Method for improving citrus liberobacter asiaticum resistance by using CsFMO1-1 protein and disease-resistant citrus

By overexpressing CsFMO1-1 protein in citrus, the resistance of citrus to Huanglong disease is improved, and the major threat of citrus Huanglong disease to the citrus industry has been solved, achieving the effect of significantly improving disease resistance and delaying the occurrence of diseases.

CN120193005APending Publication Date: 2025-06-24GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1

Patent Information

Application Number
CN202510294936.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

Citrus Huanglong disease is a bacterial disease caused by Candidatus Liberibacter asiaticus. There is currently no effective treatment method, which seriously affects the citrus industry.

Method used

By integrating the overexpressor of the citrus flavin monooxygenase CsFMO1-1 gene into Agrobacterium rhizobium, the expression of CsFMO1-1 protein in citrus hairy roots is promoted, thereby improving the resistance of citrus to Huanglong disease.

Benefits of technology

It significantly improves the resistance of citrus to citrus Huanglong disease, delays the occurrence of the disease, and has important application value in citrus breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193005A_ABST
    Figure CN120193005A_ABST
Patent Text Reader

Abstract

The invention discloses a method for improving citrus liberobacter asiaticum resistance by using CsFMO1-1 protein and a disease-resistant citrus, and the citrus liberobacter asiaticum resistance of citrus plants is improved by adjusting the expression level of CsFMO1-1 gene in the citrus plants; the method specifically comprises the following steps: (1) cloning a citrus CsFMO1-1 gene sequence; (2) constructing an overexpression vector; and (3) transforming the overexpression vector into citrus to obtain a transgenic plant of which the expression level of the CsFMO1-1 gene is up-regulated. The citrus CsFMO1-1 gene coding sequence is cloned, an overexpression vector of the citrus CsFMO1-1 gene is constructed, then citrus is converted, the content of CLas in an obtained CsFMO1-1 overexpression transgenic plant is obviously lower than that of a wild type, the incidence degree of the citrus huanglongbing can be effectively and remarkably reduced, and therefore the resistance of the citrus to the citrus huanglongbing is remarkably improved; the phenotype of a citrus plant is not influenced, and the gene has an important application value for citrus liberobacter asiaticum resistance breeding, and can be used as a candidate gene for citrus liberobacter asiaticum resistance breeding with a plurality of citrus liberobacter asiaticum resistance and susceptible genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular, to a method for improving the resistance of citrus to Huanglongbing by using CsFMO1-1 protein and disease-resistant citrus. Background Art

[0002] Citrus is the largest fruit in southern China and also an important economic crop globally. However, with the development of the citrus industry, Citrus Huanglongbing (HLB) has become the number one killer of the citrus industry. HLB is a bacterial disease caused by Candidatus Liberibacter asiaticus (CaLas), parasitizing in the phloem, and is transmitted through feeding on diseased trees by Asian citrus psyllid (ACP) or grafting of diseased seedlings. Once a citrus tree is infected, it needs to be immediately destroyed. So far, no effective treatment method has been available for citrus farmers to adopt.

[0003] The defense of plants against pathogens is based on two layers of immune systems. Pattern recognition receptor (PRR)-triggered immunity (PTI) by recognizing pathogen-associated molecular patterns is the first layer of the immune response. It can recognize pathogen-associated molecular patterns and activate host defense responses, including reactive oxygen species burst, salicylic acid accumulation, callose deposition, and cell wall thickening. Lipopolysaccharides and flagellin are typical pathogen-associated molecular patterns and play important roles in triggering the resistance of plant hosts to CLas infection. The second layer is effector-triggered immunity (ETI) recognized by plant disease-resistant proteins. In citrus diseases, the roles of the ETI and PTI immune systems are not yet clear, but transcriptomic studies have shown that many genes in the PTI and ETI immune pathways in citrus are affected by CLas infection.

