OsSNAP32 gene and application of protein coded by OsSNAP32 gene in regulation and control of resistance of plants to rice serrated leaf dwarf virus

Abstract

The invention relates to the technical field of biology, in particular to an application of an OsSNAP32 gene and a protein coded by the OsSNAP32 gene in regulating and controlling the resistance of a plant to a rice serrated leaf dwarf virus. The nucleotide sequence of the OsSNAP32 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the protein coded by the OsSNAP32 gene is as shown in SEQ ID NO. 2. It is found for the first time that by improving expression of the OsSNAP32 gene or the protein coded by the OsSNAP32 gene in rice, the resistance of the rice to the rice serrated leaf dwarf virus can be reduced; by reducing the expression of the OsSNAP32 gene or the protein coded by the OsSNAP32 gene, the resistance of the rice to the rice serrated leaf dwarf virus can be improved. According to the OsSNAP32 gene provided by the invention, the protein coded by the OsSNAP32 gene provides an important gene resource for rice disease-resistant breeding work in the future.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of the OsSNAP32 gene and the protein encoded thereby in regulating the resistance of plants to rice ragged stunt virus. Background Art

[0002] In the vesicle trafficking system of eukaryotes, SNARE proteins (Soluble N-ethylmaleimide-sensitive factor Attachment protein REceptor) play a central role as key molecular components mediating membrane fusion. According to their subcellular localization characteristics, the SNARE family can be divided into two basic types: v-SNAREs (vesicle membrane-localized type) and t-SNAREs (target membrane-localized type). When a transport vesicle anchors to the target membrane, the v-SNARE assembles with three t-SNARE subunits (usually including Qa, Qb, and Qc types) on the target membrane to form a trans-SNARE complex through a helical bundle, and the resulting zipper-like mechanical force drives the fusion of the lipid bilayer membranes. From the perspective of molecular evolution, according to the characteristics of the central residue of the hydrophobic heptapeptide repeat sequence of the SNARE motif, it can be divided into four categories: Qa-, Qb-, Qc-, and R-SNAREs. In mammalian models, the classical SNARE complex is assembled by the Qa- (syntaxin 1 homolog), Qb- (N-terminal domain of SNAP25), and Qc- (C-terminal domain of SNAP25) localized on the target membrane in cooperation with the R-SNARE on the vesicle membrane. It is worth noting that this combination pattern is also conserved in the plant system. For example, genomics research shows that the genome of the model plant Arabidopsis thaliana encodes approximately 65 SNARE proteins, and the number is significantly higher than that of single-celled organisms and mammals. This amplification phenomenon may be closely related to the unique complexity of the endomembrane system in plants - compared with other biological systems, plants require more than twice the number of SNARE molecules to regulate the highly differentiated secretory pathway and vacuolar trafficking network.

[0003] Breakthroughs have been made in the response of plant SNARE proteins to biotic stress in the plant system. However, there are still many unsolved mysteries regarding the functional diversity of SNARE proteins in plant cells and the types of complexes they may form in intracellular membrane trafficking. Model plants such as Arabidopsis thaliana and rice not only have a large SNARE family, but there is also component overlap among some of their complexes, suggesting that the physiological significance of the number of SNARE members and the dynamic combination of complexes needs to be further elucidated. Notably, thanks to the rich genetic resources, complete genomic information, and mature molecular operation systems of Arabidopsis thaliana, it is currently in the golden age of plant cell biology research. By constructing an in vitro reconstitution system containing specific SNARE combinations, the functional specificity of SNARE complexes with slight component differences in membrane fusion can be accurately analyzed. At the same time, integrating in vivo research methods such as live imaging technology and vesicle cargo tracking with in vitro biochemical analysis will systematically clarify the molecular regulatory network of vesicle trafficking and its spatiotemporal dynamic characteristics, thereby revealing the pivotal role of this mechanism in plant growth and development regulation and environmental adaptation strategies.

