Universal plasmid quality control product for detecting vibrio parahaemolyticus virulence gene in food as well as preparation method and application of universal plasmid quality control product

By developing quality control DNA quality control products containing full-length sequences of Vibrio parahaemolytic Vitiligo tdh, Trh and Tlh virulence genes, the problem of difficult to provide accurate quality control products for multiple gene detection in the prior art is solved, and the accuracy and standardization of Vibrio parahaemolytic Vitiligo gene detection is achieved, and it is suitable for a variety of molecular biological detection methods.

CN120192990APending Publication Date: 2025-06-24SHANGHAI MUNICIPAL CENT FOR DISEASE CONTROL & PREVENTION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411562972.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The prior art is difficult to provide a reliable and accurate quality control product that can be used for multiple detection of Vibrio parahaemolytic virulence genes in foods. Especially in multiple gene detection, it is difficult to ensure the accuracy of the test and the comparability of the results.

Method used

A quality control DNA quality control product containing the full-length sequence of three virulence genes of Vibrio parahaemolyticus Vibrio parahaemolyticus was developed. These genes were fused and connected to the plasmid through seamless cloning technology to form a universal plasmid quality control product.

Benefits of technology

This quality control product can provide accuracy assessment and standardization for the detection of three virulence genes of Vibrio parahemolyticus. It has the characteristics of good stability and high accuracy. It is suitable for a variety of molecular biological detection methods, such as PCR, real-time fluorescence quantitative PCR and tNGS.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192990A_ABST
    Figure CN120192990A_ABST
Patent Text Reader

Abstract

The invention relates to a universal plasmid quality control product for detecting vibrio parahaemolyticus virulence genes in food as well as a preparation method and application of the universal plasmid quality control product. The three virulence genes of the vibrio parahaemolyticus comprise a gene tdh for coding heat-resistant direct hemolysin, a gene trh for coding related heat-resistant hemolysin and a gene tlh for coding heat-labile hemolysin, and positive control can be provided for detection of the three virulence genes of the vibrio parahaemolyticus at the same time. The constructed plasmid nucleic acid quality control product is a nucleic acid complete sequence recombinant plasmid containing three virulence genes of vibrio parahaemolyticus, is not limited by the specificity of a target sequence, can be applied to the quality control of PCR (Polymerase Chain Reaction), real-time fluorescent quantitative PCR, tNGS and other molecular detection which take a nucleic acid sequence as a target, and has the characteristics of wide application range, good stability and high accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of food safety detection and risk supervision, and in particular to a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, a preparation method and application thereof. Background Art

[0002] Vibrio parahaemolyticus, a Gram-negative halophilic bacterium, is widely found in marine environments and is one of the main pathogens of foodborne diseases. The bacterium causes acute gastroenteritis in humans by contaminating food, manifesting as diarrhea, nausea, and vomiting. In severe cases, it can lead to wound infections, sepsis, and even life-threatening conditions. According to statistics, Vibrio parahaemolyticus causes approximately 20,000 cases of food poisoning in Japan each year. Data from my country's National Center for Food Safety Risk Assessment (CFSA) shows that nearly 4.95 million people in my country become ill each year from consuming contaminated aquatic products or mixed foods containing aquatic products. Vibrio parahaemolyticus is one of the leading causes of bacterial food poisoning in coastal areas.

