Application of maltose hydrolysis system enzyme and related biological materials thereof in preparation of threonine

By introducing maltose hydrolysis system enzymes into Escherichia coli, the problem of insufficient threonine fermentation yield in the existing technology was solved, and a significant output increase was achieved, meeting industrial needs.

CN120193033APending Publication Date: 2025-06-24NINGXIA EPPEN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510333053.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

In the prior art, the effects of maltose hydrolysis-related gene expression from Klebsiella pneumoniae, Bacillus safensis, Clostridium acetobutylicum, Paenibacillus durus, Bacillus smithii, Fusobacterium mortiferum, Lentibacillus salicampi and Bacillus sp. on L-threonine production have not been fully studied, resulting in insufficient threonine fermentation yield.

Method used

Maltose hydrolysis system enzymes and related biological materials were introduced, including Klebsiella pneumoniae, Bacillus safensis, Clostridium acetobutylicum, Paenibacillus durus, Bacillus smithii, Fusobacterium mortiferum and Lentibacillus salicampi-derived maltose hydrolysis system enzymes derived from, by constructing engineered strains that express these enzymes highly, and improve threonine yield.

Benefits of technology

By enhancing the expression of enzymes in the maltose hydrolysis system, the L-threonine production of Escherichia coli strain was significantly improved, and the yield increased by 8.88% to 10.06%, meeting the needs of industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005320929270000251
    Figure BDA0005320929270000251
Patent Text Reader

Abstract

The invention discloses application of maltose hydrolysis system enzyme and related biological materials thereof in preparation of threonine, and belongs to the technical field of microorganisms. The technical problem to be solved by the invention is how to improve the fermentation yield of threonine. In order to solve the technical problem, the invention provides application of the maltose hydrolysis system enzyme and / or the biological material related to the maltose hydrolysis system enzyme in preparation of recombinant microorganisms containing and / or expressing the maltose hydrolysis system enzyme and / or in preparation of threonine. The invention also provides a composition for preparing threonine. The composition contains the recombinant microorganism and / or the recombinant microorganism prepared by the method. The invention discloses the application of an exogenous and expression-enhanced maltose hydrolysis system enzyme in improving the threonine yield of a receptor microorganism for the first time. The maltose hydrolysis system enzyme provided by the invention has important application value in the fields of engineering bacterium preparation of threonine, process fermentation and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to the application of maltose hydrolysis system enzymes and related biological materials thereof in the preparation of threonine. Background Art

[0002] L-threonine is an essential amino acid, which can promote the development of mammalian mammary gland cells, improve the immune status of animals and accelerate the repair of muscle tissues, and is widely used in industries such as medicine, food and feed. At present, L-threonine is mainly produced by microbial fermentation in industry. With the continuous increase in the market demand for L-threonine, continuously optimizing the fermentation performance of production strains and developing more economical and efficient fermentation processes to improve the production efficiency of threonine have increasingly attracted the attention of researchers.

[0003] There is no research on the effect of gene expression related to maltose hydrolysis and the encoded enzymes derived from Klebsiella pneumoniae, Bacillus safensis, Clostridium acetobutylicum, Paenibacillus durus, Bacillus smithii 7_3_47FAA, Fusobacterium mortiferum, Lentibacillus salicampi, Bacillus sp. on L-threonine production. Summary of the Invention

[0004] The technical problem to be solved by the present invention is: how to improve the fermentation yield of threonine. To solve this technical problem, the present invention provides the following technical solutions:

[0005] The present invention provides the application of at least one of the following:

[0006] A1), the application of maltose hydrolysis system enzymes and / or biological materials related to the maltose hydrolysis system enzymes in the preparation of threonine;

[0007] A2), the application of the maltose hydrolysis system enzymes and / or biological materials related to the maltose hydrolysis system enzymes in improving the threonine yield of microorganisms;

[0008] A3), the application of the maltose hydrolysis system enzymes and / or biological materials related to the maltose hydrolysis system enzymes in constructing engineering bacteria producing threonine;

[0009] A4), the application of the maltose hydrolysis system enzymes and / or biological materials related to the maltose hydrolysis system enzymes in constructing recombinant microorganisms with high threonine yield; the threonine yield of the recombinant microorganisms is higher than that of the starting strain.

[0010] Further, in the present invention, the maltose hydrolysis system enzyme is at least selected from any one or more of the following:

[0011] B1), the maltose hydrolysis system enzyme derived from Klebsiella pneumoniae;

[0012] B2), the maltose hydrolysis system enzyme derived from Bacillus safensis;

[0013] B3), the maltose hydrolysis system enzyme derived from Clostridium acetobutylicum;

[0014] B4), the maltose hydrolysis system enzyme derived from Paenibacillus durus;

[0015] B5), the maltose hydrolysis system enzyme derived from Bacillus smithii;

[0016] B6), the maltose hydrolysis system enzyme derived from Fusobacterium mortiferum;

[0017] B7), the maltose hydrolysis system enzyme derived from Lentibacillus salicampi;

[0018] B8), the maltose hydrolysis system enzyme derived from Bacillus sp.