[0004] Rice, as an important global food source, has long been invaded by various pathogens, which seriously affects its yield. Among them, rice viruses are regarded as the "potential threat to rice" due to their strong concealment and rapid transmission. These viruses are transmitted by insect vectors, and once they break out, they often lead to a sharp drop in rice yield or even a complete crop failure. For example, Rice ragged stunt virus (RRSV), as a member of the genus Oryzavirus, has been prevalent in East Asia, Southeast Asia, and South Asia many times, causing extensive agricultural losses.

[0005] Especially in the southern rice-growing regions of China, RRSV poses a major threat to rice yield, bringing a heavy economic burden to local farmers. The virus is mainly transmitted by the brown planthopper and spreads among hosts through persistent proliferation. The virus particles of RRSV have an isometric icosahedral structure with a double protein coat, and the diameter is about 75 - 80 nanometers. There are two types of protrusions, type A and type B, on its surface, and the internal core diameter is about 57 - 65 nanometers. The virus remains stable within the pH range of 6.0 - 9.0 and can maintain its structural integrity in a certain concentration of magnesium chloride solution, but it is sensitive to high temperatures and easily loses its infectivity.

[0006] Rice plants infected with RRSV will show typical symptoms such as stunted plants, increased tillering, twisted and wrinkled leaves with serrated notches. In severe infections, rice may not be able to head normally or have short panicles, and the grain filling process is blocked, resulting in a significant reduction in yield. Currently, effective control strategies for RRSV are still being explored, and no mature solutions have been formed. In addition, research on the role of SNARE proteins and their encoding genes in enhancing the antiviral ability of rice is still blank. Summary of the Invention

[0007] The object of the present invention is to provide the application of the OsSNAP32 gene and the protein encoded thereby in regulating the resistance of plants to rice ragged stunt virus.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows: The application of the OsSNAP32 gene in regulating the resistance of plants to rice ragged stunt virus, wherein the nucleotide sequence of the OsSNAP32 gene is as shown in SEQ ID NO.1; The regulation of the resistance of plants to rice ragged stunt virus specifically means that overexpression of the OsSNAP32 gene reduces the resistance of plants to rice ragged stunt virus; knockout of the OsSNAP32 gene increases the resistance of plants to rice ragged stunt virus; the plant is rice.

[0009] The application of the OsSNAP32 protein in regulating the resistance of plants to rice ragged stunt virus, wherein the amino acid sequence of the OsSNAP32 protein is as shown in SEQ ID NO.2; The regulation of the resistance of plants to rice ragged stunt virus specifically means that increasing the expression of the OsSNAP32 protein reduces the resistance of plants to rice ragged stunt virus; reducing the expression of the OsSNAP32 protein increases the resistance of plants to rice ragged stunt virus; The plant is rice.

[0010] A method for reducing the resistance of plants to rice ragged stunt virus, comprising the following steps: introducing the OsSNAP32 gene into a recipient plant to overexpress the OsSNAP32 gene in the recipient plant to obtain a transgenic plant; the transgenic plant has a reduced resistance to rice ragged stunt virus compared with the recipient plant; the nucleotide sequence of the OsSNAP32 gene is as shown in SEQ ID NO.1; The plant is rice.

[0011] A method for increasing the resistance of plants to rice ragged stunt virus, comprising the following steps: inhibiting the expression of the OsSNAP32 gene in a recipient plant to obtain a transgenic plant; the transgenic plant has an increased resistance to rice ragged stunt virus compared with the recipient plant; the nucleotide sequence of the OsSNAP32 gene is as shown in SEQ ID NO.1; The plant is rice.

[0012] The remarkable advantage of the present invention lies in: The present invention discovers for the first time that increasing the expression of the OsSNAP32 gene or the protein encoded by the OsSNAP32 gene in rice can reduce the resistance of rice to rice ragged stunt virus; reducing the expression of the OsSNAP32 gene or the protein encoded by the OsSNAP32 gene can increase the resistance of rice to rice ragged stunt virus. The OsSNAP32 gene and the protein encoded by the OsSNAP32 gene provided by the present invention provide important gene resources for future rice disease resistance breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : Western identification of OsSNAP32 transgenic rice.

[0014] Figure 2 : Identification of OsSNAP32 CRISPR / Cas9 transgenic rice.

