.1 and SEQ ID NO.2 provided by the embodiments of the present invention using GO fluorescence resonance energy transfer; wherein, A is the nonlinear fitting curve graph of SEQ ID NO.1; B is the nonlinear fitting curve graph of SEQ ID NO.2;

[0046] Figure 5 Schematic diagram for the specificity analysis of the short-chain nucleic acid aptamer SEQ ID NO.2 provided by the embodiments of the present invention;

[0047] Figure 6 Standard curve for the detection of guaiacol by the nucleic acid aptamer SEQ ID NO.2 provided by the embodiments of the present invention;

[0048] Figure 7 Nonlinear fitting curves for the affinity of the nucleic acid aptamers with sequences SEQ ID NO.6 and SEQ ID NO.7 provided by the embodiments of the present invention; wherein, A is the nonlinear fitting curve graph of SEQ ID NO.6; B is the nonlinear fitting curve graph of SEQ ID NO.7. Detailed implementation manners

[0049] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0050] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0051] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0052] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.

[0053] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0054] Example 1 Screening and Preparation of Nucleic Acid Aptamers Specifically Recognizing Guaiacol

[0055] The performance of nucleic acid aptamers determines the quality of the detection effect of the kit. The present invention screened multiple nucleic acid aptamers for the detection index guaiacol, and finally screened an optimal nucleic acid aptamer. This example aims to illustrate the screening process of nucleic acid aptamers.

[0056] 1. Synthesize the random ssDNA library and primers shown in the following sequences

[0057] Random ssDNA library: 5'-AGCAGCACAGAGGTCAGTTC-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNN(N40)-CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO.3);

[0058] Upstream primer: 5'-FAM-AGCAGCACAGAGGTCAGTTC-3' (SEQ ID NO.4);

[0059] Downstream primer: 5'-P-TTCACGGTAGCACGCATAGG-3' (SEQ ID NO.5).

[0060] Among them, "N40" represents a sequence composed of 40 arbitrary nucleotide bases, and this library and primer were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0061] The random ssDNA library and primers were respectively prepared into stock solutions with a concentration of 100 μM using TE buffer (10 mM Tris-HCl and 1 mM EDTA, pH = 8.0) and stored at -20°C for later use.

[0062] 2. GO-SELEX Screening of Specific Nucleic Acid Aptamers

[0063] Figure 1 is the GO-SELEX screening flow chart provided by the embodiments of the present invention. As Figure 1As shown in the figure, the non-immobilized GO-SELEX screening process mainly includes four steps: binding, separation, elution, and amplification. An oligonucleotide library is synthesized in vitro, with fixed primer sequences at both ends and a random sequence in the middle. The random library is mixed and incubated with the target, and unbound or weakly bound oligonucleotides are removed by high-speed centrifugation and graphene oxide (GO) adsorption method to obtain the oligonucleotide-target complex. Then, PCR amplification is carried out using this as a template, and after enrichment, a single-stranded secondary library is prepared for the next round of screening. After multiple rounds of screening and amplification, oligonucleotides with low affinity are gradually eliminated, and finally, nucleic acid aptamers that can bind to the target with high affinity and specificity are obtained through sequencing and identification.

[0064] The following details the process of screening specific nucleic acid aptamers by non-immobilized GO-SELEX.

[0065] (1) Pretreatment of the random ssDNA library: Dissolve the initial random ssDNA library or the secondary ssDNA library in 100 μL of acidic simulated buffer (2 μM CaCl2, 50 mM KCl, 2 μM MgCl2, and 40 mM Tris, pH = 3.5), treat it in a metal bath at 95 °C for 5 min, and then slowly cool it to room temperature until the two are fully complementary.

[0066] (2) Determination of the optimal adsorption ratio of GO to the random ssDNA library: To ensure that GO completely adsorbs the free ssDNA that has not bound to the target guaiacol during the SELEX process, it is necessary to first determine the optimal mass ratio of GO to ssDNA. Incubate GO and ssDNA at different mass ratios of GO to ssDNA (0:1 - 200:1) for binding, and measure the ssDNA concentration in the supernatant after centrifugation using a micro-spectrophotometer until the ssDNA is completely adsorbed by GO and almost no ssDNA concentration can be detected in the supernatant. Determine the optimal adsorption mass ratio of GO to ssDNA as 50:1.