[0003] Hemolysins are the most important virulence factors of Vibrio parahaemolyticus. These include thermostable direct hemolysin (TDH), TDH-related hemolysin (TRH), and thermolabile hermolysin (TLH), encoded by three virulence genes: tdh, trh, and tlh, respectively. The tlh gene, in particular, is considered an ideal target for detecting V. parahaemolyticus due to its species-specificity. TDH lyses red blood cells, producing the Kanagawa phenomenon (KP). TRH is enterotoxic and often present in KP-negative but pathogenic strains. The presence of virulence genes is a key marker for distinguishing pathogenic from nonpathogenic V. parahaemolyticus. However, the prevalence of the virulence genes tdh (0.4%) and trh (1.8%) in foodborne V. parahaemolyticus in my country is much lower than in isolates from clinical cases (97.5%). The significant difference in virulence gene carrier rates between the two types of samples presents significant challenges in the handling and tracing of food poisoning incidents. Due to the interference of numerous non-pathogenic bacteria, the detection and analysis of foodborne samples, involving a tedious and complex process of culture, isolation, and identification, often makes it difficult to capture truly virulent pathogens, thus missing the golden opportunity for epidemiological investigations. Therefore, while testing for Vibrio parahaemolyticus, it is important to focus on pathogenic strains and the detection and analysis of virulence genes to enable a rapid response to food poisoning incidents, further food safety testing and research, and prevent the occurrence of foodborne illnesses.

[0004] At present, the virulence genes of foodborne Vibrio parahaemolyticus are mainly detected by molecular methods based on nucleic acid detection, such as PCR, real-time fluorescence quantitative PCR, and sequencing (tNGS). These methods are highly sensitive and have high requirements for experimental conditions and operations. If affected by the sample or operation process, false positive or false negative results are very likely to occur. Therefore, reference substances must be used to ensure the accuracy of the test. In addition, when performing quantitative analysis by real-time fluorescence quantitative PCR, quality control products with traceable values ​​are also required to establish a standard curve. In recent years, the rapid development and widespread application of multiple detection technologies have also urgently required a quality control product that can provide a reference for multiple gene detection at the same time to ensure the accuracy of the test and achieve comparability of multiple methods.

[0005] Current quality control products include template DNA extracted from bacterial cultures, purified PCR amplification products, and construction of recombinant plasmids containing sequences identical to the target gene fragment. Extracting template DNA from bacterial cultures as a quality control is cumbersome, cannot be stored long-term, and cannot guarantee consistency across multiple experiments. While purification of PCR amplification products offers high purity, extraction and recovery efficiency is low. Furthermore, neither of these quality control products contains multiple target genes, making them ineffective for multiplexed assays. While the most commonly used method is recombinant plasmid construction, this approach is only suitable for inserting single or short fragments. When multiple target fragments need to be introduced, multiple restriction sites are required, significantly increasing the difficulty of obtaining them. Furthermore, the longer the inserted fragment, the more difficult it is to successfully construct a recombinant plasmid. Therefore, while some nucleic acid quality control products containing the tdh, trh, and tlh virulence genes exist, these contain only partial fragments of these three virulence genes and can only serve as positive controls for detecting the corresponding fragments. This is particularly true when the designed detection probe region does not fall within these regions, making these quality control products ineffective.

[0006] In view of the above limitations, there is an urgent need to develop a new type of nucleic acid quality control product that can provide reliable and accurate quality control for the multiple detection of three specific virulence genes of Vibrio parahaemolyticus in food. At the same time, it is suitable for various detection methods targeting the virulence gene nucleic acids of Vibrio parahaemolyticus, including but not limited to PCR, real-time fluorescence quantitative PCR, tNGS, etc., to ensure the consistency and comparability of various test results, accurately identify highly virulent strains of Vibrio parahaemolyticus, and have important reference significance for controlling the safety risks brought by it and prevention and control measures. Summary of the Invention

[0007] In view of the shortcomings of the existing technology, the purpose of the present invention is to provide a universal plasmid quality control product, preparation method and application for the detection of virulence genes of Vibrio parahaemolyticus in food. It provides a quality control DNA quality control product containing the full-length sequences of the three virulence genes of Vibrio parahaemolyticus, tdh, trh and tlh, which can simultaneously provide accuracy assessment and standardization for the detection of the three virulence genes of Vibrio parahaemolyticus, and has the advantages of easy preparation, good long-term stability and good compatibility. It is a universal molecular biology experiment quality control product containing the full-length sequences of the three virulence genes, which is not limited by the specificity of the target sequence and is suitable for various molecular biology tests based on the three virulence gene target probes of tdh, trh and tlh, such as fluorescent quantitative PCR, digital PCR and tNGS.