[0015] Figure 3 : qRT-PCR detection of RRSV virus-related genes in OsSNAP32 transgenic rice, OsSNAP32 CRISPR / Cas9 transgenic rice and wild-type rice (Zhonghua 11) after RRSV infection.

[0016] Figure 4 : Symptom diagrams of different rice lines infected with RRSV. DETAILED DESCRIPTION OF THE INVENTION

[0017] In order to make the content of the present invention easier to understand, the technical solutions of the present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited thereto.

[0018] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0019] Example 1. Obtaining of OsSNAP32 Protein and Its Encoding Gene I. Obtaining of OsSNAP32 Protein and Its Encoding Gene The rice OsSNAP32 sequence is publicly available in the Rice Genome Annotation Database (http: / / rice.plantbiology.msu.edu / ) and can be retrieved by LOC_Os02g24080. The DNA sequence starting from the ATG start codon of the OsSNAP32 CDS sequence was intercepted, and PCR primers were designed: OsSNAP32 CDS-F: 5'-ATGTGCTGCTCTTCC-3', OsSNAP32 CDS-R: 5'-TTATTTTCCAAGCAGACGGCGTG-3'.

[0020] According to the instructions, total RNA of Zhonghua 11 rice (Oryza sativa L. japonica cv. Zhonghua 11, Xu Yu, et al., "Cloning of the Glutelin Gt1 Gene and Construction of an Expression Vector of the Gt1 Gene Directed by the Waxy Gene Promoter in Rice cv. Zhonghua 11", Journal of Shanghai Normal University (Natural Science Edition), Vol. 39, No. 2, April 2010, p. 204) was extracted using TRIzol Reagent from Invitrogen, and reverse transcription was performed using the company's SuperScript II reverse transcriptase to obtain cDNA. The primer used for reverse transcription was an Oligod(T) primer of 16 nucleotides.

[0021] Using the cDNA obtained by reverse transcription as a template, PCR (Polymerase Chain Reaction) was performed with the above primers OsSNAP32 CDS-F and OsSNAP32 CDS-R to obtain a 969-bp PCR product, and this PCR product has the sequences shown in SEQ ID NO.1 - 2.

[0022] After recovering the PCR product, it was ligated with the vector pEASY-Blunt Zero Cloning Kit (TransGen Biotech, Product Catalog Number: CB501-01), and Escherichia coli strain DH5α was transformed to obtain transformants. The plasmid of the transformants was extracted and sent for sequencing. This plasmid was obtained by inserting the OsSNAP32 gene shown in SEQ ID NO.1 into the vector pEASY-Blunt, and this plasmid was named pEASYBlunt-SNAP32, which is the recombinant vector.

[0023] Example 2: Obtaining of OsSNAP32-Transgenic Rice I. Construction of expression vector Using pEASY-Blunt-SNAP32 as a template, PCR amplification was performed with primers SNAP32-5'SalI (5’-aggggatcctctagagtcgacATGTGC TGCTCTTCC-3’) and SNAP32-3’PstI (5’-taaagcagggcatgcctgcagTTATTTTCCAAGCAGACGG CGTG-3’) to obtain a PCR product. The PCR product was purified and recovered, and then ligated with the pCambia2300-Actin-Flag plasmid vector backbone digested with SalI and PstI by seamless cloning (referring to Novizan Co., product catalog number: C112-01) to obtain the recombinant plasmid pCambia2300-Actin-FLAGSNAP32. After sequencing, the recombinant plasmid pCambia2300-Actin-FLAGSNAP32 was obtained by inserting the OsSNAP32 gene shown in SEQ ID NO.1 between the SalI and PstI digestion sites of the pCambia2300-Actin-Flag plasmid.

[0024] II. Genetic transformation of rice 1) Inductive culture of callus The seeds of Zhonghua 11 rice (hereinafter also referred to as wild-type rice) were dehulled, first soaked in 70% ethanol for 10 min, and then soaked in 0.1% mercuric chloride for 30 min for surface sterilization. The solution on the seed surface was washed off with a large amount of sterile water, and the water on the seed surface was blotted with sterile filter paper. The seeds were placed on the mature embryo callus induction medium plate, and the edges of the petri dish were sealed with Parafilm membrane and cultured in the dark in an incubator at 26°C. After about 15 days, the grown callus was carefully removed and transferred to the mature embryo subculture medium for continuous culture under the same conditions. Subculture was required every two weeks. When used for transformation, yellowish granular callus subcultured for about 5 days was selected.