[0067] (3) Incubation and binding: Incubate 100 μL of the folded aptamer random library with 10 nmol of guaiacol in a 200 μL system, and incubate it in a shaking incubator at 37 °C and 200 rpm in the dark for 2 h.

[0068] (4) Separation: To separate the bound and unbound ssDNA, a GO solution (1 mg / mL) 50 times the mass of ssDNA was added, and the mixture was incubated with shaking in the dark at 37 °C and 200 rpm in an oscillator for 1 h. After incubation, it was centrifuged at 13000 rpm and 4 °C in a refrigerated high-speed centrifuge for 15 min to remove the non-specific ssDNA adsorbed on GO. The supernatant was recovered, and this step was repeated 2 times until no GO precipitate appeared in the solution. The supernatant was the GO-SELEX screening product, and the recovery rate of each screening cycle was calculated. In the seventh, ninth, and eleventh rounds, a counter-selection process was added. Before incubation with the target, other co-existing substances (chlorogenic acid (CA), epicatechin (EC), ferulic acid (FA), vanillic acid (VA), and vanillin) were introduced into the system to increase the screening pressure and obtain sequences with better affinity and specificity.

[0069] (5) PCR amplification: PCR amplification was performed using the centrifuged supernatant as a template. The conditions for the PCR amplification reaction were: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s; annealing at 53 °C for 30 s; extension at 72 °C for 30 s; and final extension at 72 °C for 5 min, for 27 cycles.

[0070] The system for the PCR amplification reaction was: 2 μL of DNA template (2 μmol / L), 1 μL of upstream primer (20 μmol / L, SEQ ID NO.4), 1 μL of downstream primer (20 μmol / L, SEQ ID NO.5), 25 μL of 2×Es Taq MasterMix (Dye), 0.1 μL of 50% methanol-sterilized water, and 20.9 μL of ddH2O.

[0071] (6) Purification of PCR products: An equal volume of phenol:chloroform:isoamyl alcohol reagent (the reagent is a mixture of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1) was added to the PCR products, vortex-mixed, and centrifuged at 4 °C and 13000 rpm for 15 min. The upper layer liquid (DNA) was aspirated, centrifuged once more, 1 / 10 volume of 3M sodium acetate (pH = 5.2) solution and 2.5 times volume of absolute ethanol (pre-cooled at -20 °C) were added and mixed evenly. It was centrifuged at 4 °C and 12000 rpm for 15 min, the supernatant was discarded, 1 mL of 70% absolute ethanol (pre-cooled at -20 °C) was added again, the precipitate was washed thoroughly and then centrifuged again, the supernatant was discarded, and the dried precipitate was dissolved in TE buffer.

[0072] (7) Verification by agarose gel electrophoresis: After PCR amplification of the secondary library obtained in each round of screening, it was detected by 4% (v / v) agarose gel electrophoresis, and the size of the obtained band was compared with the marker to see if it was approximately 80 bp.

[0073] The steps of agarose gel electrophoresis are as follows: Prepare an agarose solution with an appropriate volume concentration using 1×TAE solution according to the number of sample loading amounts and the size of the target band, heat it in a microwave oven for 1 min until the agarose dissolves, pour it into the gel-making tank after slightly cooling, and insert a comb; after the gel solidifies, pull out the comb vertically. Place the gel in the 1×TAE nucleic acid electrophoresis buffer in the electrophoresis tank, mix the sample and the loading buffer at a volume ratio of 6:1 and then load the sample, with a voltage of 100 V for 45 min; observe the results in the gel imaging system.

[0074] (8) Preparation of ssDNA secondary library: The 5'-phosphorylated labeled antisense strand in the PCR product was removed by digestion with Lambda exonuclease to obtain ssDNA. Add Lambda exonuclease (5000 U / mL) and 1 / 10 of the original volume of Lambda exonuclease buffer to the purified PCR product. The reaction conditions were: digestion at 37 °C in a water bath for 1 h, and termination of the reaction by heating in a water bath at 75 °C for 10 min.