[0004] Plant systemic acquired resistance (SAR) is a defense mechanism for plants to avoid secondary infection by pathogens. The infected tissues produce SAR system signals to initiate the distal accumulation of salicylic acid, activate the defense response of the downstream pathogenesis-related (PR) protein gene expression, thus activating systemic acquired resistance and preventing the pathogens from reinfecting. Currently, many studies have shown that systemic acquired resistance is an important immune mechanism for citrus to respond to Huanglongbing (HLB) infection, and the resistance mediated by it is closely related to the tolerance of citrus to HLB. Acid pummelo resistant to HLB has a strong systemic acquired resistance response to CLas infection. The basal levels of salicylic acid in the disease-resistant variety Murraya paniculata, the disease-tolerant variety Citrus hystrix DC. and the disease-susceptible variety Jincheng orange are closely related to the resistance to Huanglongbing. The systemic acquired resistance marker genes CsPR1, CsPR2 and CsPR5 respond positively to the infection of Candidatus Liberibacter asiaticus, and the transcriptional levels of CsPR2 and CsPR5 in the HLB-tolerant varieties (acid pummelo and Citrus hystrix DC.) are significantly higher than those in the highly susceptible variety (Jincheng orange). The rapid transmission of SAR signals from the pathogen-infected tissues to the uninfected tissues through the phloem transport system is the key to the establishment of whole-plant SAR resistance. Similar to this transmission, Candidatus Liberibacter asiaticus also systematically infects the host in the plant through the phloem, triggers a systemic immune response, and finally causes systemic symptoms in the whole plant. The similarity between the systemic infection of Candidatus Liberibacter asiaticus and the systemic transmission of SAR signals implies a long-term and systemic confrontation between the two in the citrus phloem. Therefore, inducing systemic acquired resistance by using SAR signals to enhance the resistance of citrus to HLB has great application value.

[0005] With the development of molecular biology techniques, using genetic engineering techniques to change the genes in citrus, thereby regulating the disease resistance of plants, is a simple, effective and economical method. The activation or inhibition of the SAR response can be achieved by regulating the expression levels of endogenous related genes. For example, NPR1, as a key regulatory gene for activating systemic acquired resistance, overexpression of AtNPR1 and CsNPR1 in citrus can activate the expression of pathogenesis-related protein genes PR1 and PR2, endowing transgenic plants with tolerance to Huanglongbing.

[0006] NHP belongs to non-protein amino acids in plants, and its precursor is pipecolic acid (Pip). Both NHP and Pip participate in plant immune regulation as SAR signal transduction molecules. Metabolomics studies have found that Pip is enriched in the petiole exudate of Arabidopsis thaliana leaves infected by SAR-inducing pathogens. Exogenous Pip can induce SAR in Arabidopsis thaliana, from which it is found that Pip may be a long-distance signaling molecule that induces the SAR response. The precursor of Pip, L-lysine, is catalyzed by ALD1 to become △1-piperidine-2-carboxylic acid (P2C), and P2C is further catalyzed by SARD4 to become L-Pip. However, SAR mediated by Pip completely disappears in the fmo1 mutant. Based on this, it is speculated that FMO1 plays a role downstream of the Pip signal during the induction of SAR and can convert Pip into downstream signaling molecules. Subsequent experiments confirmed that FMO1 can hydroxylate Pip to form NHP. NHP can be synthesized in large quantities in pathogen-infected leaves and systemic leaves. Exogenous NHP can strongly induce the resistance of Arabidopsis thaliana to pathogens and can restore SAR in ald1 and fmo1 mutants. Similar to Pip, NHP can also induce the expression of ALD1, SARD4, and FMO1 genes in infected tissues and distal tissues and can move from the infected site to systemic tissues. Overexpression of FMO1 has been proven to improve the resistance of crops such as Arabidopsis thaliana, barley, and tomato to bacterial diseases, and vice versa, the resistance decreases. However, currently, there is no research and application on using the NHP biosynthetic gene FMO1-1 to improve the resistance of citrus to huanglongbing.

[0007] In view of this, the present application is specifically proposed. Summary of the Invention

[0008] The present invention provides a method for improving the resistance of citrus to huanglongbing by using the CsFMO1-1 protein and disease-resistant citrus to improve the resistance of citrus to huanglongbing. By integrating the overexpression vector of the citrus flavin monooxygenase CsFMO1-1 gene into the hairy roots of citrus through Agrobacterium rhizogenes, the expression level of the CsFMO1-1 protein in the hairy roots of citrus is up-regulated, which can significantly improve the resistance of citrus to huanglongbing, and the appearance of its typical symptoms is later, which has great application value in citrus breeding and can be used as a candidate gene for huanglongbing resistance breeding with multiple citrus huanglongbing-resistant and -susceptible genes.

