PtoNAC90 gene for regulating formation of poplar wood and application of PtoNAC90 gene

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a PtoNAC90 gene for regulating formation of poplar wood and application of the PtoNAC90 gene. The nucleotide sequence of the PtoNAC90 gene is as shown in SEQ ID No. 1; the amino acid sequence of the PtoNAC90 gene is as shown in SEQ ID No. 2. According to the invention, a transgenic plant is obtained by overexpressing PtoNAC90 in 741 populus tomentosa, and compared with a wild type, the transgenic populus with overexpressed PtoNAC90 has the advantages that xylem thickness and lignin content are increased, which indicates that the PtoNAC90 gene has potential application value in improvement of populus wood yield, and wood fast growth and wood property new variety improvement can be regulated and controlled by using a genetic engineering technology.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular, to a PtoNAC90 gene for regulating poplar wood formation and its application. Background Art

[0002] Wood is the result of the annual accumulation of secondary xylem tissues during the secondary growth of forest trees. As an important renewable resource, wood can be used not only for biomass energy, but also as raw materials for construction, furniture production, and the paper industry.

[0003] The formation of wood is a complex dynamic biological process strictly regulated by gene encoding. Transcription factors play an important role in regulating wood formation. By regulating the gene expression level of key transcription factors for wood formation through genetic engineering means, and thus precisely regulating the growth and development process of wood, it is of great significance for improving wood properties and increasing the growth rate and yield of wood.

[0004] The NAC transcription factor family is one of the largest transcription factor families in plants. NAC proteins are widely involved in regulating plant seed germination, secondary cell wall growth, root development, leaf senescence, flower formation and senescence, and fruit ripening through various signaling pathways (see Han K, Zhao Y, Sun Y, Li Y. NACs, generalist in plant life [J]. Plant Biotechnol J, 2023, 21(12): 2433-2457). During the development of secondary xylem in poplar, there is a transcriptional regulatory network mediated by NAC-MYB (see Zhong R, McCarthy RL, Lee C, Ye ZH. Dissection of the transcriptional program regulating secondary wall biosynthesis during wood formation in poplar [J]. Plant Physiology, 2011, 157(3): 1452-1468; Zhong R, Ye ZH. Complexity of the transcriptional network controlling secondary wall biosynthesis [J]. Plant Science, 2014, 229: 193-207). Some NAC transcription factors (PtVNS / PtrWND) have been functionally identified, and overexpression of these genes can promote secondary wall thickening and xylem development (see Ohtani M, Nishikubo N, Xu B, et al. A NAC domain protein family contributing to the regulation of wood formation in poplar [J]. The Plant Journal, 2011, 67: 499-512). These theoretical research results provide important theoretical guidance for controlling the wood formation process at the molecular level, improving wood traits, and enhancing the economic value of woody plants.

[0005] Overexpressing key transcription factors through genetic engineering to regulate xylem development provides a new approach for promoting wood formation and improving wood properties. In this invention, overexpressing the transcription factor PtoNAC90 gene promotes xylem development, with the expectation of providing excellent strains for cultivating high-yield and fast-growing forest trees with improved wood properties.

[0006] In the regulatory network of xylem development in poplar, it remains to be explored and studied whether there are new NAC transcription factors that regulate xylem development. In previous laboratory studies, we obtained differentially expressed genes related to xylem development by sampling and transcriptome sequencing of developing xylem (see Zhang C, Zhang J, Liu Y, et al. Integrated Transcriptomic and Proteomic Analysis in the Roadmap of the Xylem Development Stage in Populus tomentosa[J]. Front Plant Sci, 2021, 12: 724559). Among them, PtoNAC90 is highly expressed in the xylem and may play a role in the process of wood development. However, the function of PtoNAC90 is unknown, and there is no clear report on its specific role in wood formation. Overexpressing PtoNAC90 using genetic engineering techniques can provide a new theoretical basis for cultivating new tree varieties with high yield, fast growth, and improved wood properties. Summary of the Invention

[0007] The present invention first provides a PtoNAC90 gene for regulating wood formation in poplar. The CDS nucleotide sequence of the PtoNAC90 gene is shown in SEQ ID NO.1, or a nucleotide sequence obtained by substituting and / or deleting and / or adding one or more bases to the nucleotide sequence shown in SEQ ID No.1.

[0008] The present invention secondly provides a PtoNAC90 protein for regulating wood formation in poplar. The amino acid sequence of the PtoNAC90 protein is shown in SEQ ID NO.2, or a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No.2.