[0025] 2) Culture of Agrobacterium pCambia2300-Actin-FLAGSNAP32 was electrotransformed into Agrobacterium EHA105 to obtain the recombinant strain EHA105 / pCambia2300-Actin-FLAGSNAP32.

[0026] EHA105 / pCambia2300-Actin-FLAGSNAP32 was streaked on an LB plate containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and cultured at 28°C for 2 days. A single colony was picked and inoculated into liquid LB medium, and cultured with shaking at 28°C until OD 600Approximately 0.5, add acetosyringone to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice calli.

[0027] 3) Co-culture of rice calli and Agrobacterium Put the subcultured calli into a sterilized conical flask, pour in the Agrobacterium suspension to submerge the calli. Place at room temperature for 20 min, and gently shake from time to time to ensure sufficient contact between the calli and the bacterial solution. Gently remove the calli with sterile forceps, place them on sterile filter paper to absorb the excess bacterial solution, and transfer them to a co-culture medium plate covered with a layer of sterile filter paper. Incubate in the dark at 28 °C for 3 days to obtain co-cultured calli.

[0028] 4) Screening and differentiation of resistant calli Wash the co-cultured calli with an appropriate amount of sterile water to remove the residual Agrobacterium on the surface, place them on the screening medium, and culture them in the dark at 26 °C for screening. After two weeks, transfer them to a new screening medium and continue screening for another two weeks. Select the calli with better status after two rounds of screening, transfer them to a differentiation medium plate, first culture them in the dark for 3 days, and then transfer them to a light incubator (15 hr / day) for light culture. Small seedlings can be seen after one month. When the differentiated small seedlings grow to about 2 cm, transfer them to the rooting medium in a conical flask and continue to culture for about two weeks. Select the small seedlings with better growth and well-developed roots, wash the medium on the roots with tap water and transplant them into the soil, collect the seeds to obtain T1 generation FLAGSNAP32 transgenic rice seeds, and sow them to obtain T1 generation FLAGSNAP32 transgenic rice (i.e., OsSNAP32 transgenic rice).

[0029] The rice seeds of T1 generation are preliminarily screened by G418 (the pCambia2300 vector carries a G418 resistance screening gene). The germinated seeds indicate that the vector has been transferred into the rice. Plant the germinated seeds into the soil. After growing for 2 weeks, take 0.1 g of leaves and grind them into powder with liquid nitrogen.

[0030] Add 200 μl of protein extraction buffer (0.25 M Tris-HCl, pH 6.8, 8% SDS, 8% β-mercaptoethanol, 20% glycerol) to the leaf powder of OsSNAP32 transgenic rice, incubate on ice for 10 min, boil at 100 °C for 10 min, centrifuge at 4 °C and 12,000 rpm for 10 min, and take the supernatant for SDS-PAGE. After transferring the membrane, perform Western blotting. SDS-PAGE and Western Blot are carried out according to the well-known methods and product instructions. The antibody used is anti-FLAG-HRP (sigma), and the endogenous Actin protein of rice is detected with the antibody anti-Actin as an internal reference. As Figure 1Those with a band at 40 KDa are positive, indicating that the target gene has been transferred and the protein is expressed. Two overexpression lines, OE#1 and OE#2, were selected for subsequent disease resistance analysis experiments (Zhonghua 11 in the figure is the wild-type rice and was used as a negative control).