[0009] The present invention is achieved through the following technical solutions:

[0010] In a first aspect, the present invention provides a method for improving the resistance of citrus to Huanglongbing by using the NHP biosynthetic protein CsFMO1-1 protein. The CsFMO1-1 protein contains the characteristic "GAGYSGI" FAD-binding domain and "FxGXVXHSXDY" FMO-identifying domain of the FMO protein, and is an enzyme that directly synthesizes NHP immune signals, which is the last enzymatic reaction in the NHP biosynthetic pathway, that is, the CsFMO1-1 protein catalyzes the hydroxylation reaction of Pip to generate NHP. The present invention improves the resistance of citrus plants to Huanglongbing by regulating the expression level of the CsFMO1-1 protein in citrus plants, and the amino acid sequence of the CsFMO1-1 protein is shown in SEQ ID NO: 1.

[0011] In a specific embodiment, the gene encoding the CsFMO1-1 protein is the CsFMO1-1 gene of citrus, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0012] In a specific embodiment, the specific method for regulating the expression level of the CsFMO1-1 protein is: up-regulating the expression level of the CsFMO1-1 protein in citrus plants.

[0013] In a specific embodiment, the method for up-regulating the expression level of the CsFMO1-1 protein in citrus plants is to use an overexpression vector to control the expression of the CsFMO1-1 gene in citrus, up-regulate the accumulation of the CsFMO1-1 protein in citrus, and thus enhance the content of Pip and NHP in citrus plants.

[0014] In a specific embodiment, the method for improving the resistance of citrus to Huanglongbing by using the CsFMO1-1 protein specifically includes the following steps:

[0015] (1) Clone the coding sequence of the citrus CsFMO1-1 gene;

[0016] (2) Construct an overexpression vector;

[0017] (3) Transform citrus with the overexpression vector to obtain transgenic plants overexpressing the CsFMO1-1 protein.

[0018] In a specific embodiment, in step (1), the cloning method of the coding sequence of the citrus CsFMO1-1 gene is: extract the total RNA of citrus, then reverse transcribe it into cDNA, and finally use high-fidelity enzyme PCR to amplify the DNA fragment of the CsFMO1-1 gene coding sequence.

[0019] In a specific embodiment, in step (1), the PCR primers used for cloning the coding sequence of the citrus CsFMO1-1 gene are OE-F and OE-R, and their nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively.

[0020] In a specific embodiment, in step (2), the method for constructing the overexpression vector is as follows: using pNmGFPer as the vector, the pNmGFPer vector carries the CaMV 35S promoter, the CaMV 35S promoter is the cauliflower mosaic virus promoter, and has the nucleotide sequence shown in SEQ ID NO: 5. After digesting the target fragment with SalⅠ and BamHⅠ enzymes and ligating it to the vector recovered by digestion with SalⅠ and BamHⅠ enzymes, the overexpression vector pNmGFPer-CsFMO1-1 is constructed.

[0021] In a specific embodiment, in step (3), the method for transforming citrus with the overexpression vector is as follows: the overexpression vector is transformed into Agrobacterium rhizogenes by heat shock method, and then Agrobacterium rhizogenes is used to mediate the transformation of citrus explants. The transgenic plants are obtained after the genetically transformed explant cells are cultured with vermiculite and identified by GFP fluorescence.

[0022] In a specific embodiment, it also includes verifying the transgenic plants by PCR. The primers used are ID-F and ID-R. ID-F is a sequence taken from CaMV 35S on the pNmGFPer vector, and ID-R is designed according to the terminal sequence of the CsFMO1-1 gene. The primers have the nucleotide sequences shown in SEQ ID NO: 6 and SEQ ID NO: 7 respectively;

[0023] The expression level of the CsFMO1-1 gene is detected by real-time fluorescence quantitative PCR. The primers used are RT-F and RT-R, and their nucleotide sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 9 respectively. The internal reference for real-time fluorescence quantitative PCR is the citrus CsGAPDH gene, and the primers used are GA-F and GA-R, and their nucleotide sequences are shown in SEQ ID NO: 10 and SEQ ID NO: 11 respectively.