[0075] (9) Purification of ssDNA secondary library: Add 1 / 10 of the original volume of 3 M sodium acetate (pH = 5.2) solution, nucleic acid coprecipitant, and 2.5 volumes of anhydrous ethanol (pre-cooled at -20 °C) to the digested product and mix evenly. Centrifuge at 4 °C and 12000 rpm for 15 min, discard the supernatant, then add 1 mL of 70% anhydrous ethanol (pre-cooled at -20 °C), wash the precipitate thoroughly and centrifuge again, discard the supernatant, and dissolve the dried precipitate in TE buffer as the secondary library for the next round of screening, and measure its nucleic acid concentration using a micro UV spectrophotometer.

[0076] (10) Repeat multiple rounds of screening: Replace the initial library in step (1) with the ssDNA secondary library collected in step (9), and repeat the above steps (1)-(10).

[0077] In order to obtain ssDNA with higher affinity for the target guaiacol, as the number of SELEX screening rounds increases, the screening pressure is gradually increased, and the results are shown in Table 1. It can be seen from Table 1 that the amount of the ssDNA library is gradually reduced from 1000 pmol to 150 pmol, the concentration of guaiacol is reduced from 10 nmol to 2 nmol, and the incubation time of the library and the target is reduced from 120 min to 90 min.

[0078] Table 1 Cell-SELEX screening conditions

[0079]

[0080] Note: Negative SELEX refers to introducing negative screening substances (analogues or interferents against the target) in the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to eliminate aptamers that have cross-reactivity with interferents or analogues with a structure similar to the target substance (guaiacol), thereby obtaining highly specific nucleic acid aptamers.

[0081] The changes in the recovery rate and enrichment rate during the nucleic acid aptamer screening process are as Figure 2 shown. As Figure 2 can be seen, with the increase in the number of screening rounds, more and more ssDNA binding to guaiacol is obtained, and the recovery rate increases to a certain extent and then no longer increases. This indicates that the ssDNA that can bind to guaiacol is enriched, and the aptamers that cannot bind to guaiacol or have weak binding ability have been eliminated. Specifically, the recovery rate suddenly drops in the seventh round, probably because chlorogenic acid, epicatechin, ferulic acid, vanillic acid, and vanillin are added for reverse screening, enhancing the specificity of the aptamer. Reverse screening is carried out again in the ninth and eleventh rounds, and the recovery rate no longer decreases. After 3 more rounds of positive screening, the screening process ends, and more than 70% of the ssDNA can be recovered from the input ssDNA library.

[0082] 3. High-throughput sequencing and sequence analysis

[0083] The products of the last round of screening are sent to Sangon Biotech (Shanghai) Co., Ltd. for high-throughput sequencing after PCR amplification. The sequences with a relatively high occurrence frequency in the sequencing results are aligned and analyzed using the Mage6 software, and the secondary structure of the sequences is predicted. Representative sequences with lower energy levels and stable structures are selected from different families, and nucleic acid aptamer sequences labeled with 5'-FAM are synthesized for the next step of affinity identification. By analyzing the consensus sequences and secondary structures among the candidate ssDNAs, the most likely stem-loop positions for binding are predicted for truncation optimization. The secondary structure is predicted by UNAFold (http: / / www.unafold.org / ), and the results are as Figure 3 shown.

[0084] As Figure 3It can be seen that through the prediction of the secondary structure of the full-length nucleic acid aptamer (whose sequence is shown in SEQ ID NO.1, specifically: 5'-AGCAGCACAGAGGTCAGTTCTGTACGAACATTGCGGTTTCTCCCCGTGTGCAGTACGGGGCCTATGCGTGCTACCGTGAA-3'), it is found that there is a stem-loop structure that may bind in the sequence. Therefore, the stem-loop structure part was truncated and optimized to obtain a truncated nucleic acid aptamer (whose sequence is shown in SEQ ID NO.2, specifically: 5'-TTGCGGTTTCTCCCCGTGTGCAGTACGGGGCCTATGCGTGCTACCGTGAA-3'), which was truncated from 80 bases in length to 50 bases in sequence.