[0008] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0009] A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, comprising a nucleotide sequence of 2434 bp based on the gene tdh encoding a heat-stable direct hemolysin, the gene trh encoding a related heat-stable hemolysin, and the gene tlh encoding a heat-labile hemolysin, see Appendix 1.

[0010] As a further technical solution of the present invention: the gene encoding the heat-resistant direct hemolysin is 570 bp in length, with reference to Vibrio parahaemolyticus RI MD 2210633;

[0011] The gene encoding the related thermostable hemolysin is 570 bp in length and is based on the standard strain ATCC17802;

[0012] The gene encoding the thermolabile hemolysin has a full length of 1254 bp and is based on the standard strain ATCC17802.

[0013] As a further technical solution of the present invention: the full lengths of three virulence genes are selected, fused into a plasmid, and transformed into an engineered bacterium.

[0014] As a further technical solution of the present invention: it utilizes seamless cloning technology to connect the three virulence gene nucleic acid fragments to the target plasmid.

[0015] As a further technical solution of the present invention: the concentration of the plasmid DNA standard sample carrying three virulence genes is 97.6 ng / μL, and the volume of each tube is 25 μL.

[0016] As a further technical solution of the present invention: used for quality control of virulence genes of Vibrio parahaemolyticus by molecular biological methods (mainly including PCR and RT-PCR), and plasmid DNA standard samples, in the amplification system, the concentration range of plasmid DNA used as a template is 97.6 ng / mL-97.6 fg / mL, and the CT range at this time is 12-35, with a good amplification effect diagram.

[0017] A method for preparing a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food comprises the following steps:

[0018] Step 1: Obtaining full-length fragments of virulence genes (tdh, trh, and tlh) and designing amplification primers. PCR amplification primers for the three virulence genes tdh, trh, and tlh were designed with reference to the gene sequence encoding the thermostable direct hemolysin, the gene sequence encoding the related thermostable hemolysin, and the gene sequence encoding the thermolabile hemolysin.

[0019] Step 2: Construction of plasmid DNA:

[0020] Step 2.1, double enzyme digestion of plasmid pUC18;

[0021] Step 2.2, verification of enzyme digestion products;

[0022] Step 2.3, recovery of linear plasmid;

[0023] Step 2.4, ligation of virulence gene to linear plasmid;

[0024] Step 3: Plasmid verification test: confirm that the plasmid contains the full-length fragments of the three virulence genes through RT-PCR amplification.

[0025] As a further technical solution of the present invention: in the step 1, three pairs of PCR amplification primers are included, corresponding to the sequences of the three genes tdh, trh and tlh, respectively. The designed PCR amplification primers of the three virulence genes tdh, trh and tlh are as follows:

[0026] Tdh-F:TGCCTGCAGGTCGACTCTAGATGAAACACCAATATTTTGCA;

[0027] Tdh-R: TTAGTTTCATTTATTGTTGATGTTTACATTCAAAA;

[0028] Trh-F:TCAACAATAAATGAAAACTAAGACTCTACTTTGCA;

[0029] Trh-R:TTTTTTTCATTTAAATTTGTGATTTACATTCGCCA;

[0030] Tlh-F:ACAAAATTAAATGAAAAAAACAATCACACTATTAA;

[0031] Tlh-R:CGAATTCGAGCTCGGTACCCTTAGAAACGGTACTCGGCT.

[0032] For example, the universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food is used for laboratory quality control in nucleic acid detection.

[0033] For example, the application of a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food in PCR-related quantitative detection.