[0009] The present invention also provides a biological material, which is any one of the following B1) to B8):

[0010] B1) A nucleic acid molecule encoding the above-mentioned PtoNAC90 protein;

[0011] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0012] B3) A recombinant vector containing the nucleic acid molecule described in B1),

[0013] B4) A recombinant vector containing the expression cassette described in B2);

[0014] B5) A recombinant microorganism containing the nucleic acid molecule described in B1);

[0015] B6) A recombinant microorganism containing the expression cassette described in B2);

[0016] B7) A recombinant microorganism containing the recombinant vector described in B3);

[0017] B8) A recombinant microorganism containing the recombinant vector described in B4).

[0018] In certain embodiments, the nucleic acid molecule is the nucleic acid molecule shown in any of the following 1), 2), 3), or 4):

[0019] 1) A DNA molecule or cDNA molecule whose coding sequence is the DNA molecule of SEQ ID No.1 in the sequence listing;

[0020] 2) A DNA molecule whose nucleic acid sequence is the DNA molecule of SEQ ID No.1 in the sequence listing;

[0021] 3) A cDNA molecule or genomic DNA molecule encoding the above-mentioned PtoNAC90 protein;

[0022] 4) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the above-mentioned PtoNAC90 protein.

[0023] The present invention also provides the application of the PtoNAC90 gene for regulating poplar wood formation as described above, or the PtoNAC90 protein for regulating poplar wood formation as described above, or the above-mentioned biological material in regulating poplar wood formation.

[0024] In certain embodiments, the application is implemented by overexpressing the PtoNAC90 gene.

[0025] In certain embodiments, the overexpression is carried out by constructing a plant overexpression vector using the PtoNAC90 gene.

[0026] The present invention also provides a primer pair for amplifying a nucleic acid molecule fragment encoding the above-mentioned PtoNAC90 gene;

[0027] In certain embodiments, the amplification primer pair is: the forward primer is as shown in SEQ ID NO.3, and the reverse primer is as shown in SEQ ID NO.4.

[0028] Finally, the present invention provides a method for regulating poplar wood formation, the method comprising the step of overexpressing the above-mentioned PtoNAC90 gene.

[0029] Compared with the prior art, the present invention has at least the following beneficial effects:

[0030] The present invention provides the application of the PtoNAC90 gene in regulating wood formation. By constructing an overexpression vector of 35S:PtoNAC90 and introducing it into Populus tomentosa Carr. 741 by Agrobacterium-mediated transformation, PtoNAC90 overexpressing poplars were screened. Paraffin sections were made of the cross-sections of the stems of 3-month-old wild-type and transgenic plants, and microscopic observation showed that the secondary xylem thickness of the overexpression lines was thicker than that of the wild-type in the cross-sections of the same stem nodes. Measurement of lignin content showed that the lignin content percentage of the overexpression lines was 5.8 - 6.0% higher than that of the wild-type.

[0031] Based on the comprehensive phenotypic analysis results of genetic materials, the up-regulation of PtoNAC90 can change the wood components, increase the lignin content, and promote the development of secondary xylem. The above results all indicate that PtoNAC90 plays an important role in the process of wood formation. The PtoNAC90 gene has potential application value in improving poplar wood yield, can be applied in production by genetic engineering technology, and has important practical significance for cultivating fast-growing poplar wood and breeding new varieties with improved wood properties. Description of the Drawings

[0032] Figure 1 Identification of PtoNAC90 overexpressing transgenic plants of Populus tomentosa Carr.

[0033] A: PCR identification of transgenic plants; B: RT-qPCR identification of the expression level of PtoNAC90 in transgenic plants; Note: M: Marker 2000; 5: negative control; 1: positive control; 2 - 3: two lines of transgenic PtoNAC90.

[0034] Figure 2 Phenotypic analysis of wild-type and PtoNAC90 overexpressing transgenic plants; A: WT and transgenic plants; B, C: paraffin sections of cross-sections of WT and transgenic plant stems; D: lignin content measurement; E: statistics of secondary xylem thickness. Detailed Embodiments

[0035] To make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following will be described in detail with reference to the drawings and specific embodiments.

[0036] PtoNAC90 gene

[0037] CDS sequence (SEQ ID NO.1):

[0038] ATGATTCCACCAGGGTTTCGATTTTACCCAACAGAAGAAGAACTGGTCTCTTTTTATCTGCATAACAAGCTTGAAGCAAGGAGAGAGGACCTCCTACGGGTTATGGACCGCCTTATACCGGTTCTTGATGTATACGGGTTCAATCCATGGGAGCTTCCGCAATTTTCAGGAGATTTGTGCCATGGAGATCCTGAAGAATGGTTTTTCTTCATTCGAAGGCAAGAAAGCGAAGCCCGTGGAGGGAGGCCGAAGCGACTCACAAGTAGTGGATATTGGAAAGCTACTGGCTCTCCTTCTCATGTTTACTCTTCCAACAGTAATCGTAGCATTGGCGAGAAAAGAACCATGGTGTTCTACGAGGGAAGGGCTCCAAGAGGACGAAAAACCGAGTGGAAAATGAACGAATATAAGGCTATGGAAGAAGAAGCAGCATCATATTCAAATGGTGGACATCCAAGGCTAAGGCAAGAATTCAGCTTGTGTCGGGTTTACAAGAAGTCCAAATTCGTGCGAGCATTTGATAGACGGCCATCAGGAGTGGAGATGGGTACTGCGATGAGAGCTCAAGCAACCCCCGGCAACGAGGTCACATCATCTCATCAGAACCTTTCAACGGCGGCGACACCATGCTCGCATGATAGATTATCCTTAGGAGACCATGGCCAGACCTTCCAAACTGGAGAAAGTAGCTACATGGCAAGCATCGTTACTGACAATGAACCTTTTTGGGACTGGGAGCAATTAGAATGGTGCTACAGTGACAGGGACAATATTGAAAAAGTCCAATCTGCATAG;

