GmG3PDH8 gene and application of GmG3PDH8 gene in regulation and control of soybean resistance to soybean mosaic virus

Abstract

The invention belongs to the field of plant genetic engineering, and discloses a GmG3PDH8 gene and an application thereof in regulation and control of soybean mosaic virus resistance of soybeans, the sequence of the GmG3PDH8 gene is shown as SEQ ID NO.1, and the SMV disease resistance of soybean plants is positively regulated and controlled. Based on the disease resistance of the GmG3PDH8 gene, the gene as well as a recombinant vector, a transgenic cell or a recombinant bacterium containing the gene can be applied to regulation and control of soybean mosaic virus resistance of soybeans, and can also be applied to cultivation of soybean plants resistant to soybean mosaic diseases, so that a good foundation is laid for sustainable development of the soybean industry; an important gene resource is provided for molecular breeding for improving the resistance of soybeans to the soybean mosaic virus.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and particularly to the GmG3PDH8 gene and its application in regulating the resistance of soybeans to soybean mosaic virus. Background Art

[0002] Soybeans are rich in high-quality protein, unsaturated fatty acids, calcium, and B vitamins, and are an important source of high-quality protein in the diets of Chinese residents. However, during the growth and development of soybeans, they are affected by many factors and infected with soybean mosaic virus, resulting in diseases, which in turn have a serious impact on the growth and development of soybeans.

[0003] Soybean mosaic virus disease is an important soybean virus disease that occurs worldwide and is caused by soybean mosaic virus (i.e., SMV). This disease is an important factor affecting yield in major soybean-producing countries such as the United States, Brazil, China, and Argentina, and it also occurs widely in major soybean-producing areas in China. Soybean mosaic virus mainly damages leaves and has strong infectivity. The typical symptoms are plant dwarfing, leaves showing yellow-green mosaic and wrinkling, leaf margins curling downward or leaves twisting, with a hard and brittle texture, veins turning brown, and sometimes many blister-like protrusions along both sides of the veins. Soybean mosaic virus not only causes a reduction in soybean yield but also decreases the quality of soybean grains. The resulting mottled soybean seed coats form brown-spotted grains, reducing the price of commercial soybeans.

[0004] Therefore, conducting research on soybean resistance to soybean mosaic virus helps to identify SMV resistance genes and clarify the soybean anti-SMV regulatory network, effectively improve the actual yield and quality of soybeans, provide a feasible solution for cultivating soybean plants resistant to soybean mosaic virus, and thus lay a good foundation for the sustainable development of the soybean industry.

[0005] However, there is currently no good control method for soybean mosaic virus disease, and cultivating disease-resistant varieties is the most economical and effective method. And how to cultivate soybean varieties resistant to soybean mosaic virus is a problem that needs to be solved currently.

[0006] Therefore, the prior art needs to be further improved. Summary of the Invention

[0007] In view of the above problems, the present invention provides a GmG3PDH8 gene and the application of this gene in regulating the resistance of soybeans to soybean mosaic virus. This gene positively regulates the resistance of soybeans to soybean mosaic virus, and the cultivated GmG3PDH8 overexpressing soybean plants have stable and excellent resistance to soybean mosaic virus.

[0008] To solve the above problems, the present application provides the following technical solutions:

[0009] In a first aspect, the present application provides a GmG3PDH8 gene, and the gene sequence is as shown in SEQ ID NO.1.

[0010] A new gene GmG3PDH8 of the GmG3PDH gene family was isolated from soybean by homologous cloning in this application, and the gene sequence was obtained by sequencing as shown in SEQ ID NO.1. Expression pattern analysis showed that GmG3PDH8 was mainly expressed in seeds, and fluorescence quantitative PCR detection found that this gene was induced to express more after virus infection.

[0011] To clarify the function of GmG3PDH8 during the infection process of soybean mosaic virus (SMV), soybean plants with silenced and overexpressed genes were constructed. The experimental results showed that soybean plants with silenced genes accumulated more soybean mosaic virus than the control plants; while compared with the control soybeans, the amount of soybean mosaic virus carried by soybean plants overexpressing GmG3PDH8 was significantly reduced, showing excellent resistance to soybean mosaic virus.