[0034] In summary, the present invention includes at least one of the following beneficial technical effects:

[0035] The present invention discloses a universal plasmid quality control product, preparation method, and application for detecting virulence genes of Vibrio parahaemolyticus in food. The constructed plasmid DNA is a recombinant plasmid containing the complete nucleic acid fragments of three virulence genes of Vibrio parahaemolyticus, and has the characteristics of good stability and high accuracy. It can not only serve as a positive control in qualitative nucleic acid detection, but also as a reference in quantitative analysis to construct a standard curve for quantitative analysis. Therefore, the constructed plasmid DNA can also play a key role in the traceability process of nucleic acid detection as a quality control product.

[0036] Using this plasmid nucleic acid as a quality control product provides accuracy and standardized evaluation for the detection of three virulence genes of Vibrio parahaemolyticus, which helps to accurately identify highly virulent strains of Vibrio parahaemolyticus. It can not only quickly respond to food poisoning incidents and conduct pollution source traceability analysis, effectively control food safety risks caused by Vibrio parahaemolyticus, but also provide important reference for the formulation of corresponding prevention and control measures. It has important application value in the field of food safety testing and risk management. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a schematic diagram of the results after the three virulence genes in the present invention are connected to the plasmid.

[0038] Figure 2 Schematic diagram of the purification and recovery of the enzymatic cleavage product in the present invention.

[0039] Figure 3 This is a schematic diagram of the amplification results of the virulence gene tdh using bacterial chromosome and plasmid DNA as templates in the present invention.

[0040] Figure 4 This is a schematic diagram of the amplification results of the virulence gene trh using bacterial chromosome and plasmid DNA as templates in the present invention.

[0041] Figure 5 Schematic diagram of the amplification results of the virulence gene tlh using bacterial chromosome and plasmid DNA as templates in the present invention.

[0042] Figure 6 This is a diagram showing the sensitivity detection results of the tdh gene in fluorescent quantitative PCR in the present invention.

[0043] Figure 7 This is a diagram showing the sensitivity detection results of the trh gene in fluorescent quantitative PCR in the present invention.

[0044] Figure 8 This is a diagram showing the sensitivity detection results of the tlh gene in fluorescent quantitative PCR in the present invention. DETAILED DESCRIPTION

[0045] The technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application; it is obvious that the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0046] In the description of this application, it should be noted that the terms "upper," "lower," "inner," "outer," "top / bottom," and the like, indicating orientations or positional relationships, are based on the orientations or positional relationships shown in the accompanying drawings and are intended solely to facilitate the description of this application and simplify the description. They do not indicate or imply that the devices or components referred to must have a specific orientation, be constructed, or operate in a specific orientation. Therefore, they should not be construed as limitations on this application. Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0047] In the description of this application, it should be noted that, unless otherwise expressly specified or limited, the terms "installed," "provided with," "mounted / connected," and "connected" should be understood in a broad sense. For example, "connected" can mean a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection or an indirect connection through an intermediate medium, or it can be internal communication between two components. Those skilled in the art will understand the specific meanings of the above terms in this application based on the specific circumstances.

[0048] Example 1:

[0049] Reference Figure 1, which is a recombinant plasmid map carrying three virulence genes in the patent of this invention. The present invention discloses a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, including a gene encoding a thermostable direct hemolysin (tdh, full length 570 bp, reference Vibrioparahaemolyticus, RI MD 2210633), a gene encoding a related thermostable hemolysin (trh, full length 570 bp, reference ATCC17802), and a gene encoding a thermolabile hemolysin (tlh, full length 1254 bp, reference ATCC17802) (see Appendix 1 for virulence gene sequences).

[0050] The recombinant plasmid constructed in this paper utilizes a high-fidelity enzyme to amplify the full length of three virulence genes. This study selected two standard strains of Vibrio parahaemolyticus (ATCC17802 and ATCC33847) as templates. The tdh, trh, and tlh virulence genes carried by these strains were 100% identical to the nucleic acid sequences of the reference genes listed on the VFDB website. These nucleotide sequences were fused into a plasmid and transformed into engineered bacteria. The full-length virulence genes were selected. This recombinant plasmid can be used as a universal standard plasmid, suitable for quality control in various commercial kits or assays using self-synthesized primers.