[0085] Example 2 Affinity Identification of Candidate ssDNA (i.e., Nucleic Acid Aptamer)

[0086] To identify the affinities of the full-length nucleic acid aptamer (SEQ ID NO.1) and the short-chain nucleic acid aptamer obtained by truncating and optimizing the full-length nucleic acid aptamer (SEQ ID NO.2), the nucleic acid aptamers were incubated with different concentrations of guaiacol and processed, and then the dissociation constant Kd values of the sequences were determined.

[0087] The specific method includes: performing a folding treatment on the 5'-FAM-labeled nucleic acid aptamer sequence solution by heating and then slowly cooling, and then incubating different concentrations of guaiacol with the nucleic acid aptamer at a fixed concentration (100 nmol / L) for 1 h. The total reaction volume is 110 μL. At the same time, a negative control without adding guaiacol is set. After the reaction ends, GO is added according to the mass ratio of GO to the nucleic acid aptamer of 20:1, and the incubation is continued in the dark for 25 min. Then, centrifuge at 13000 rpm for 15 min, and measure the fluorescence value of the supernatant (Ex = 492 nm, Em = 522 nm). The dissociation constant Kd value of the sequence is determined by non-linear fitting using GraphPad Prism 8 software.

[0088] The non-linear fitting curves of the full-length nucleic acid aptamer and its truncated nucleic acid aptamer are as Figure 4 shown, and the sequences and corresponding Kd values of the full-length nucleic acid aptamer and its truncated short-chain nucleic acid aptamer are shown in Table 2.

[0089] Table 2 Sequences and Kd Values of the Full-length Nucleic Acid Aptamer and Its Truncated Short-chain Nucleic Acid Aptamer

[0090]

[0091] From Figure 4As shown in Table 2, the affinity Kd value of the full-length nucleic acid aptamer is 47.97 ± 18.55 nmol / L, while the affinity Kd value of the short-chain nucleic acid aptamer is 46.77 ± 3.84 nmol / L. It can be seen that although the Kd value of the short-chain nucleic acid aptamer is not much different from that of the full-length nucleic acid aptamer, the standard deviation of the Kd value of the short-chain nucleic acid aptamer is smaller. Moreover, the synthesis cost of the short-chain nucleic acid aptamer is not only reduced, but its binding stability is stronger. Thus, the short-chain nucleic acid aptamer has more advantages than the full-length nucleic acid aptamer.

[0092] Example 3 Specificity Analysis of Short-Chain Nucleic Acid Aptamer (SEQ ID NO.2) for Guaiacol

[0093] The same method as in Example 2 was used to evaluate the specificity of the short-chain nucleic acid aptamer sequence for guaiacol.

[0094] The method specifically includes: 100 nM short-chain nucleic acid aptamer (SEQ ID NO.2) was mixed with 800 μg / mL guaiacol, chlorogenic acid, epicatechin, ferulic acid, vanillic acid, and vanillin respectively, incubated in the dark at 37 °C for 1 h, and an acidic simulated buffer (2 μM CaCl2, 50 mM KCl, 2 μM MgCl2, and 40 mM Tris, pH = 3.5) was used as a negative control. Subsequently, GO was added at a ratio of 20:1 by mass of GO to the short-chain nucleic acid aptamer, and incubation was continued in the dark for 25 min, centrifuged at 13,000 rpm for 15 min, and the fluorescence value of the supernatant (Ex = 492 nm, Em = 522 nm) was measured, with the acidic simulated buffer as a blank control (Blank). The fluorescence value was used to evaluate the specificity analysis of the short-chain nucleic acid aptamer for guaiacol. Each sample was measured in parallel 3 times and operated in the dark. The results of the specificity analysis of the short-chain nucleic acid aptamer are shown in Figure 5 . From Figure 5 It can be seen that the fluorescence signal of the target guaiacol is significantly about 2 - 7 times higher than the fluorescence signals of chlorogenic acid, epicatechin, ferulic acid, vanillic acid, and vanillin, indicating that the short-chain nucleic acid aptamer (i.e., the nucleic acid aptamer with the sequence shown in SEQ ID NO.2) has good specificity.