[0019] Further, in the present invention, the maltose hydrolysis system enzyme derived from Klebsiella pneumoniae includes the PTS system α-glucoside-specific EIICB component and 6-phosphoglucosidase derived from Klebsiella pneumoniae. The PTS system α-glucoside-specific EIICB component derived from Klebsiella pneumoniae contains at least one of the following proteins:

[0020] a1), a protein whose amino acid sequence contains SEQ ID NO.1;

[0021] a2), a protein obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of the protein shown in a1), having more than 70% identity with the amino acid sequence shown in a1), and related to the maltose hydrolysis system enzyme;

[0022] a3), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0023] Further, in the present invention, the 6-phosphoglucosidase derived from Klebsiella pneumoniae comprises at least one of the following:

[0024] a4), a protein whose amino acid sequence comprises SEQ ID NO.3;

[0025] a5), a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of the protein shown in a4), has more than 70% identity with the amino acid sequence shown in a4), and is related to the maltose hydrolysis system enzyme;

[0026] a6), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1) or a2).

[0027] Further, in the present invention, the maltose hydrolysis system enzyme derived from Bacillus safensis comprises a 6-phosphoglucosidase derived from Bacillus safensis, and the 6-phosphoglucosidase derived from Bacillus safensis comprises at least one of the following:

[0028] a7), a protein whose amino acid sequence comprises SEQ ID NO.7;

[0029] a8), a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of the protein shown in a7), has more than 70% identity with the amino acid sequence shown in a7), and is related to the maltose hydrolysis system enzyme;

[0030] a9), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a7) or a8).

[0031] Further, in the present invention, the maltose hydrolysis system enzyme derived from Clostridium acetobutylicum comprises a 6-phosphoglucosidase derived from Clostridium acetobutylicum and a PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum, and the 6-phosphoglucosidase derived from Clostridium acetobutylicum comprises at least one of the following:

[0032] a10), a protein whose amino acid sequence comprises SEQ ID NO.10;

[0033] a11) A protein that has more than 70% identity with the amino acid sequence of the protein shown in a10) and is related to a maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a10);

[0034] a12) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a10) or a11).

[0035] Furthermore, in the present invention, the PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum comprises at least one of the following:

[0036] a13) A protein whose amino acid sequence comprises SEQ ID NO.12;

[0037] a14) A protein that has more than 70% identity with the amino acid sequence of the protein shown in a13) and is related to a maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a13);

[0038] a15) A fusion protein obtained by linking a tag to the N-terminus and / or N-terminus of a13) or a14).

[0039] Furthermore, in the present invention, the maltose hydrolysis system enzyme derived from Paenibacillus durus includes 6-phosphoglucosidase derived from Paenibacillus durus, and the 6-phosphoglucosidase derived from Paenibacillus durus comprises at least one of the following:

[0040] a16) A protein whose amino acid sequence comprises SEQ ID NO.15;

[0041] a17) A protein that has more than 70% identity with the amino acid sequence of the protein shown in a16) and is related to a maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a16);

[0042] a18) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a16) or a17).

[0043] Furthermore, in the present invention, the maltose hydrolysis system enzyme derived from Bacillus smithii includes 6-phosphoglucosidase derived from Bacillus smithii, and the 6-phosphoglucosidase derived from Bacillus smithii comprises at least one of the following:

[0044] a19), a protein whose amino acid sequence comprises SEQ ID NO. 18;

[0045] a20), a protein which has more than 70% identity with the amino acid sequence shown in a19) and is related to the maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a19);

[0046] a21), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a19) or a20).

[0047] Furthermore, in the present invention, the maltose hydrolysis system enzyme derived from Fusobacterium mortiferum includes the 6-phosphoglucosidase derived from Fusobacterium mortiferum, and the 6-phosphoglucosidase derived from Fusobacterium mortiferum includes at least one of the following:

[0048] a22), a protein whose amino acid sequence comprises SEQ ID NO. 21;

[0049] a23), a protein which has more than 70% identity with the amino acid sequence shown in a22) and is related to the maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a22);

[0050] a24), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a22) or a23).