[0051] The present invention utilizes seamless cloning technology to connect three virulence gene nucleic acid fragments to the target plasmid.

[0052] The plasmid DNA quality control product carrying three virulence genes of the present invention has a concentration of 97.6 ng / μL and a volume of 25 μL per tube.

[0053] Used for quality control of virulence genes in Vibrio parahaemolyticus using molecular biology methods (primarily PCR, RT-PCR, etc.), as well as for quality control of plasmid DNA nucleic acids. In amplification systems, the plasmid DNA used as a template has a concentration range of 97.6 ng / mL to 97.6 fg / mL, with a CT range of 12-35, demonstrating excellent amplification results.

[0054] Example 2:

[0055] The present invention also discloses a method for preparing a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, which specifically comprises the following steps:

[0056] Step 1. Obtaining full-length fragments of virulence genes (tdh, trh, and tlh) and designing amplification primers:

[0057] This study employed a highly efficient enzymatic infusion ligation technique, relying on the ability of the infusion enzyme to recognize any 16 bases at the 5-3 ends of a linearized DNA fragment, forming sticky ends. As long as the sticky ends formed by the plasmid and gene are complementary, vector construction can be completed through annealing.

[0058] Based on this principle, PCR amplification primers for the three virulence genes tdh, trh, and tlh were designed with reference to the sequences of the gene encoding the thermostable direct hemolysin (tdh, full length 570 bp, reference Vibrio parahaemolysin RIMD 2210633), the gene encoding the related thermostable hemolysin (trh, full length 570 bp, reference ATCC17802), and the gene encoding the thermolabile hemolysin (tlh, full length 1254 bp, reference ATCC17802):

[0059] Tdh-F:TGCCTGCAGGTCGACTCTAGATGAAACACCAATATTTTGCA;

[0060] Tdh-R: TTAGTTTCATTTATTGTTGATGTTTACATTCAAAA;

[0061] Trh-F:TCAACAATAAATGAAAACTAAGACTCTACTTTGCA;

[0062] Trh-R:TTTTTTTCATTTAAATTTGTGATTTACATTCGCCA;

[0063] Tlh-F:ACAAAATTAAATGAAAAAAACAATCACACTATTAA;

[0064] Tlh-R:CGAATTCGAGCTCGGTACCCTTAGAAACGGTACTCGGCT.

[0065] PCR amplification procedure:

[0066] 40 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 60 s, and extension at 72°C for 10 s were performed. PCR products were electrophoresed on a 1% agarose gel at 180 V for 45 min and recovered.

[0067] Step 2. Construction of plasmid DNA:

[0068] 2.1 Double enzyme digestion of plasmid pUC18:

[0069] pUC18 was digested with double enzymes (Xba I and Sma I) to obtain a linear vector (2686 bp).

[0070] The enzyme digestion system is:

[0071] Table 1

[0072] Components Volume (μL) SmaI 1 XB 1 pUC18 ≤1 μg 10*Tbuffer 2 0.1% BSA 2 Deionized Water up to 20 μL

[0073] Reaction conditions: 37°C, 2 h. Run gel electrophoresis to determine if digestion is complete before use.

[0074] 2.2 Verification of enzyme digestion products:

[0075] Prepare 1% agarose gel: 40 mL TBE, boil, add dye at a ratio of 10 mL: 1 uL (Gelred dye), pour into gel mold, and cool for 20-30 minutes;

[0076] Loading: Marker 5uL, sample 30uL, undigested plasmid as control (see Figure 2 ).

[0077] Conditions: voltage 180V, 45min;

[0078] 2.3 Recovery of linear plasmids:

[0079] The concentration was measured using the Takara gel recovery kit, and the plasmid vector concentration was measured to be 88 ng / μL.

[0080] 2.4 Connection of virulence gene to linear plasmid:

[0081] The amplified fragments of the three virulence genes tdh, trh and tlh were purified and then ligated with the linear plasmid in sequence.