[0031] Example 3: Obtaining of OsSNAP32 CRISPR / Cas9 Transgenic Rice I. Construction of Expression Vector 1) According to the website http: / / skl.scau.edu.cn / home / , based on the PAM site with the terminal sequence of NGG, the specific target sequence targeting the N-terminus of the OsSNAP32 coding region was selected as follows: AGGAACGACTTCCGCGACACCGG; 2) Primers were designed according to the DNA sequence of the target, and BsaI restriction sites were added at both ends of the primers. The primer sequences were U-F: 5’-CTCCGTTTTACCTGTGGAATCG-3’, OsSNAP32-gRT1: 5’-GGAACGACTTCCGCGACACgttttagagctagaaat-3’, OsSNAP32-U3T1: 5’-GTGTCGCGGAAGTCGTTCCTgccacggatcatctgc-3’, gRNA-R: 5’-CGGAGGAAAATTCCATCCAC-3’; B1’: 5’-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3’, B2: 5’-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3’; 3) Using the intermediate vector as a template, three rounds of PCR amplification were carried out with three pairs of primers, U-F / OsSNAP32-U3T1, OsSNAP32-gRT1 / gRNA-R, and B1’ / B2, respectively, to obtain an expression cassette with adapters; among them, the intermediate vector contains the specific target sequence targeting the N-terminus of the OsSNAP32 coding region: AGGAACGACTTCCGCGACACCGG; 4) After the amplification was completed, the final product was cut and purified by gel extraction and recovery. The final vector pYLCRISPR / Cas9 (Ma etal., 2013, A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant. 2015), restriction endonucleases, and T4 ligase were added, and ligation was carried out while cutting according to a certain system.

[0032] 5) Transform Escherichia coli strain DH5α, spread it on a kanamycin-resistant medium to obtain transformants, extract the plasmids of the transformants and send them for sequencing. The positive transformants are the final recombinant vectors, named pYLCRISPR / Cas9-SNAP32:sgRNA.

[0033] II. Genetic transformation of rice 1) Culture and transformation of callus See Example 2, II. 1)-4) 2) Identification of OsSNAP32 CRISPR / Cas9 transgenic rice The leaf powder of OsSNAP32 CRISPR / Cas9 transgenic rice is used to extract genomic DNA. The specific method refers to the High Efficiency Plant Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., product number: DP350). Then, using 0.5 g of genomic DNA as a template, primers SNAP32-C-F: 5’-CATTTGTGCGCAGAAACTTGC-3’ and primer SNAP32-C-R: 5’-ATCAGGCTTCTGAGTAATCACATA-3’ are used for PCR reaction. The PCR products are directly sent for sequencing and then sequence alignment is performed. As Figure 2 shown, the DNA sequencing results alignment shows that two positive lines are named KO#1 and KO#2 respectively. Among them, KO#1 inserts two Gs at the 335th position in the OsSNAP32 coding region, resulting in a frameshift and premature termination of the OsSNAP32 amino acid sequence; KO#2 deletes 26 bases near the target site in the OsSNAP32 coding region, resulting in a frameshift and premature termination of the OsSNAP32 amino acid sequence.

[0034] Example 4: Overexpression of OsSNAP32 can reduce the resistance of rice to RRSV, and OsSNAP32 CRISPR / Cas9 can reduce the resistance of rice to RRSV 1) Identification of RRSV infection by identifying the expression level of RRSV S8 through quantitative real-time PCR (qRT-PCR). Brown planthoppers carrying RRSV (see Zhang et al., 2016. Suppression of jasmonic acid-mediated defense by viral-inducible microRNA319 facilitates virus infection in rice. Molecular Plant. 9: 1302-1314) (the pathogen is rice ragged stunt virus) were used to inoculate T1 generation transgenic OsSNAP32 rice, transgenic OsSNAP32 CRISPR / Cas9 rice, and wild-type rice Zhonghua 11. 30 plants of each type of rice were inoculated. They were cultured at 30 °C during the day, 22 °C at night, and a humidity of 60%. 3 brown planthoppers were inoculated on each plant. After three days of feeding, the brown planthoppers were removed, and the inoculated rice was cultured in a sunlight greenhouse (natural light). The experiment was repeated 3 times, and the results were averaged.