[0051] Furthermore, in the present invention, the maltose hydrolysis system enzyme derived from Lentibacillus salicampi includes the 6-phosphoglucosidase derived from Lentibacillus salicampi, and the 6-phosphoglucosidase derived from Lentibacillus salicampi includes at least one of the following:

[0052] a25), a protein whose amino acid sequence comprises SEQ ID NO. 24;

[0053] a26), a protein which has more than 70% identity with the amino acid sequence shown in a25) and is related to the maltose hydrolysis system enzyme, obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence of the protein shown in a25);

[0054] a27), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of a25) or a26).

[0055] Further, in the present invention, the maltose hydrolysis system enzyme derived from Bacillus sp. includes a 6-phosphoglucosidase derived from Bacillus sp., and the 6-phosphoglucosidase derived from Bacillus sp. includes at least one of the following:

[0056] a28), a protein whose amino acid sequence includes SEQ ID NO. 27;

[0057] a29), a protein that has more than 70% identity with the amino acid sequence of the protein shown in a28) and is related to the maltose hydrolysis system enzyme, obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence of the protein shown in a28);

[0058] a30), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a28) or a29).

[0059] Further, a1) can be a protein whose amino acid sequence is SEQ ID NO. 1.

[0060] Further, a4) can be a protein whose amino acid sequence is SEQ ID NO. 3.

[0061] Further, a7) can be a protein whose amino acid sequence is SEQ ID NO. 7.

[0062] Further, a10) can be a protein whose amino acid sequence is SEQ ID NO. 10.

[0063] Further, a13) can be a protein whose amino acid sequence is SEQ ID NO. 12.

[0064] Further, a16) can be a protein whose amino acid sequence is SEQ ID NO. 15.

[0065] Further, a19) can be a protein whose amino acid sequence is SEQ ID NO. 18.

[0066] Further, a22) can be a protein whose amino acid sequence is SEQ ID NO. 21.

[0067] Further, a25) can be a protein whose amino acid sequence is SEQ ID NO. 24.

[0068] Further, a28) can be a protein whose amino acid sequence is SEQ ID NO. 27.

[0069] Further, in the present invention, the biological material related to the maltose hydrolysis system enzyme includes at least one of the following:

[0070] C1), a nucleic acid molecule encoding the maltose hydrolysis system enzyme;

[0071] C2), an expression cassette and / or construct containing the nucleic acid molecule;

[0072] C3), a DNA fragment and / or recombinant vector containing the nucleic acid molecule and / or the expression cassette and / or the construct.

[0073] Furthermore, in the present invention, the nucleic acid molecule encoding the maltose hydrolysis system enzyme is the coding gene of the maltose hydrolysis system enzyme or the RNA transcribed from the coding gene.

[0074] Furthermore, in the present invention, the coding genes of the maltose hydrolysis system enzyme derived from Klebsiella pneumoniae include the algA gene and the algB gene, and the algA gene includes at least one of the following:

[0075] g1), a nucleic acid molecule whose coding sequence contains SEQ ID NO.2;

[0076] g2), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g1);

[0077] The algB gene includes at least one of the following:

[0078] g3), a nucleic acid molecule whose coding sequence contains SEQ ID NO.4;

[0079] g4), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g3).

[0080] Furthermore, in the present invention, the coding gene of the maltose hydrolysis system enzyme derived from Bacillus safensis includes at least one of the following:

[0081] g5), a nucleic acid molecule whose coding sequence contains SEQ ID NO.8;

[0082] g6), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g5).

[0083] Furthermore, in the present invention, the coding genes of the maltose hydrolysis system enzyme derived from Clostridium acetobutylicum include the glvA gene and the glvC gene, and the glvA gene includes at least one of the following:

[0084] g7), a nucleic acid molecule whose coding sequence contains SEQ ID NO.11;

[0085] g8), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g7).

[0086] Furthermore, in the present invention, the glvC gene comprises at least one of the following:

[0087] g9), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.13;

[0088] g10), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g9).

[0089] Furthermore, in the present invention, the coding gene of the maltose hydrolysis system enzyme derived from Paenibacillus durus comprises at least one of the following:

[0090] g11), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.16;

[0091] g12), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g11).

[0092] Furthermore, in the present invention, the coding gene of the maltose hydrolysis system enzyme derived from Bacillus smithii comprises at least one of the following:

[0093] g13), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.19;

[0094] g14), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g13).

[0095] Furthermore, in the present invention, the coding gene of the maltose hydrolysis system enzyme derived from Fusobacterium mortiferum comprises at least one of the following:

[0096] g15), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.22;

[0097] g16), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g15).

[0098] Furthermore, in the present invention, the coding gene of the maltose hydrolysis system enzyme derived from Lentibacillus salicampi comprises at least one of the following:

[0099] g17), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.25;

[0100] g18), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g17).