[0012] Therefore, this gene is an SMV resistance gene, positively regulating the SMV resistance of soybean plants. This gene provides a new feasible solution for the cultivation of high-quality disease-resistant soybeans.

[0013] In the second aspect, this application also provides a protein encoded by the above-mentioned GmG3PDH8 gene.

[0014] The corresponding protein sequence can be obtained by analyzing the nucleotide sequence of GmG3PDH8 as shown in SEQ ID NO.1, binding its protein sequence to a recombinant vector, constructing an overexpression vector, and using it for the research of the GmG3PDH8 gene or the construction of overexpressed plants, etc.

[0015] In the third aspect, this application also provides a recombinant vector or recombinant bacterium of the above-mentioned GmG3PDH8 gene.

[0016] The above-mentioned recombinant vector is pMDC83; the recombinant bacteria are Escherichia coli DH5α and Agrobacterium tumefaciens EHA105.

[0017] In the fourth aspect, this application also provides the application of the above-mentioned GmG3PDH8 gene, and the recombinant vector or recombinant bacterium containing this GmG3PDH8 gene in regulating the soybean mosaic virus resistance of soybeans.

[0018] Analysis of the gene - silenced plants and over - expressed plants of GmG3PDH8 shows that the GmG3PDH8 gene positively regulates the resistance of soybean plants to SMV. On the one hand, the expression level of GmG3PDH8 can be reduced by gene knockout, gene silencing and other methods, thereby down - regulating the resistance of soybean plants to soybean mosaic virus. The obtained transgenic plants have higher SMV infectivity and can be used as experimental materials for research. On the other hand, the expression level of the GmG3PDH8 gene in plants can be increased by gene over - expression, thereby improving the SMV resistance of soybean plants, which is a method for cultivating high - quality disease - resistant soybean germplasm.

[0019] Fifthly, the present application also provides the application of the above - mentioned GmG3PDH8 gene, recombinant vector containing the GmG3PDH8 gene, transgenic cell or recombinant bacterium in cultivating soybean plants resistant to soybean mosaic disease.

[0020] Experiments have proved that the over - expressed soybean plants of the GmG3PDH8 gene show excellent SMV disease resistance. On the diseased plants inoculated with the SC3 strain, the symptoms of soybean mosaic virus are hardly observable, and the symptoms are significantly alleviated. The results of Western blot analysis also show that the amount of SMV accumulated in the over - expressed soybean plants is much less than that of the control.

[0021] Sixthly, the present application provides a method for cultivating soybean plants resistant to soybean mosaic disease. The method is to construct GmG3PDH8 over - expressed soybean plants, thereby obtaining soybean plants resistant to soybean mosaic virus.

[0022] Optionally, the cultivation method is specifically: constructing a GmG3PDH8 recombinant expression vector and inoculating the GmG3PDH8 recombinant expression vector onto the cotyledon nodes of soybeans.

[0023] Optionally, the over - expression vector is pMDC83; the transformation method is: connecting GmG3PDH8 to the expression vector pMDC83 through multiple cloning sites, heat - shock transforming it into Agrobacterium tumefaciens EHA105, and using the Agrobacterium - mediated method for genetic transformation of the receptor variety.

[0024] Seventhly, the present application also provides a pair of specific primers for specifically amplifying the aforementioned GmG3PDH8 gene, and the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0025] Eighthly, the present application also provides the application of the above - mentioned specific primers in identifying the GmG3PDH8 gene.

[0026] The present invention has the following beneficial effects:

[0027] 1. The present invention first isolated and identified the GmG3PDH8 gene, and for the first time discovered that this gene is an SMV resistance gene, which positively regulates the SMV resistance of soybean plants. This gene provides a new feasible solution for the cultivation of high-quality disease-resistant soybeans, provides important gene resources for molecular breeding to improve the resistance of soybeans to soybean mosaic virus, and lays a good foundation for the sustainable development of the soybean industry.