[0035] Four weeks after virus inoculation, the powdered leaves of T1 generation transgenic OsSNAP32 rice, transgenic OsSNAP32 CRISPR / Cas9 rice, and wild-type rice Zhonghua 11 after virus infection were collected, and Trizol (Invitrogen) was added respectively. RNA was extracted according to the method described in the instruction manual. Then, genomic DNA in the RNA was digested with RQ1 DNase (Promega, catalog number: M610A). Then, 2 μg of the digested RNA was taken for reverse transcription qRT-PCR. The specific method can be referred to Invitrogen M-MLV Reverse Transcriptase (catalog number: 28025-021). OsEF1α was used as an internal reference. The primers for the internal reference were EF1α-F: 5’-GCACGCTCTTCTTGCTTTCACTCT-3’ and EF1α-R: 5‘-AAAGGTCACCACCATACCAGGCTT-3’. The expression level of RRSV S8 was detected. The primers for RRSV S8 were S8-F: 5’-CACCAAACAACGCACTACC AT-3’ and S8-R: 5’-AATCAGTCGGAGCAGCAAATC-3’. The results were as Figure 3As shown, it can be seen that the accumulation of RRSV S8 in OE#1 and OE#2 rice is higher than that in the wild-type rice Zhonghua 11, while the accumulation of RRSV S8 in KO#1 and KO#2 rice is lower than that in the wild-type rice Zhonghua 11 (the asterisks in the figure indicate significant differences). Therefore, overexpression of OsSNAP32 can reduce the resistance of rice to RRSV, while OsSNAP32 CRISPR / Cas9 can enhance the resistance of rice to RRSV.

[0036] 2) Determine the RRSV infection rate through phenotypes In addition, we took pictures of diseased rice of different lines. As Figure 4 shown, the figure shows the diseased symptom pictures of healthy, OsSNAP32 transgenic rice and OsSNAP32 CRISPR / Cas9 transgenic rice at 4 weeks after infection. It can be seen that the diseased symptoms of OE#1 and OE#2 rice are stronger, showing a relatively stronger dwarfing degree compared to the wild type; while the diseased symptoms of KO#1 and KO#2 rice are relatively weaker, showing a weaker dwarfing degree. Compared with the wild-type rice, OsSNAP32 transgenic rice is more susceptible to disease, while OsSNAP32 CRISPR / Cas9 transgenic rice is more disease-resistant.

[0037] The above are only the preferred embodiments of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the present invention.

Claims

1. OsSNAP32 The use of a gene in regulating plant resistance to rice sawtooth leaf dwarf virus is characterized by: Said OsSNAP32 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The regulation of plant resistance to rice serrated leaf dwarf virus is specifically: overexpression OsSNAP32 Gene, reduces plant resistance to rice serrated leaf dwarf virus; knockout OsSNAP32 Gene, improves plant resistance to rice sawtooth leaf dwarf virus.

3. The use according to claim 1, characterized in that: The plant is rice.

4. Use of OsSNAP32 protein in regulating plant resistance to rice sawtooth leaf dwarf virus, characterized in that: The amino acid sequence of the OsSNAP32 protein is shown in SEQ ID NO.

2.

5. The use according to claim 4, characterized in that: The method for regulating the resistance of plants to rice serrated leaf dwarf virus is specifically as follows: increasing the expression of OsSNAP32 protein to reduce the resistance of plants to rice serrated leaf dwarf virus; reducing the expression of OsSNAP32 protein to increase the resistance of plants to rice serrated leaf dwarf virus.

6. The use according to claim 4, characterized in that: The plant is rice.

7. A method for reducing plant resistance to rice sawtooth leaf dwarf virus, characterized in that: The following steps are involved: Introduced into recipient plants OsSNAP32 Gene, OsSNAP32 The gene is overexpressed in a recipient plant to obtain a transgenic plant; the transgenic plant has reduced resistance to rice sawtooth leaf dwarf virus compared with the recipient plant; OsSNAP32 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that: The plant is rice.

9. A method for improving plant resistance to rice sawtooth leaf dwarf virus, characterized in that: The following steps are involved: Inhibitory receptors in plants OsSNAP32 The gene is expressed to obtain a transgenic plant; the transgenic plant has improved resistance to rice sawtooth leaf dwarf virus compared with the recipient plant; the OsSNAP32 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. The method according to claim 9, characterized in that: The plant is rice.

Images