[0101] Furthermore, in the present invention, the encoding gene of the maltose hydrolysis system enzyme derived from Bacillus sp. comprises at least one of the following:

[0102] g19), a nucleic acid molecule whose coding sequence comprises SEQ ID NO. 28;

[0103] g20), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g19).

[0104] Furthermore, g1) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 2.

[0105] Furthermore, g3) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 4.

[0106] Furthermore, g5) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 8.

[0107] Furthermore, g7) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 11.

[0108] Furthermore, g9) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 13.

[0109] Furthermore, g11) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 16.

[0110] Furthermore, g13) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 19.

[0111] Furthermore, g15) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 22.

[0112] Furthermore, g17) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 25.

[0113] Furthermore, g19) may be a nucleic acid molecule whose coding sequence is SEQ ID NO. 28.

[0114] Furthermore, the expression cassette and / or construct comprises an enhanced promoter and the encoding gene of the maltose hydrolysis system enzyme. The enhanced promoter is the Ptrc promoter, and the nucleotide sequence of the Ptrc promoter comprises positions 487 to 560 of SEQ ID NO: 5.

[0115] Furthermore, the expression cassette and / or construct may further comprise a terminator.

[0116] Further, the nucleotide sequence of the terminator may comprise positions 3507 to 3593 of SEQ ID NO:5.

[0117] Further, the nucleotide sequence of the Ptrc promoter may be positions 487 to 560 of SEQ ID NO:5.

[0118] Further, the nucleotide sequence of the terminator may be positions 3507 to 3593 of SEQ ID NO:5.

[0119] Further, in the present invention, the expression cassette and / or construct may be at least one of the following:

[0120] b1), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 3593 in SEQ ID NO:5;

[0121] b2), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 1973 in SEQ ID NO:9;

[0122] b3), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 3569 in SEQ ID NO:14;

[0123] b4), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 1976 in SEQ ID NO:17;

[0124] b5), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 2243 in SEQ ID NO:20;

[0125] b6), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 1973 in SEQ ID NO:23;

[0126] b7), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 1973 of SEQ ID NO:26;

[0127] b8), a nucleic acid molecule whose nucleotide sequence comprises positions 487 to 2003 in SEQ ID NO:29;

[0128] b9), a nucleic acid molecule having more than 70% identity with the nucleic acid molecules described in b1) to b8).

[0129] Further, the expression cassette and / or construct may be at least one of the following:

[0130] b1’), a nucleic acid molecule whose nucleotide sequence is positions 487 to 3593 in SEQ ID NO:5;

[0131] b2’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 1973 of SEQ ID NO: 9;

[0132] b3’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 3569 of SEQ ID NO: 14;

[0133] b4’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 1976 of SEQ ID NO: 17;

[0134] b5’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 2243 of SEQ ID NO: 20;

[0135] b6’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 1973 of SEQ ID NO: 23;

[0136] b7’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 1973 of SEQ ID NO: 26;

[0137] b8’), a nucleic acid molecule having a nucleotide sequence from position 487 to position 2003 of SEQ ID NO: 29;

[0138] b9’), a nucleic acid molecule having at least 70% identity with the nucleic acid molecules described in b1’) to b8’).

[0139] Furthermore, in the recombinant microorganism, the DNA fragment may be at least one of the following:

[0140] c1), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 5;

[0141] c2), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 9;

[0142] c3), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 14;

[0143] c4), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 17;

[0144] c5), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 20;

[0145] c6), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 23;

[0146] c7), a DNA molecule having a nucleotide sequence containing SEQ ID NO: 26;

[0147] c8), a DNA molecule whose nucleotide sequence comprises SEQ ID NO: 29;

[0148] c9), a DNA molecule having more than 70% identity with the nucleic acid molecule described in c1) to c8).

[0149] Furthermore, the DNA fragment may be at least one of the following:

[0150] c1’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 5;

[0151] c2’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 9;

[0152] c3’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 14;

[0153] c4’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 17;

[0154] c5’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 20;

[0155] c6’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 23;

[0156] c7’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 26;

[0157] c8’), a DNA molecule whose nucleotide sequence is SEQ ID NO: 29;

[0158] c9’), a DNA molecule having more than 70% identity with the nucleic acid molecule described in c1’) to c8’).

[0159] Any of the above-mentioned biomaterials is also the protected content of the present invention.

[0160] The present invention also provides a method for increasing the threonine production of a recipient microorganism and / or constructing a recombinant microorganism with high threonine production, and the method comprises M1 or M2.

[0161] The M1 includes the step of making the recipient microorganism contain or express the maltose hydrolysis system enzyme, so as to increase the threonine production of the recipient microorganism and / or obtain a recombinant microorganism with high threonine production. The threonine production of the recombinant microorganism is higher than that of the recipient microorganism.