[0082] 2.4.1 Connection system:

[0083] Conditions: 50°C, 15 min on ice.

[0084] Table 2

[0085] Components Concentration (g / μL) Dosage (ng) Volume (μL) tdh 34.8 39 2.3 trh 23.6 38 2.6 tlh 49 35 1.5 Linearized vestor 24 88 7.3 5X Infusion Master Mix - - 4 Deionized Water - - up to 20 μL

[0086] 2.4.2 Conversion:

[0087] Transform the ligation product into competent cells: Thaw JM109 competent cells on ice, then transfer 50 μl of the competent cells into an EP tube. Add 2.5 μl of the infusion reaction product to the competent cells. Place the tube on ice for 30 minutes, heat shock the cells at 42°C for 45 seconds, then place the tube on ice for 1-2 minutes, add SOC medium to a final volume of 500 μL, and incubate in a 37°C incubator for 1 hour. Place 1 / 5-1 / 3 of each transformation reaction into a separate tube, bring the volume to 100 μL with SOC medium, and spread onto a resistance plate. Pick positive clones from each resistance plate for expansion and simultaneously extract plasmid DNA for verification.

[0088] Step 3. Confirmatory test of plasmid quality control:

[0089] RT-PCR amplification confirmed that the plasmid contained the full-length fragments of three virulence genes.

[0090] The amplification primers are:

[0091] Table 3

[0092]

[0093]

[0094] The results of amplification of tdh, trh and tlh virulence genes using bacterial chromosome DNA and plasmid DNA of standard strains of Vibrio parahaemolyticus as templates were: all positive results were obtained (refer to Figure 3-Figure 5 ).

[0095] Example 3:

[0096] The present invention discloses a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, as shown in the embodiments, and its application as laboratory quality control in qualitative detection of nucleic acids or in PCR-related quantitative detection.

[0097] Test example:

[0098] The plasmid DNA quality control product constructed in the present invention is a recombinant plasmid containing complete nucleic acid fragments of three virulence genes from Vibrio parahaemolyticus. It is characterized by good stability and high accuracy. It can not only serve as a positive control in qualitative nucleic acid detection, but also as a quantitative standard in quantitative analysis to construct a standard curve for quantitative analysis. Therefore, the constructed plasmid DNA can also play a key role in the traceability process of nucleic acid detection as a quality control product.

[0099] 1. Concentration and purity of plasmid quality control products:

[0100] The concentration of the plasmid DNA standard sample carrying three virulence genes of the present invention is 97 ng / μL, and the volume of each tube is 25 μL. The A260 / A280 ratio measured by ultraviolet method is 1.86, which is between 1.8 and 2.0, and has high purity.

[0101] 2. DNA sequencing results of plasmid quality control products:

[0102] DNA was extracted from the constructed recombinant plasmid to obtain a plasmid DNA of 2435 bp of virulence genes of Vibrio parahaemolyticus. The sequencing results were compared with the tdh, trh and tlh virulence gene sequences of Vibrio parahaemolyticus in Gen-Bank by BLAST, and the coincidence rate reached 100%.

[0103] 3. Specificity assessment of plasmid quality control products:

[0104] To verify the cross-reactivity of the positive plasmid against other pathogens, specificity testing was performed on 10 non-parahaemolytic Vibrio pathogens, including Salmonella Enteritidis, Vibrio mimicus, Vibrio vulnificus, Vibrio alginolyticus, Escherichia coli, Staphylococcus aureus, Proteus, Shigella flexneri, Listeria monocytogenes, and Pseudomonas aeruginosa. The results are shown in the table below: the negative rate for all 10 pathogens was 100%. The present invention exhibits good specificity. The detection method is the same as in step 3.

[0105] Table 4

[0106]

[0107] Note: UD (UNDETECT IVE) means not detected.