[0024] In the second aspect, the present invention provides a citrus with Huanglongbing resistance, which is obtained by the above method and can have good resistance to citrus Huanglongbing.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0026] 1. A method for improving the resistance of citrus to Huanglongbing using the CsFMO1-1 protein and disease-resistant citrus provided by the embodiments of the present invention. By cloning the coding sequence of the citrus CsFMO1-1 gene, constructing an overexpression vector of the citrus CsFMO1-1 gene, and then transforming citrus, the content of CLas in the obtained CsFMO1-1 overexpressing transgenic plants is significantly lower than that of the wild type, and the incidence of citrus Huanglongbing is significantly reduced;

[0027] 2. A method for improving the resistance of citrus to Huanglongbing using the CsFMO1-1 protein and disease-resistant citrus provided by the embodiments of the present invention. By integrating the overexpression vector of the citrus flavin monooxygenase CsFMO1-1 gene into citrus, the incidence of citrus Huanglongbing can be significantly reduced, the resistance of citrus to Huanglongbing can be improved, and the phenotype of citrus plants will not be affected;

[0028] 3. A method for improving the resistance of citrus to Huanglongbing using the CsFMO1-1 protein and disease-resistant citrus provided by the embodiments of the present invention. By overexpressing the CsFMO1-1 gene, the resistance of citrus plants to Huanglongbing can be greatly improved, which has great application value for citrus breeding against Huanglongbing. It can be used as a candidate gene for citrus Huanglongbing resistance breeding together with multiple citrus Huanglongbing-resistant and -susceptible genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can also be obtained based on these drawings without creative efforts.

[0030] Figure 1 It is a domain alignment analysis diagram of citrus CsFMO1-1 provided by the embodiments of the present invention: the "FAD-binding" and "FMO-identifying" domains are expressed at the boxed positions;

[0031] Figure 2 It is a differential expression analysis diagram of the citrus CsFMO1-1 gene in different tolerance varieties in response to Huanglongbing; the asterisks on the data bars indicate significant differences (*, P < 0.05);

[0032] Figure 3Positive plant identification diagram provided by the embodiments of the present invention: A, Flow chart for constructing the pNmGFPer-CsFMO1-1 vector: CaMV 35S, a plant constitutive promoter derived from cauliflower mosaic virus; NOS, terminator of the nopaline synthase gene; B, PCR detection diagram of transgenic plants: M, marker; P, plasmid of the pNmGFPer-CsFMO1-1 vector; WT, wild-type control; O1-1, O1-3, and O1-6 represent three transgenic plants; C, qRT-PCR detection diagram of transgenic plants: * indicates significant difference compared with the wild type (P < 0.05), the same below; D, Content change of NHP compared with the control.

[0033] Figure 4 Evaluation diagram of the resistance of CsFMO1-1 overexpressing transgenic citrus to Huanglongbing provided by the embodiments of the present invention. Detailed implementation manners

[0034] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the embodiments and the accompanying drawings. The illustrative embodiments and descriptions thereof of the present invention are only used to explain the present invention and do not limit the present invention.

[0035] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that the present invention does not have to be implemented with these specific details. In other embodiments, well-known structures, circuits, materials, or methods are not specifically described in order to avoid obscuring the present invention.

[0036] Throughout the specification, references to "one embodiment", "an embodiment", "an example", or "an example" mean that a particular feature, structure, or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present invention. Thus, the phrases "one embodiment", "an embodiment", "an example", or "an example" appearing throughout the specification do not necessarily all refer to the same embodiment or example. In addition, the specific features, structures, or characteristics may be combined in any suitable combination and / or sub-combination in one or more embodiments or examples. In addition, those of ordinary skill in the art should understand that the drawings provided herein are for illustrative purposes only and are not necessarily drawn to scale. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0037] In the description of the present invention, the orientation or positional relationship indicated by terms such as "front", "rear", "left", "right", "upper", "lower", "vertical", "horizontal", "high", "low", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings. It is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be construed as a limitation on the protection scope of the present invention.