[0162] The M2 includes the step of introducing the nucleic acid molecule, expression cassette and / or construct and / or the DNA fragment and / or recombinant vector into the recipient microorganism, so as to increase the threonine production of the recipient microorganism.

[0163] The present invention also provides recombinant microorganisms, which comprise at least one of the following:

[0164] D1), recombinant microorganisms containing and / or expressing the enzymes of the maltose hydrolysis system described above;

[0165] D2), recombinant microorganisms containing the coding genes of the maltose hydrolysis system enzymes described in D1);

[0166] D3), recombinant microorganisms containing the expression cassette and / or construct of the coding gene described in D2);

[0167] D4), recombinant microorganisms containing the DNA fragment and / or recombinant vector of the coding gene described in D2) and / or the expression cassette and / or construct described in D3);

[0168] D5), recombinant microorganisms obtained by the method described above.

[0169] The present invention also provides a composition for preparing threonine, which contains the above-mentioned recombinant microorganisms and / or recombinant microorganisms obtained by the method described above.

[0170] The active ingredient of the above composition may be the recombinant microorganism or / and the metabolite of the recombinant microorganism or / and the culture of the recombinant microorganism.

[0171] The above culture may be a substance obtained by culturing the recombinant microorganism in a microbial culture medium (i.e., a fermentation product, such as a fermentation broth containing the recombinant microorganism and substances secreted into the liquid culture medium, or a solid fermentation product containing the recombinant microorganism and substances secreted into the solid culture medium).

[0172] In the above text, the metabolite may be a product obtained by removing the recombinant microorganism from the culture. For example, the recombinant microorganism is cultured in a liquid fermentation medium, the fermentation broth (containing the recombinant microorganism and substances secreted into the liquid culture medium) is collected, the recombinant microorganism in the fermentation broth is removed, and the remaining components of the fermentation broth are collected to obtain the metabolite of the recombinant microorganism.

[0173] The active ingredient of the above composition may also contain other biological components or non-biological components, and those skilled in the art can determine other active ingredients of the composition according to the effect of the composition.

[0174] The above composition may be the culture. The above composition may also be a microbial agent.

[0175] The above microbial agent refers to a live microbial preparation prepared by multiplying the target microorganism and using a carrier as an adsorbent to adsorb the fermentation broth or solid fermentation product of the bacterial cells.

[0176] Among the above-mentioned bacterial agents, the dosage form of the bacterial agent can be various dosage forms, including but not limited to liquid agents, emulsions, suspensions, powders, granules, wettable powders, water-dispersible granules, etc.

[0177] As needed, the bacterial agent may further include a carrier. The carrier can be a solid carrier or a liquid carrier.

[0178] The present invention also provides the use of the recombinant microorganism obtained by the above method, the recombinant microorganism and / or the composition in the preparation of threonine.

[0179] The present invention also provides a method for preparing threonine, the method comprising the step of using the recombinant microorganism obtained by the recombinant microorganism, the composition and / or the method as a fermentation strain to prepare threonine.

[0180] In the present invention, the microorganism and / or the recipient microorganism can be at least one of the following:

[0181] E1), a microorganism having the ability to produce threonine;

[0182] E2), bacteria;

[0183] E3), Gram-negative bacteria;

[0184] E4), Enterobacteriaceae bacteria;

[0185] E5), Escherichia bacteria;

[0186] E6), Escherichia coli (Latin scientific name: Escherichia coli).

[0187] Furthermore, Escherichia coli as the recipient bacterium can be Escherichia coli that produces threonine. In some embodiments of the present invention, the Escherichia coli is MG1655 or CGMCC25404.

[0188] Furthermore, Escherichia coli as the recipient bacterium contains the DNA fragment shown in positions 1-486 of SEQ ID NO: 5 and the DNA fragment shown in positions 3594-4144 of SEQ ID NO: 5.

[0189] In the present invention, the protein can be artificially synthesized, or its coding gene can be synthesized first and then expressed biologically. The protein-tag refers to a polypeptide or protein that is expressed in fusion with the target protein by using in vitro DNA recombination technology for the expression, detection, tracing, and / or purification of the target protein in the present invention. The protein-tag can be a Flag protein-tag, His protein-tag, MBP protein-tag, HA protein-tag, myc protein-tag, GST protein-tag, and / or SUMO protein-tag, etc.

[0190] Taking algA as an example, a3) the connection can be that the N-terminus of the tag is connected to the C-terminus of the protein described in a1) or a2) through dehydration condensation to form a peptide bond. Or, a3) the connection can be that the C-terminus of the tag is connected to the N-terminus of the protein described in a1) or a2) through dehydration condensation to form a peptide bond. A linker peptide can also be contained between the protein and the tag.