[0108] 4. Investigation of the stability of constructed strains through passage:

[0109] After 20 consecutive passages, the plasmids were streaked onto resistance plates containing ampicillin and those without antibiotics, and the plasmids were extracted. Fluorescence PCR detection showed that all three virulence genes were positive, indicating that the constructed plasmid DNA standard sample was stable.

[0110] Table 5 Results of fluorescence PCR of 20th generation plasmids

[0111]

[0112]

[0113] 5. Sensitivity study of virulence genes on plasmids using fluorescent quantitative PCR:

[0114] The concentration of the extracted plasmid was 97.6 ng / μL, and it was diluted 10-fold in sequence, with concentrations of 9.76 μg / mL, 0.976 μg / mL, 97.6 ng / mL, 9.76 ng / mL, 0.976 ng / mL, 97.6 pg / mL, 9.76 pg / mL, 0.976 pg / mL, and 97.6 fg / mL, respectively.

[0115] The Rt-PCR standard curves of the three virulence genes tdh, trh and tlh of Vibrio parahaemolyticus were established based on the correspondence between the logarithm of the copy number and the Ct value.

[0116] Reference Figure 6 , is the test result of tdh gene:

[0117] From left to right, the plasmid concentration was diluted in a gradient, and the Ct values ​​were: 7.76, 10.7, 12.35, 16.09, 18.67, 22.23, 24.94, 29.36, 31.75, and 34.27. The standard curve r was established based on this. 2 =0.9947, amplification efficiency E=112.52%.

[0118] Reference Figure 7 , is the trh gene test result:

[0119] From left to right, the plasmid concentration was diluted in a gradient, and the Ct values ​​were: 7.65, 10.79, 12.44, 16.28, 18.79, 22.49, 25.04, 29.46, 32.05, and 34.84. The standard curve r was established based on this. 2 =0.996, amplification efficiency E=108.82%.

[0120] Reference Figure 8 , is the tlh gene test result:

[0121] From left to right, the plasmid concentration was diluted in a gradient, and the Ct values ​​were: 8.88, 12.01, 13.78, 17.64, 20.15, 23.82, 26.51, 30.96, 33.36, 35.92. The standard curve r was established based on this. 2 =0.9955, amplification efficiency E=109.83%.

[0122] There was a corresponding linear relationship between the copy numbers of the three virulence genes in the recombinant plasmid and the Ct value, with the lowest detectable value being 97.6 fg / mL.

[0123] 6. Evaluation of the plasmid containing three virulence genes as a quality control product in practical applications:

[0124] Fourteen laboratories tested the recombinant plasmid quality control product for the three virulence genes, tdh, trh, and tlh, using 14 different commercial kits from five different brands. All of the tests yielded positive results, with 100% accuracy. The following table shows the test results for the 14 commercial kits: * indicates a single-target assay. The constructed plasmid quality control product consistently yielded the expected results across different laboratories and experiments, and can serve as a quality control for a variety of related tests.

[0125] Table 6

[0126] tdh trh tlh Reagent A + + + Reagent B + + + Reagent C + + + D reagent + + + E reagent + + + F reagent + + + Reagent G + + + H reagent + + + I reagent* + / / J reagent* / + / Reagent K* / / + Reagent L* + / / M reagent* / + / Reagent N* / / +

[0127] The embodiments of this specific implementation method are all preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, any equivalent changes made based on the structure, shape, and principle of the present invention should be included in the scope of protection of the present invention.