[0095] Therefore, from the results of Examples 1 to 3, compared with the target fixation technology used to screen nucleic acid aptamers in the related art, the aptamer of guaiacol screened by the non-immobilization method in the embodiments of the present invention can effectively overcome the steric hindrance effect of the traditional method and the conformational change defect caused by target fixation, can be screened in vitro, has the advantages of short screening cycle, simple operation, and low screening process cost. At the same time, the screened nucleic acid aptamer has the advantages of strong stability, convenient synthesis, easy labeling of various modification groups, and can be stored and used for a long time.

[0096] Example 4 Establishment of a method for detecting guaiacol using the truncated short-chain nucleic acid aptamer (SEQ ID NO.2)

[0097] Mix 100 nM of the short-chain nucleic acid aptamer with GO at a mass ratio of 1:20 and react in the dark for 25 min. Then add a series of concentrations (0.625 μg / mL, 1.25 μg / mL, 2.5 μg / mL, 5.0 μg / mL, 10 μg / mL, 20 μg / mL) of guaiacol to the system and measure the fluorescence value of the supernatant (Ex = 492 nm, Em = 522 nm). Take the fluorescence intensity value as the ordinate and the logarithm of the guaiacol concentration as the abscissa to achieve sensitive detection of guaiacol. The standard curve of this detection method is as Figure 6 shown. The results show that the standard curve is y = 124.99ln(x) + 142.94, R 2 = 0.996. Further analysis Figure 6 shows that this detection method has a good linear range within the guaiacol concentration of 0.625 - 20 μg / mL.

[0098] Example 5 Detection of the lowest detection limit of the truncated short-chain nucleic acid aptamer (SEQ ID NO.2)

[0099] The limit of detection (LOD), also known as the detection limit, refers to the lowest concentration (amount) of the analyte that can be detected in a sample. Generally based on the signal-to-noise ratio method, that is, the sample concentration when the generated signal (peak height) is k times the standard deviation of the baseline noise, and calculate the lowest concentration or amount of the analyte that can be reliably detected. The concentration at a signal-to-noise ratio (S / N) of 3:1 is determined as the detection limit, that is, LOD = 3S / N, where LOD is the lowest detection limit, S is the standard deviation of the instrument response value, and N is the slope of the standard curve. After calculation, the lowest detection limit of guaiacol that can be detected by the nucleic acid aptamer provided by the present invention is 0.072 μg / mL.

[0100] Based on the above, the nucleic acid aptamer obtained by library screening in the embodiments of the present invention has good affinity and specificity, and the nucleic acid aptamer structure in the embodiments of the present invention is stable. After group labeling, it still has good affinity and specificity and can be applied to guaiacol detection kits.

[0101] Example 6 Establishment of a method for detecting guaiacol using the truncated short-chain nucleic acid aptamer (SEQ ID NO.2)

[0102] Mix 100 nM short-chain nucleic acid aptamer with GO at a mass ratio of 1:20 and react in the dark for 25 min. Then add 15 μg / mL guaiacol to the system and measure the fluorescence value of the supernatant (Ex = 492 nm, Em = 522 nm). Substitute the measured fluorescence value into the standard curve "y = 124.99ln(x) + 142.94" to calculate the concentration of guaiacol. The results show that the concentration of guaiacol is 15.02 μg / mL, which is the same as the concentration of guaiacol when added. Thus, this method can be used for the quantitative analysis of guaiacol.

[0103] Example 7

[0104] Synthesize nucleic acid aptamers shown in SEQ ID NO.6 and SEQ ID NO.7.

[0105] SEQ ID NO.6: 5'-AGCAGCACAGAGGTCAGTTCACTCGATTTGCGTGGTAATTGCCTTGCCGGTACTAGAT AACCTATGCGTGCTACCGTGAA-3';

[0106] SEQ ID NO.7: 5'-AGCAGCACAGAGGTCAGTTCGCTCATCATATCGTGAACTTGGGCAGAGCCCTGGGTAT GACCTATGCGTGCTACCGTGAA-3'.

[0107] Use the same method as in Example 2 to measure the affinity of nucleic acid aptamers with sequences SEQ ID NO.6 and SEQ ID NO.7. The results are as Figure 7 shown. Among them, the Kd value of the nucleic acid aptamer with the sequence SEQ ID NO.6 is 88.98 ± 10.62 nmol / L, and the Kd value of the nucleic acid aptamer with the sequence SEQ ID NO.7 is 69.61 ± 50.29 nmol / L.