[0191] In the present invention, the threonine can be L-threonine.

[0192] The beneficial effects achieved by the present invention are as follows:

[0193] The present invention for the first time discloses the application of exogenous and enhanced-expression maltose hydrolysis system enzymes in improving the threonine production of recipient microorganisms.

[0194] The present invention enhances the expression intensity of the algAB gene derived from Klebsiella pneumoniae, promoting the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 33.46 g / L, and the L-threonine production rate increases by 8.88%;

[0195] Enhancing the expression intensity of the glvA gene derived from Bacillus safensis promotes the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 32.55 g / L, and the L-threonine production rate increases by 5.92%;

[0196] Enhancing the expression intensity of the glvAC gene derived from Clostridium acetobutylicum promotes the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 32.19 g / L, and the L-threonine production rate increases by 4.75%;

[0197] Enhancing the expression intensity of the glvA gene derived from Paenibacillus durus promotes the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 to 31.02 g / L, and the increase in the L-threonine production rate is not significant;

[0198] Enhancing the expression intensity of the glvC gene from Bacillus smithii promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 31.98 g / L, and the L-threonine yield increased by 4.07%;

[0199] Enhancing the expression intensity of the glvA gene from Fusobacterium mortiferum promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 30.82 g / L, and the increase in the L-threonine yield was not significant;

[0200] Enhancing the expression intensity of the glvA gene from Lentibacillus salicampi promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 33.82 g / L, and the L-threonine yield increased by 10.06%; enhancing the expression intensity of the glvA gene from Bacillus sp. promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 31.74 g / L, and the L-threonine yield increased by 3.29%.

[0201] Depositing Instructions

[0202] Name of the strain: Escherichia coli

[0203] Latin name: Escherichia coli

[0204] Taxonomic nomenclature: Escherichia coli (Escherichia coli)

[0205] Strain number: YP0158

[0206] Depositing unit: General Microbiology Center of China Committee for Culture Collection of Microorganisms

[0207] Abbreviation of the depositing unit: CGMCC

[0208] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0209] Depositing date: July 25, 2022

[0210] Registration number of the depositing center: CGMCC No. 25404. Detailed implementation manners

[0211] Terms in the present invention:

[0212] Examples of resources that describe many of the terms related to molecular biology used herein can be found in the following references: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0213] Any reference cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.

[0214] For ease of understanding the present disclosure, several terms and abbreviations used herein are defined as follows:

[0215] In the present invention, "identity" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or nucleotide sequence) can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search, the identity value (%) of a pair of amino acid sequences can be calculated.

[0216] Specifically, the consistency of more than 70% may be more than 75%. Specifically, the consistency of more than 75% may be more than 80%. Specifically, the consistency of more than 80% may be more than 85%. Specifically, the consistency of more than 85% may be more than 90%. Specifically, the consistency of more than 90% may be more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98% or more than 99%. More specifically, the consistency of more than 70% may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0217] When used in a list of two or more items, the term "and / or" means that any one of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean at least one or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0218] As commonly understood in the art, the term "promoter" generally refers to DNA that contains an RNA polymerase binding site and / or a transcription start site and aids or promotes the transcription of transcribable DNA. The promoter sequence of prokaryotes is located at the 5' end of the transcription start site (TSS) and covers an area of about 40 bp in length. Structurally, it generally includes a transcription start site (denoted as +1), a -35 region, a -10 region, and an intervening region between the -35 region and the -10 region. The promoter can be synthetically produced, altered, or derived from a known or naturally occurring promoter. The promoter can also include a chimeric promoter that contains a combination of two or more heterologous sequences. Therefore, the promoter of the present invention can include variants of promoter sequences that are compositionally similar but not identical to other promoter sequences provided herein.

[0219] Promoters can be classified according to various criteria related to the expression patterns of associated coding or transcribable sequences or genes (including transgenes) operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters that drive expression in all or most tissues of the recipient are called "constitutive" promoters. Promoters that drive expression at certain periods or stages of development are called "developmental" promoters. An "inducible" promoter is a promoter that initiates transcription in response to environmental stimuli (such as cold, drought, or light) or other stimuli (such as wounding or chemical application). Promoters can also be classified according to their origin, such as heterologous, homologous, chimeric, synthetic, etc.

[0220] The term "operably linked" can refer to a functional linkage between a promoter and transcribable DNA such that the promoter functions to initiate transcription of the transcribable DNA. The term "operably linked" also refers to a functional linkage between other regulatory elements and a gene of interest to regulate the transcription and / or expression of the gene of interest.