[0028] 2. Based on the disease resistance of the GmG3PDH8 gene, this gene, recombinant vectors containing this gene, transgenic cells or recombinant bacteria can be applied to regulate the resistance of soybeans to soybean mosaic virus. On the one hand, the expression level of GmG3PDH8 can be reduced by means such as gene knockout and gene silencing, thereby down-regulating the resistance of soybean plants to soybean mosaic virus. The obtained transgenic plants have higher SMV infectivity and can be used as experimental materials for research. On the other hand, by the method of gene overexpression, the expression level of the GmG3PDH8 gene in plants is increased, thereby improving the SMV resistance of soybean plants, which is a method for cultivating high-quality disease-resistant soybean germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The sequence alignment results; wherein, seq1 is Glyma.19g053500, and seq2 is soybean GmG3PDH8;

[0030] Figure 2 shows the specific expression of the GmG3PDH gene in different tissues of soybeans;

[0031] Figure 3 shows the expression of the GmG3PDH family genes after being infected by SMV;

[0032] Figure 4 shows the change in SMV resistance of the GmG3PDH8 silencing material; A is the leaf phenotype; B is the detection result of Western blot of SMV in the leaves;

[0033] Figure 5 shows the change in SMV resistance of the GmG3PDH8 overexpression material; the left figure is the leaf phenotype; the right figure is the detection result of Western blot of SMV in the leaves. DETAILED DESCRIPTION OF THE INVENTION

[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0035] Example 1 Cloning and sequence analysis of GmG3PDH8 gene

[0036] 1. Experimental methods and steps

[0037] (1) Cloning of GmG3PDH8 gene

[0038] Download the GmG3PDH8 gene of soybean, and design the homologous upstream primer as

[0039] GmG3PDH8-F: ATGGCTCCAGCCTTGGAAG (such as SEQ ID NO.2), and the downstream primer GmG3PDH8-R is: GAAGGACCTGGGTAGCTTCT (such as SEQ ID NO.3), and clone its homologous genes in soybean varieties Essex and Nannong 1138-2.

[0040] First, use the KARROTEN kit to extract the RNA of soybean variety Essex, and then use this extracted RNA as a template, use Oligo(dT) as a primer to reverse transcribe to obtain cDNA; then, use this cDNA as a template, and use the aforementioned designed homologous upstream primer, homologous downstream primer and the high-fidelity enzyme of Novoprotein for amplification, and send the amplification product to the company for sequencing.

[0041] (2) Sequence alignment of GmG3PDH8 gene

[0042] Perform sequence alignment and analysis of the sequencing results of the amplification product on NCBI.

[0043] 2. Experimental results and analysis

[0044] The sequencing results of the soybean GmG3PDH8 gene are specifically shown in SEQ ID NO.1. The length of this gene is 1140bp. Compare this gene with the sequence Glyma.19g053500 (i.e., Figure 1 seq-1) with the highest homology in soybean in NCBI. The homology between the two is 98.87%. The specific comparison results are shown in Figure 1 .

[0045] Example 2 Tissue-specific expression of GmG3PDH gene

[0046] 1. Experimental methods and procedures

[0047] Analyze the expression of GmG3PDH gene in different tissues such as flowers, leaves, root nodules, pods, roots, root hairs, seeds, shoot apical meristem (SAM), and stems.

[0048] The analysis method for tissue-specific expression is as follows: Download the tissue expression data of GmG3PDH gene from the Phytozome database and visualize the data using TBtools.

[0049] 2. Experimental results and analysis

[0050] From Figure 2 the experimental results, it is obtained that GmG3PDH9 is only slightly expressed in flowers, leaves, pods, and seeds, and the rest of GmG3PDH are expressed in all tissues. Among them, GmG3PDH8 is highly expressed in seeds. This result indicates that these GmG3PDH family genes may be selectively expressed during the growth and development of soybean.