[0128]

[0129] ATCGACAAAATTCGTGCGAAAGTGCTTGAGATGAACGAGTTCATCAAG

[0130] GCACAAGCGATGTACTACAAAGCGCAAGGTTACAACATCACGTTGTTT

[0131] GATACTCACGCCTTGTTCGAGACGCTAACTTCTGCGCCAGAAGAGCAC

[0132] GGTTTCGTGAACGCAAGTGATCCTTGTTTGGACATCAACCGCTCATCGT

[0133] CTGTCGATTACATGTACACCCACGCATTGCGCTCTGAGTGTGCGGCGTC

[0134] CGGTGCTGAGAAATTTGTGTTCTGGGATGTCACGCACCCAACAACAGC

[0135] AACTCACCGCTATGTTGCAGAGAAAATGCTAGAAAGTAGCAACAACTT

[0136] AGCCGAGTACCGTTTCTAAGGGTACCGAGCTCGAATTCG。

Claims

1. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, characterized in that: It contains a nucleotide sequence based on the gene tdh encoding the thermostable direct hemolysin, the gene trh encoding the related thermostable hemolysin, and the gene tlh encoding the thermolabile hemolysin, with a length of 2434bp, see Appendix 1.

2. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 1, characterized in that: The gene encoding the heat-resistant direct hemolysin has a total length of 570 bp, with reference to Vibrio parahaemolyticus RIMD2210633; The gene encoding the relevant thermostable hemolysin has a total length of 570 bp and is based on the standard strain of Vibrio parahaemolyticus ATCC17802; The gene encoding the thermolabile hemolysin has a total length of 1254 bp and is based on the standard strain of Vibrio parahaemolyticus ATCC17802.

3. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 1, characterized in that: The full length of three virulence genes were selected, fused into plasmids, and transformed into engineered bacteria.

4. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 1, characterized in that: It uses seamless cloning technology to connect three virulence gene nucleic acid fragments to the target plasmid.

5. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 1, characterized in that: The concentration of the plasmid DNA standard sample carrying three virulence genes is 97.6 ng / μL, and the volume of each tube is 25 μL.

6. A universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 1, characterized in that: Used for quality control of virulence genes of Vibrio parahaemolyticus detected by molecular biological methods (mainly including PCR, RT-PCR), and plasmid DNA quality control products. In the amplification system, the concentration range of plasmid DNA as a template is 97.6ng / mL-97.6fg / mL, and the CT range at this time is 12-35, with a good amplification effect diagram.

7. A method for preparing a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food, characterized in that: The following steps are involved: Step 1, obtaining the full-length fragments of virulence genes (tdh, trh and tlh) and designing amplification primers, referring to the sequences of the gene tdh encoding the thermostable direct hemolysin, the gene trh encoding the related thermostable hemolysin, and the gene tlh encoding the thermolabile hemolysin, designing PCR amplification primers for the three virulence genes tdh, trh and tlh; Step 2: Construction of plasmid DNA: Step 2.1, double restriction enzyme digestion of plasmid pUC18; Step 2.2, verification of enzyme digestion products; Step 2.3, recovery of linear plasmid; Step 2.4, ligation of virulence gene and linear plasmid; Step 3: Plasmid verification test: confirm that the plasmid contains the full-length fragments of the three virulence genes through RT-PCR amplification.

8. The method for preparing a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to claim 7, characterized in that: In step 1, three pairs of PCR amplification primers are included, corresponding to the sequences of the three genes tdh, trh and tlh, respectively. The designed PCR amplification primers of the three virulence genes tdh, trh and tlh are as follows: Tdh-F:TGCCTGCAGGTCGACTCTAGATGAAACACCAATATTTTGCA; Tdh-R: TTAGTTTCATTTATTGTTGATGTTTACATTCAAAA; Trh-F:TCAACAATAAATGAAAACTAAGACTCTACTTTGCA; Trh-R:TTTTTTTCATTTAAATTTGTGATTTACATTCGCCA; Tlh-F:ACAAAATTAAATGAAAAAAACAATCACACTATTAA; Tlh-R:CGAATTCGAGCTCGGTACCCTTAGAAACGGTACTCGGCT.

9. Use of the universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food as described in any one of claims 1 to 6 as laboratory quality control in nucleic acid detection.

10. Use of a universal plasmid quality control product for detecting virulence genes of Vibrio parahaemolyticus in food according to any one of claims 1 to 6 in PCR-related quantitative detection.