[0221] The term "construct" means any recombinant DNA molecule or recombinant RNA molecule. The recombinant DNA molecule can be a plasmid, cosmid, virus, phage, or linear or circular DNA. A construct typically includes one or more expression cassettes.

[0222] As used herein, an "expression cassette" refers to at least transcribable DNA that is operably linked to one or more regulatory elements, typically at least a promoter and a 3' UTR (such as a terminator).

[0223] As used herein, the term "vector" means any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell. Such as a plasmid, cosmid, virus, phage, or linear or circular DNA.

[0224] As used herein, the term "microorganism capable of producing threonine" refers to a microorganism having the ability to utilize external substances (such as a culture medium) to produce and accumulate threonine in vivo, and further may include the ability to secrete threonine into the culture system. Thus, threonine can be collected when the microorganism is cultured in a culture medium.

[0225] As used herein, the term "culture" refers to the collective term for liquid or solid products (all substances in the culture vessel) with a microbial population after artificial inoculation and culture. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites, or other components produced during the culture process. It can also be a mixture containing a certain amount of culture medium, microbial cell metabolites while removing the microbial cells.

[0226] II. Technical Solution Provided by the Present Invention

[0227] The present invention provides an application of maltose hydrolysis system enzymes in increasing the yield of L-threonine prepared by Escherichia coli. For the recipient bacterium Escherichia coli, the maltose hydrolysis system enzymes are enzymes related to maltose hydrolysis, and the malt hydrolysis system enzymes are exogenous. The maltose hydrolysis system enzymes include maltose hydrolysis system enzymes derived from Klebsiella pneumoniae, Bacillus safensis, Clostridium acetobutylicum, Paenibacillus durus, Bacillus smithii, Fusobacterium mortiferum, Lentibacillus salicampi, and Bacillus sp. (Bacillus sp. V3-13).

[0228] The maltose hydrolysis system enzymes are encoded by genes related to maltose hydrolysis-related enzymes. The genes related to the maltose hydrolysis system enzymes include the algAB gene derived from Klebsiella pneumoniae, the glvA gene derived from Bacillus safensis, the glvAC gene derived from Clostridium acetobutylicum, the glvA gene derived from Paenibacillus durus, the glvC gene derived from Bacillus smithii, the glvA gene derived from Fusobacterium mortiferum, the glvA gene derived from Lentibacillus salicampi, and the glvA gene derived from Bacillus sp. (Bacillus sp. V3-13).

[0229] (1) Maltose Hydrolysis System Enzymes Derived from Klebsiella pneumoniae

[0230] The maltose hydrolysis system enzyme derived from Klebsiella pneumoniae consists of an α-glucoside-specific EIICB component of the PTS system derived from Klebsiella pneumoniae and 6-phospho-α-glucosidase. The amino acid sequence of the α-glucoside-specific EIICB component of the PTS system derived from Klebsiella pneumoniae is SEQ ID NO:1. The amino acid sequence of the 6-phospho-α-glucosidase derived from Klebsiella pneumoniae is SEQ ID NO:3.

[0231] The algAB gene derived from Klebsiella pneumoniae includes the algA gene with the coding sequence SEQ ID NO:2 and the algB gene with the coding sequence SEQ ID NO:4. The algA gene expresses the α-glucoside-specific PTS transporter subunit IIBC derived from Klebsiella pneumoniae, and its amino acid sequence is SEQ ID NO:1. The algB gene expresses the 6-phospho-α-glucosidase derived from Klebsiella pneumoniae, and its amino acid sequence is SEQ ID NO:3.

[0232] (2) Maltose hydrolysis system enzyme derived from Bacillus safensis

[0233] The maltose hydrolysis system enzyme derived from Bacillus safensis is 6-phospho-α-glucosidase derived from Bacillus safensis, and the amino acid sequence of the 6-phospho-α-glucosidase derived from Bacillus safensis is SEQ ID NO:7. The coding sequence of the glvA gene derived from Bacillus safensis is SEQ ID NO:8.

[0234] (3) Maltose hydrolysis system enzyme derived from Clostridium acetobutylicum

[0235] The maltose hydrolysis system enzymes derived from Clostridium acetobutylicum include 6-phosphoglucosidase derived from Clostridium acetobutylicum and the PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum. The amino acid sequence of the 6-phosphoglucosidase derived from Clostridium acetobutylicum is SEQ ID NO:10. The amino acid sequence of the PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum is SEQ ID NO:12.