[0038] Example 1

[0039] Bioinformatics analysis of citrus CsFMO1-1

[0040] Bioinformatics analysis shows that the CDS length of CsFMO1-1 is 1,537 bp and it consists of 512 amino acids. As Figure 1 shown, protein sequence alignment analysis shows that CsFMO1-1 contains the "FAD-binding" and "FMO-identifying" domain modules with the functions of FMO family proteins, and this module is conserved in both ponkan and sweet orange.

[0041] Amino acid sequence of CsFMO1-1 protein SEQ ID NO: 1:

[0042] MANYSKIAIIGAGVSGLAAVKQLRHHNPVVFEASDSIGGIWKSCSYNSTKLQSHRSDYEFTDFPWPNRDDPGFPSYTEILDYLESYAKHFDVFKCVRFNSKVVEVRFTGSLETTDSGGNLLPAGHPVWEVAVQTHNSNSIQRYGFEFLVVCTGKYGDVPIIPAFPNNKGPEVFEGQVLHSIDYCKLDKEAASQLLKDKKVAVVGFKKSAIDLAKECAESNQGPEGQPCTMIVRTTHWTVPHYRIWGLPFFMFYSTRFSQFLHGSPNQSLLRTLLCLLLSPLRRGVSKFIESYLLWKLPLLKYGLKPDHPFEEDYASCQMAIMPEGFFSEAEKGKIVFKRASKWWFWKGGLEFEDNTKLEADVVILCTGYDGKKKLKAFLPEPFQSLLEHPSGLLPLYRGTIHPLIPNMAFVGYIESVSNLHTAELRSIWLSRLIDDKFKLPSAEKMLEQTSKEMEVMKQSTRFYKRHCISTFSINHSDEICEEMGWNAWRKRNWLLEAFSPYGSKDYEDEK

[0043] Nucleotide sequence of the CsFMO1-1 gene SEQ ID NO.2:

[0044]

[0045] Example 2

[0046] Expression analysis of citrus CsFMO1-1

[0047] Expression analysis of CsFMO1-1 gene in citrus varieties with different resistance to Huanglongbing

[0048] Compared with Jincheng, Mafeng orange is more resistant to Huanglongbing. The CLas content in Mafeng orange was significantly lower than that in Jincheng after 4 months of infection. Therefore, this experiment further used RT-qPCR to compare and analyze the expression characteristics of CsFMO1-1 gene in Jincheng and Mafeng orange after 6 months of infection. Figure 2 As shown in the figure, before infection, the expression level of CsFMO1-1 gene in disease-resistant Mafeng orange was significantly higher than that in Jincheng orange. After infection, the expression of CsFMO1-1 gene in leaves, stems and roots of both varieties was significantly upregulated, suggesting that CsFMO1-1 positively regulates citrus Huanglongbing resistance.

[0049] Example 3

[0050] Genetic transformation of late orange with citrus OE-CsFMO1-1 gene to improve citrus Huanglongbing resistance

[0051] 1. Cloning of Citrus CsFMO1-1 Gene

[0052] RNA was extracted from Late Jin Orange using an RNA extraction kit (Adlai, CAT: RN09). cDNA was synthesized using Recombinant DNaseI (TAKARA). Primers OE-F (SEQ ID No: 3) and OE-R (SEQ ID No: 4) were used to amplify the CsFMO1-1 fragment from citrus cDNA. The length of the fragment was 1,537 bp, and the sequence was shown in SEQ ID NO: 2. The amplified DNA fragment was sequenced and analyzed to be the coding sequence of the citrus CsFMO1-1 gene.

[0053] Amplification system: 10X PCR mix: 2.5 μL; Primer OE-F (5 μmol / L): 1 μL; Primer OE-R (5 μmol / L): 1 μL; cDNA about 60 ng; add ddH2O to 25 μL.

[0054] Amplification program: 94°C, 5 min; 94°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0055] DNA fragment recovery: Under ultraviolet light, use a clean blade to cut out the agarose gel block containing the target fragment. Use a kit (Adlai) to recover the fragment.