[0051] Example 3 Expression patterns of GmG3PDH family members in response to SMV infection

[0052] 1. Experimental methods and procedures

[0053] Inoculate SMV onto the susceptible cultivar Nannong 1138-2, and collect leaves for transcriptome sequencing when mosaic symptoms appear.

[0054] 2. Experimental results and analysis

[0055] According to the transcriptome data of soybean leaves after SMV infection, it is found that: all members of the GmG3PDH family are up-regulated to varying degrees, among which the expression level of GmG3PDH8 is the highest, as shown in Figure 3 . Select GmG3PDH8 for subsequent experiments.

[0056] Example 4 Changes in disease resistance of GmG3PDH8-silenced plants to SMV

[0057] 1. Experimental methods and procedures

[0058] To detect whether GmG3PDH8 is involved in the regulation of SMV infection in soybean, a gene silencing material (S G3PDH ) of G3PDH8 gene in soybean was constructed using the virus-induced gene silencing (BPMV-VIGS) method, and the BPMV empty vector was used as a control (V). The S G3PDHBoth S and V were inoculated onto the disease-resistant cultivar Rsv1 and the disease-susceptible cultivar Essex, respectively, and then inoculated with the SMV G7 strain, and the virus proliferation was monitored over time.

[0059] (1) The construction steps of the G3PDH8 gene-silencing material were as follows: A 135-bp sequence of GmG3PDH from S40-S174 was amplified by specific primers S G3PDH -F and S G3PDH -R, and then ligated into RNA2 of BPMV to form the recombinant vector BPMV-RNA2-GmG3PDH. BPMV-RNA1 and BPMV-RNA2-GmG3PDH were transcribed in vitro and mixed together for rubbing inoculation of recombinant BPMV on soybean leaves. The in vitro transcription reagents were purchased from NEB, and the reaction system was configured as follows:

[0060]

[0061]

[0062] Incubate at 37 °C for 3-4 h. Take 1 μl of the above in vitro transcription product, and detect the RNA yield of in vitro transcription by 1.0% agarose gel electrophoresis. The remaining in vitro transcription product BPMV-RNA1 was mixed with the recombinant BPMV-RNA2 in equal amounts for in vitro inoculation experiments. The primer sequences were as follows:

[0063] S G3PDH -F: AGTGTGGCACAGAACAACTC (SEQ ID NO.4);

[0064] S G3PDH -R: GCTAAGCCTGAGGGTATTGG (SEQ ID NO.5).

[0065] (2) The method of inoculating S G3PDH and V onto the disease-resistant cultivar Rsv1 and the disease-susceptible cultivar Essex respectively: At 10-14 days after the in vitro inoculation mixture, observe the phenotypic changes of the inoculated leaves and the first and second trifoliolate leaves of the inoculated soybean. If typical mosaic symptoms are visible to the naked eye, it indicates successful in vitro inoculation. Take the mosaic symptom leaves of S G3PDH and the empty vector (V) and grind them thoroughly in a mortar, and then rub and inoculate them onto the first true leaves of soybeans.

[0066] (3) Virus monitoring method: Observe the disease incidence of the plants visually within one week after rubbing inoculation. Inoculate SMV on the first trifoliolate leaves, and perform Western blot experiments on the diseased plants and the control group to detect the SMV virus content in the plants.

[0067] 2. Experimental results and analysis

[0068] (1) Phenotypically, Rsv1 plants inoculated with S G3PDH showed more obvious symptoms after being infected with the G7 strain. More necrotic spots appeared on these plants, as shown in Figure 4 A; while the control had normal symptoms.

[0069] (2) Western blot analysis showed that in Rsv1, compared with V, S G3PDH plants accumulated a high level of SMV (see the lower part of Figure 4 B). In Essex soybeans, SMV protein accumulated earlier in S G3PDH plants than in V plants (the upper part of Figure 4 B). Therefore, the above results indicate that GmG3PDH8 in Rsv1 plants may have a positive regulatory effect on SMV resistance.