[0039] Protein sequence (SEQ ID NO.2):

[0040] MIPPGFRFYPTEEELVSFYLHNKLEARREDLLRVMDRLIPVLDVYGFNPWELPQFSGDLCHGDPEEWFFFIRRQESEARGGRPKRLTSSGYWKATGSPSHVYSSNSNRSIGEKRTMVFYEGRAPRGRKTEWKMNEYKAMEEEAASYSNGGHPRLRQEFSLCRVYKKSKFVRAFDRRPSGVEMGTAMRAQATPGNEVTSSHQNLSTAATPCSHDRLSLGDHGQTFQTGESSYMASIVTDNEPFWDWEQLEWCYSDRDNIEKVQSA*;

[0041] Example 1

[0042] In this invention, transgenic poplar plants overexpressing PtoNAC90 were obtained through Agrobacterium-mediated genetic transformation of Populus tomentosa Carr. cv. 741. Through phenotypic observation, it was found that the xylem thickness and lignin content of the transgenic poplars overexpressing PtoNAC90 increased. The research of this invention has important theoretical guiding significance for cultivating new forest tree varieties with high quality, fast growth and improved wood properties.

[0043] (1) Construction of overexpression vector

[0044] The total RNA of Populus tomentosa Carr. cv. 741 was extracted using the kit from Tiangen Biotech (Beijing) Co., Ltd., and after reverse transcription into cDNA, it was used as a template. The CDS sequence of PtoNAC90 was obtained by PCR amplification. The amplification primers are as follows:

[0045] F: 5'-ATGATTCCACCAGGGTTTCG-3' (SEQ ID NO.3),

[0046] R: 5'-CTATGCAGATTGGACTTTTTCAATATTG-3' (SEQ ID NO.4).

[0047] The full length of the PtoNAC90 gene is 807 bp. After correct sequencing and alignment, it was ligated to the plant expression vector pBI121 that had been digested with double enzymes to construct the 35S:NAC90 vector. After correct re-sequencing, the vector was stored.

[0048] (2) Transformation of Populus tomentosa Carr. cv. 741 by leaf disc method and identification of positive seedlings

[0049] The plasmid of the above-mentioned correctly sequenced 35S:PtoNAC90 vector was transferred into the competent cells of Agrobacterium tumefaciens GV3101, and the bacterial solution with correct PCR detection was stored for the transformation of Populus tomentosa Carr. cv. 741.

[0050] After the positive bacteria were streaked and cultured, single colonies were picked and inoculated into YEB liquid medium (containing 50 mg / L Kan + 50 mg / L Rif). After shaking culture at 28 °C for 24 - 36 h, the culture was expanded until the OD600 of the bacterial solution was about 0.6.

[0051] Centrifuge at 4500 rpm for 20 min, discard the supernatant, resuspend the cells with an equal volume of resuspension solution, and shake culture at 28 °C until OD600 is about 0.4 - 0.6.

[0052] Cut the leaves of 1 - month - old and vigorously growing tissue - cultured seedlings into small leaf discs, suspend them in the infection solution for 15 min, then spread them on the co - culture medium and culture them in the dark for 2 d. Then transfer the co - cultured leaf discs to the callus induction medium (containing 30 mg / L Kan) and culture them in the dark for 2 - 3 weeks. Transfer the leaf discs with the selected callus to the shoot induction medium, induce shoots under light. After adventitious shoots grow, cut them off and transfer them to the rooting medium for culture.

[0053] Cut the leaves of the putative positive seedlings with roots, extract the genomic DNA of the leaves using a kit, and detect whether the 35S:NAC90 vector has been transferred into the poplar genome. Then extract the total RNA and quantitatively detect the expression level of PtoNAC90 ( Figure 1 ).