[0056] The nucleotide sequence of primer OE-F is SEQ ID NO: 3:

[0057] ATGGCCAATTACTCCAAAATTG

[0058] The nucleotide sequence of primer OE-R is SEQ ID NO: 4:

[0059] TTATTTCTCGTCCTCGTAGTCT

[0060] 2. Construction of CsFMO1-1 overexpression vector and transformation of Agrobacterium rhizogenes

[0061] The carrier structure is as follows Figure 3 As shown in A, all restriction endonucleases were purchased from THERMO and operated according to the instructions.

[0062] The specific operation is as follows: the CsFMO1-1 gene fragment and the overexpression vector pNmGFPer are double digested with restriction endonucleases SalⅠ and BamHI, and then recovered and connected. The pNmGFPer vector carries the CaMV 35S promoter, which is a cauliflower mosaic virus promoter with a nucleotide sequence shown in SEQ ID NO: 5. The connection is carried out using a T4 DNA Ligase kit (TAKARA). The connection product is transformed into Escherichia coli DH5α, and the plasmid is extracted from the positive clone to obtain the CsFMO1-1 overexpression vector pNmGFPer-CsFMO1-1. The plasmid is extracted using a kit (Adlai).

[0063] Take the K599 Agrobacterium competent cells stored in a -80℃ refrigerator and insert them into ice until they are completely melted. Take 1μL of plasmid and add it to the bottom of 100μL K599 competent cells, and gently stir to mix. Let it stand on ice for 5min, liquid nitrogen for 5min, 37℃ water bath for 5min, and ice bath for 5min. Add 500μL LB liquid culture medium and shake it at 220rpm at 28℃ constant temperature shaker for 2h-3h. Centrifuge the revived bacterial solution at 5000g for 1min, discard the supernatant, and keep 100μL of the resuspended bacterial solution, pipet and mix it, and apply it to the LK plate. Invert and culture at 28℃ for 2d. Pick the plaques and shake them in LK liquid culture medium. Screen the positive clones and store them at -80℃ for later use.

[0064] CaMV 35S promoter nucleotide sequence SEQ ID NO: 5:

[0065] TGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAG

[0066] 3. Genetic transformation of citrus (Jincheng orange)

[0067] (1) Preparation and resuspension of bacterial liquid. After thawing Agrobacterium rhizogenes K599 stored at -80°C, streak it on an LB plate with a spreader and incubate it upside down at 28°C for 2 days. Then pick 4 - 6 single colonies with a pipette tip, add them to 50 ml of LB liquid, and shake culture overnight on a shaker at 220 r / min and 28°C. Measure the OD600 value of the bacterial liquid with an ultraviolet spectrophotometer. When the OD600 value is 0.8, place the bacterial liquid in a centrifuge tube, centrifuge at 5000 r / min for 10 min, discard the supernatant, collect the cells, and resuspend them with an equal volume of MS solution as the supernatant.

[0068] (2) Collect diseased citrus branches in the greenhouse, wash them with clean water, and cut them into stem segments about 5 cm long with one or more nodes using a small knife. Put a large amount of vermiculite in a culture pot, add an appropriate amount of tap water and mix well to make the humidity moderate.

[0069] (3) Vacuum infiltration transformation. Immerse the cut ends of the branches in the resuspended liquid and perform vacuum infiltration for 30 min.

[0070] (4) Insert the infected branches into moist vermiculite and place them vertically, with the stem segments inserted into the vermiculite and the leaves exposed to the air. Place them in a constant temperature incubator at 26°C, 16h / d to induce rooting. After one month, most plants will grow roots of 5-10cm.

[0071] Example 4

[0072] Identification of OE-CsFMO1-1 transgenic plants

[0073] 1. Identification of transgenic plants by GFP green fluorescence

[0074] Use LUYOR portable excitation light source, wear LUV-30A yellow glasses for observation, and choose blue light to irradiate the roots of the plants. Positive plants will appear green, and the roots of negative plants will appear yellow.

[0075] 2. PCR detection of exogenous gene integration

[0076] 100 mg of plant leaves obtained in the initial screening were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsFMO1 gene in the citrus genome. PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min. The detection primers were ID-F (SEQ ID NO: 6) and ID-R (SEQ ID NO: 7). The PCR results are shown in Figure 2. Figure 3 As shown in B, the positive plants have amplified fragments, while the WT plants have no amplification.