[0070] Example 5 Changes in the disease resistance of plants overexpressing GmG3PDH8 to SMV

[0071] 1. Experimental methods and procedures

[0072] (1) Construction of the overexpression recombinant vector OE G3PDH of GmG3PDH8

[0073] Using the virus-induced gene silencing (BPMV-VIGS) method to construct overexpression materials (OE G3PDH ) of the G3PDH8 gene in soybeans. The specific steps are as follows: Amplify the full-length CDS sequence OEGmG3PDH8 of GmG3PDH8 by specific primers OE-F: ATGGCTCCAGCCTTGGAA (SEQ ID NO.6), OE-R: GAAGGACCTGGGTAGC (SEQ ID NO.7). Linearize the BPMV-RNA2 vector and ligate it with OEGmG3PDH8 to obtain the overexpression recombinant vector pRNA2-OE G3PDH8 .

[0074] (2) Construction of overexpression plants

[0075] Mix the in vitro transcripts of pRNA2-OE G3PDH and pRNA1 in equal amounts, and rub-inoculate them onto soybean leaves. When the upper leaves unfold, observe the disease occurrence. Collect the diseased leaves, extract RNA, and perform fluorescence quantitative PCR to identify the expression of G3PDH. Plants with up-regulated expression of G3PDH are determined as overexpression positive plants, and these overexpression plants are labeled as OE G3PDH . The BPMV empty vector is used as a control (V), and OE G3PDHV was inoculated onto the susceptible cultivar Nannong 1138-2, and then inoculated with the SMV SC3 strain, and the virus proliferation was monitored over time.

[0076] In vitro transcription method: Refer to Example 4.

[0077] (3) Virus monitoring method: Refer to Example 4.

[0078] 2. Experimental results and analysis

[0079] Phenotypically, on the susceptible OE plants inoculated with the SC3 strain, the symptoms of soybean mosaic virus were very mild or hardly visible (see G3PDH A). Western blot analysis showed that in Nannong 1138-2, compared with V, the amount of SMV accumulated in OE plants was very small and almost undetectable ( Figure 5 B). G3PDH In summary, GmG3PDH8 can be overexpressed in soybeans to obtain plants with stable improved resistance to SMV. Figure 5 B).

[0080] It can be understood that for those of ordinary skill in the art, equivalent substitutions or changes can be made according to the technical solutions of the present invention and the inventive concept of the present invention, and all such changes or substitutions should fall within the protection scope of the appended claims of the present invention.

[0081] It can be understood that for those of ordinary skill in the art, equivalent substitutions or changes can be made according to the technical solutions of the present invention and the inventive concept of the present invention, and all such changes or substitutions should fall within the protection scope of the appended claims of the present invention.

Claims

1. GmG3PDH8 gene, characterized in that Its gene sequence is shown in SEQ ID NO.

1.

2. A protein, characterized in that Encoded by the GmG3PDH8 gene of claim 1.

3. A recombinant vector or recombinant bacterium containing the GmG3PDH8 gene as claimed in claim 1. 4 . Use of the GmG3PDH8 gene as claimed in claim 1 , and a recombinant vector or recombinant bacteria containing the GmG3PDH8 gene in regulating soybean mosaic virus resistance.

5. Use of the GmG3PDH8 gene as claimed in claim 1, and a recombinant vector or recombinant bacteria containing the GmG3PDH8 gene in cultivating soybean plants resistant to soybean mosaic disease.

6. A method for cultivating soybean plants resistant to soybean mosaic disease, characterized in that: GmG3PDH8 overexpressing soybean plants were constructed to obtain soybean plants resistant to soybean mosaic virus disease.

7. The cultivation method according to claim 6, characterized in that: The cultivation method comprises the following steps: constructing a GmG3PDH8 recombinant expression vector and inoculating the GmG3PDH8 recombinant expression vector into soybean leaves.

8. A specific primer, characterized in that Specifically amplifying the GmG3PDH8 gene as claimed in claim 1, the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

9. Use of the specific primers as claimed in claim 8 in identifying the GmG3PDH8 gene.

Images