[0054] (3) Tissue sectioning and statistics

[0055] Transplant the wild - type Populus tomentosa and the over - expressing Populus tomentosa into the soil at the same time. After culturing in the greenhouse for 3 months, take phenotype photos. Use a sharp blade to take the same stem segments of the wild - type and transgenic lines, immerse them in 2.5% glutaraldehyde, and fix them by vacuum for 1 h. After dehydration, clearing, infiltration with paraffin wax, sectioning, dewaxing, staining and mounting, make slides for microscopic observation and photography, and use Image J to statistically analyze the thickness of the secondary xylem ( Figure 2 ).

[0056] (4) Determination of lignin content

[0057] We scraped the xylem of the stems of wild-type and transgenic lines and measured their total lignin content. After grinding the xylem samples into powder and drying them, the pigments were extracted completely, followed by vacuum drying and sieving. 5 mg of the powder was weighed, and 7.5 ml of glacial acetic acid, 2.5 ml of acetyl bromide, and 400 μL of perchloric acid were added successively, and the reaction was carried out at 70 °C for 2 h. 20 mL of 2 M NaOH was used to terminate the reaction, and then it was supplemented to 50 ml with CH3COOH. The A280 value was detected by an ultraviolet spectrophotometer. The percentage of the total lignin content in the sample was calculated according to the following formula: lignin content = A280 / (ε·d·c), where ε = 20.09 L / cm·g; d, optical path, the optical path in a quartz cuvette is 1 cm; c, sample concentration, g / L. The absorbance value of acetylated lignin at 280 nm was measured and statistically analyzed.

[0058] The present invention provides the application of the PtoNAC90 gene in regulating wood formation. By constructing a 35S:PtoNAC90 overexpression vector and introducing it into Populus tomentosa Carr. 741 by Agrobacterium-mediated transformation, PtoNAC90 overexpressing poplars were screened. Paraffin sections were made of the cross-sections of the stems of 3-month-old wild-type and transgenic plants, and through microscopic observation, it was found that compared with the wild-type, the secondary xylem thickness of the overexpressing lines was thicker in the cross-sections of the same stem nodes. By measuring the lignin content, it was found that the lignin content percentage of the overexpressing lines was 5.8 - 6.0% higher than that of the wild-type.

[0059] Based on the above phenotypic analysis results of genetic materials, the up-regulation of PtoNAC90 can change the wood components, increase the lignin content, and promote the development of secondary xylem. The above results all indicate that PtoNAC90 plays an important role in the process of wood formation. The PtoNAC90 gene has potential application value in improving the wood yield of poplars, can be applied to production by genetic engineering technology, and has important practical significance for cultivating fast-growing poplar wood and breeding new varieties with improved wood properties.

[0060] The above is the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle described in the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A PtoNAC90 gene for regulating poplar wood formation, characterized in that: The CDS nucleotide sequence of the PtoNAC90 gene is shown in SEQ ID NO.1, or a nucleotide sequence obtained by replacing and / or deleting and / or adding one or more bases of the nucleotide sequence shown in SEQ ID No.

1.

2. A PtoNAC90 protein for regulating poplar wood formation, characterized in that: The amino acid sequence of the PtoNAC90 protein is as shown in SEQ ID NO.2 or a protein obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.

2.

3. Biological material, which is any one of the following B1) to B8): B1) a nucleic acid molecule encoding the PtoNAC90 protein according to claim 2; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); B9) A transgenic plant containing the recombinant vector described in B1).

4. The biomaterial according to claim 3, characterized in that: The nucleic acid molecule is the nucleic acid molecule shown in 1) or 2) or 3) or 4) below: 1) The coding sequence is a DNA molecule or cDNA molecule of SEQ ID No. 1 in the sequence list; 2) The nucleic acid sequence is the DNA molecule of SEQ ID No. 1 in the sequence list; 3) a cDNA molecule or a genomic DNA molecule encoding the PtoNAC90 protein according to claim 2; 4) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the PtoNAC90 protein of claim 2.

5. The PtoNAC90 gene for regulating the formation of poplar wood as claimed in claim 1, or the PtoNAC90 protein for regulating the formation of poplar wood as claimed in claim 2, or the biomaterial overexpressing the PtoNAC90 gene as claimed in claims 3-4, or the use of the biomaterial as claimed in claims 3-4 in regulating the formation of poplar wood.

6. The use according to claim 5, characterized in that: The application is implemented by overexpressing the PtoNAC90 gene.

7. The use according to claim 6, characterized in that: The overexpression is carried out by constructing a plant overexpression vector using the PtoNAC90 gene.

8. A primer pair for amplifying a nucleic acid molecule fragment encoding the PtoNAC90 gene according to claim 1.

9. The primer pair according to claim 6, characterized in that: The amplification primer pair is as follows: the forward primer is shown in SEQ ID NO.3, and the reverse primer is shown in SEQ ID NO.

4.

10. A method for regulating the formation of poplar wood, characterized in that: The method comprises the step of overexpressing the PtoNAC90 gene of claim 1.

Images