[0077] The nucleotide sequence of primer ID-F is SEQ ID NO: 6:

[0078] GCCATCGTTGAAGATGCCTCTG

[0079] The nucleotide sequence of primer ID-R is SEQ ID NO: 7:

[0080] TTATTTCTCGTCCTCGTAGTCT

[0081] 3. Analysis of CsFMO1-1 gene expression

[0082] Total RNA was extracted from citrus leaves (Adlai, CAT No: RN09), and cDNA was synthesized using Recombinant DNase I. qRT-PCR was used to detect the expression of the target gene, and the detection primers were RT-F (SEQ ID NO: 8) and RT-R (SEQ ID NO: 9); the detection primers for the internal reference gene GAPDH were RT-F (SEQ ID NO: 10) and RT-R (SEQ ID NO: 11).

[0083] The nucleotide sequence of primer RT-F, SEQ ID NO: 8:

[0084] CCCAAACAACAAAGGGCCTG

[0085] The nucleotide sequence of primer RT-R, SEQ ID NO: 9:

[0086] AGCGCACTCCTTGGCTAAAT

[0087] The nucleotide sequence of primer RT-F, SEQ ID NO: 10:

[0088] GCTTTCCGTGTACCCACTGT

[0089] The nucleotide sequence of primer RT-R, SEQ ID NO: 11:

[0090] CTCTGACTCCGCCTTGATGG

[0091] The reaction volume was 20 μL, and the reaction conditions were: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min. The experiment was repeated three times.

[0092] Using method to calculate the relative expression level of CsFMO1-1 gene in transgenic plants: Define the sample treated with water as the reference factor, that is, the expression level of CsFMO1-1 in it is 1, and then calculate the multiple of the relative reference factor gene expression in transgenic citrus as its relative expression level. The detection results are as Figure 3 shown in C. The results show that the CsFMO1-1 gene has a high-level expression in transgenic plants compared with wild-type plants.

[0093] 4. Detection of NHP and Pip contents in transgenic plants

[0094] After chopping 100 mg of citrus tissue, it was quickly frozen in liquid nitrogen, and then ground in a tissue grinder at 50 Hz for 2 minutes. The ground tissue was resuspended in 500 mL of 80% MeOH:H2O (v / v), shaken and mixed at 4°C for 12 h, then centrifuged at 13,000 rpm for 10 minutes. After collecting the supernatant with a 1 mL syringe, it was filtered through a 0.22 μm polyvinylidene fluoride filter membrane, and the changes in NHP and Pip contents in transgenic plants were detected by UPLC-MS / MS. The detection results are as Figure 3 shown in D. The results show that in CsFMO1-1 transgenic plants, the NHP content is significantly increased in both leaves and roots compared with the empty vector control group, and the Pip content is significantly increased in roots.

[0095] Example 5

[0096] Evaluation of the Resistance of OE-CsFMO1-1 Transgenic Plants to Huanglongbing

[0097] Extract DNA from leaf veins, design primers O11 / O12C for conventional PCR (see Tables 1 and 2) to detect the Huanglongbing virus source. Infect the obtained transgenic plants with the determined virus source by the method of leaf disc grafting. The specific grafting method refers to Xie et al. (Xie et al., 2021). The materials after virus infection are cultured in a modified central light incubator, watered, and the symptom changes are observed and recorded regularly. Referring to Li et al. (2006), the content of the pathogen of Huanglongbing in transgenic plants was detected by quantitative PCR (qPCR)-probe method. At 40, 60, and 80 days after CLas inoculation, 3 virus-infected leaves (including transgenic plants and wild-type plants) were picked respectively, DNA was extracted, the DNA concentration and quality were detected, and quantified to 10 ng / μL. The content of CLas was detected by qPCR.