[0108] Compare the results of Example 2 with those of Example 7. Since the Kd value of the short-chain nucleic acid aptamer in Example 2 is 46.77 ± 3.84 nmol / L, it can be seen that the affinity of the short-chain nucleic acid aptamer is better than that of the nucleic acid aptamer with the sequence SEQ ID NO.6 and the nucleic acid aptamer with the sequence SEQ ID NO.7. Moreover, the sequence length of the short-chain nucleic acid aptamer in Example 2 is also shorter, and the cost is greatly reduced.

[0109] In summary, the nucleic acid aptamer specifically recognizing guaiacol provided by the embodiment of the present invention can be screened by the SELEX technology, and has a sensitivity comparable to that of the antigen-antibody reaction and no immunogenicity; moreover, the nucleic acid aptamer has the advantages of being chemically synthesizable, having a small molecular weight, being stable in nature, and being able to specifically bind guaiacol. The nucleic acid aptamer provided by the present invention uses guaiacol as a target, can realize the rapid detection of the qualitative and quantitative determination of guaiacol, has the advantages of low cost, high specificity and wide application range, and various biosensors for detecting guaiacol can also be constructed based on the nucleic acid aptamer. In addition, the nucleic acid aptamer of guaiacol is screened by a non-immobilized method in the present invention, which can take into account the advantages of accurate detection and rapid and simple detection, effectively overcome the steric hindrance effect of the traditional method and the defect of conformational change caused by target immobilization, can be screened in vitro, and has the advantages of short screening period, simple operation and low cost in the screening process; the screened nucleic acid aptamer has the advantages of strong stability, convenient synthesis, easy labeling of various modification groups and long-term storage and use.

[0110] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A nucleic acid aptamer that can specifically recognize guaiacol, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in any one of the following: (1) the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2; (2) a nucleotide sequence that has a homology of more than 60% with the sequence shown in (1) and that specifically recognizes guaiacol; (3) A complementary sequence of the sequence shown in (1) or (2); (4) An RNA sequence transcribed from the sequence shown in (1) or (2).

2. The nucleic acid aptamer according to claim 1, characterized in that The 5' end of the nucleotide sequence of the nucleic acid aptamer is bound to a label; The marker includes one or more of a fluorescent marker, a radioactive substance, a therapeutic substance, biotin, digoxin, a small peptide, si RNA and an enzyme.

3. The nucleic acid aptamer according to claim 2, characterized in that The 5' end of the nucleotide sequence of the nucleic acid aptamer is combined with a fluorescent marker.

4. The nucleic acid aptamer according to claim 1, characterized in that The nucleotide sequence of the nucleic acid aptamer is modified; the modification includes one or more of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization; And / or, the nucleotide sequence of the nucleic acid aptamer is derivatized; the derivatization includes deriving the backbone of the nucleotide sequence into a phosphorothioate backbone sequence or a peptide nucleic acid.

5. Use of the nucleic acid aptamer according to claim 1 in preparing a guaiacol detection kit, a guaiacol molecular probe or an aptamer biosensor.

6. A guaiacol detection kit, characterized in that: The kit comprises the nucleic acid aptamer according to any one of claims 1 to 4.

7. An aptamer biosensor, characterized in that: The aptamer biosensor comprises the nucleic acid aptamer according to any one of claims 1 to 4.

8. Use of the nucleic acid aptamer according to any one of claims 1 to 4, the guaiacol detection kit according to claim 6, or the aptamer biosensor according to claim 7 in detecting guaiacol.

9. A method for detecting guaiacol, characterized in that: The steps include: The nucleic acid aptamer according to claim 1 is mixed with graphene oxide, and a first light-proof reaction is performed, and then a sample to be tested is added, a second light-proof reaction is performed, and the fluorescence value of the supernatant is determined by centrifugation; The concentration of guaiacol was calculated based on the standard curve.

10. The method according to claim 9, characterized in that The concentration of the nucleic acid aptamer is 98-102 nM.

Images