[0098] Table 1 qPCR reaction system

[0099]

[0100] Table 2 qPCR reaction program

[0101]

[0102] Symptom observation showed that Figure 4 as shown, obvious phenotypic differences occurred between transgenic plants and wild-type plants. To determine the response of transgenic plants to CLas infection, the leaf vein DNA of transgenic plants and wild-type plants was extracted at 40, 60, and 80 days after grafting virus infection, and qPCR was used to detect the growth of CLas in the leaf veins. Compared with the wild-type control, the growth of CLas in transgenic plants was slow. At 80 days, although the pathogen content increased, it was still significantly lower than that of the wild-type. Symptom observation found that after 80 days of virus infection, the wild-type control showed symptoms such as leaf yellowing and vein bulging, while these symptoms did not appear in transgenic plants.

[0103] Therefore, overexpression of CsFMO1-1 can enhance the resistance of citrus to Huanglongbing.

[0104] In the present invention, the media used for Agrobacterium rhizogenes transformation are as follows:

[0105] LB medium: 5 g / L yeast extract + 10 g / L peptone + 10 g / L NaCl, pH 5.8.

[0106] MS infection solution: 4.43 g / L MS, pH 5.4.

[0107] The specific embodiments described above further elaborate on the object, technical solution and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein, characterized in that: By regulating the expression level of CsFMO1-1 protein in citrus plants, the resistance of citrus plants to citrus Huanglongbing disease is improved. The amino acid sequence of the CsFMO1-1 protein is shown in SEQ ID NO:

1.

2. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 1, characterized in that: The gene encoding the CsFMO1-1 protein is the Citrus CsFMO1-1 gene, and its nucleotide sequence is shown in SEQ ID NO:

2.

3. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 1, characterized in that: The specific method for regulating the expression level of CsFMO1-1 protein is: upregulating the expression level of CsFMO1-1 protein in citrus plants.

4. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 3, characterized in that: The method of up-regulating the expression level of CsFMO1-1 protein in citrus plants is to use an overexpression vector to control the expression of CsFMO1-1 gene in citrus, thereby up-regulating the accumulation of citrus CsFMO1-1 protein.

5. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 1, characterized in that: The specific steps include: (1) Cloning the coding sequence of the citrus CsFMO1-1 gene; (2) constructing an overexpression vector; (3) The overexpression vector was used to transform citrus to obtain transgenic plants overexpressing CsFMO1-1.

6. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 5, characterized in that: In step (1), the cloning method of the coding sequence of citrus CsFMO1-1 gene is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally using high-fidelity enzyme PCR to amplify the CsFMO1-1 gene coding sequence DNA fragment.

7. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 6, characterized in that: In step (1), the PCR primers used to clone the coding sequence of the citrus CsFMO1-1 gene are OE-F and OE-R, and their nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

8. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 5, characterized in that: In step (2), the overexpression vector construction method is: using pNmGFPer as a vector, the pNmGFPer vector carries a CaMV 35S promoter, the CaMV 35S promoter is a cauliflower mosaic virus promoter, and has a nucleotide sequence shown in SEQ ID NO: 5, and the target fragment is cut with SalⅠ and BamHI and then connected to the vector recovered by SalⅠ and BamHI to construct the overexpression vector pNmGFPer-CsFMO1-1.

9. The method for improving citrus Huanglongbing resistance by using CsFMO1-1 protein according to claim 5, characterized in that: In step (3), the method for transforming citrus with the overexpression vector is as follows: the overexpression vector is transformed into Agrobacterium rhizogenes by heat shock method, and then the citrus explants are transformed by Agrobacterium rhizogenes, and the explant cells after genetic transformation are cultured with vermiculite and identified by GFP fluorescence to obtain transgenic plants.

10. A citrus fruit resistant to Huanglongbing, characterized in that: The method is obtained by any one of claims 1 to 9.

Citation Information

Patent Citations

  • Enhancing cell survival against biological and abiotic stress by salicylic acid-induced NPR1 condensates

    CN116075522A

  • Atypical MEKK protein CsMEKK1-1 for resisting citrus huanglongbing and preparation method of disease-resistant citrus

    CN118207182A

  • Small molecule compound capable of inducing plant immune response and improving plant disease resistance

    CN121087047A

  • Use of elongator genes to improve plant disease resistance

    WO2017011462A1

  • Cultivation method for Anti-yellow-shoot-disease plant and use thereof

    WO2024165060A1

Cited By

  • Method for improving citrus yellow vein disease resistance by using lemon clSKP1A gene

    CN120738268A