[0236] The glvAC gene derived from Clostridium acetobutylicum includes the glvA gene with the coding sequence SEQ ID NO:11 and the glvC gene with the coding sequence SEQ ID NO:13. The glvA gene expresses 6-phosphoglucosidase derived from Clostridium acetobutylicum, and its amino acid sequence is SEQ ID NO:10. The glvC gene expresses the PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum, and its amino acid sequence is SEQ ID NO:12.

[0237] (4) Maltose hydrolysis system enzymes derived from Paenibacillus durus

[0238] The maltose hydrolysis system enzyme derived from Paenibacillus durus is 6-phosphoglucosidase derived from Paenibacillus durus, and its amino acid sequence is SEQ ID NO:15. The coding sequence of the glvA gene derived from Paenibacillus durus is SEQ ID NO:16.

[0239] (5) Maltose hydrolysis system enzymes derived from Bacillus smithii

[0240] The maltose hydrolysis system enzyme derived from Bacillus smithii is 6-phosphoglucosidase derived from Bacillus smithii, and its amino acid sequence is SEQ ID NO:18. The coding sequence of the glvC gene derived from Bacillus smithii is SEQ ID NO:19.

[0241] (6) Maltose hydrolysis system enzymes derived from Fusobacterium mortiferum

[0242] The maltose hydrolysis system enzyme derived from Fusobacterium mortiferum is a 6-phosphoglucosidase derived from Fusobacterium mortiferum, and its amino acid sequence is SEQ ID NO:21. The coding sequence of the glvA gene derived from Fusobacterium mortiferum is SEQ ID NO:22.

[0243] (7) Maltose hydrolysis system enzyme derived from Lentibacillus salicampi

[0244] The maltose hydrolysis system enzyme derived from Lentibacillus salicampi is a 6-phosphoglucosidase derived from Lentibacillus salicampi, and its amino acid sequence is SEQ ID NO:24. The coding sequence of the glvA gene derived from Lentibacillus salicampi is SEQ ID NO:25.

[0245] (8) Maltose hydrolysis system enzyme derived from Bacillus sp. (Bacillus sp. V3-13)

[0246] The maltose hydrolysis system enzyme derived from Bacillus sp. is a 6-phosphoglucosidase derived from Bacillus sp., and its amino acid sequence is SEQ ID NO:27. The coding sequence of the glvA gene derived from Bacillus sp. is SEQ ID NO:28.

[0247] The upstream homologous arm sequences in each of Examples 1 to 8 are the same; the downstream homologous arm sequences in each of Examples 1 to 8 are the same. That is, the insertion sites of the exogenous maltose hydrolysis system enzyme genes in the starting strains Escherichia coli MG1655 or CGMCC25404 are the same in each example.

[0248] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0249] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0250] The L-threonine-producing bacterium CGMCC 25404 in the following examples is Escherichia coli YP0158 CGMCC No. 25404, hereinafter referred to as CGMCC 25404. Escherichia coli YP0158 CGMCC No. 25404 was deposited in the patent procedure on July 25, 2022, with the deposit number of CGMCC NO. 25404.

[0251] In the quantitative tests in the following examples, unless otherwise specified, three replicates were set, and the results were averaged.

[0252] Example 1. Construction of genetically engineered bacteria YPThr-Kpn-algAB and MG1655-Kpn-algAB

[0253] The algAB gene derived from Klebsiella pneumoniae includes the algA gene with the coding sequence of SEQ ID NO: 2 and the algB gene with the coding sequence of SEQ ID NO: 4. The algA gene expresses the alpha-glucoside-specific PTS transporter subunit IIBC derived from Klebsiella pneumoniae, and its amino acid sequence is SEQ ID NO: 1. The algB gene expresses 6-phospho-alpha-glucosidase derived from Klebsiella pneumoniae, and its amino acid sequence is SEQ ID NO: 3.

[0254] 1. Preparation of DNA fragments for homologous recombination

[0255] The recombinant fragment for the expression of the algAB gene derived from Klebsiella pneumoniae consists of the Kpn-algAB gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Kpn-algAB gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0256] Kpn-algAB-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0257] Kpn-algAB-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAct ccccaagggggcgagggg-3';

[0258] Kpn-algAB-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCTCAGTCAAATACAACG-3';

[0259] Kpn-algAB-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAATGCAGCTCAGGCCAGT-3';

[0260] Kpn-algAB-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACA AATagggttagggtgagggggcg-3';

[0261] Kpn-algAB-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0262] Using the genomic DNA of the engineering strain CGMCC25404 as a template, the upstream homologous arm of the Kpn-algAB gene was amplified with Kpn-algAB-up-R and Kpn-algAB-up-F. The amplification system is shown in Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 5) was obtained. Using the genomic DNA of the engineering strain CGMCC25404 as a template, the downstream homologous arm of the Kpn-algAB gene was amplified with Kpn-algAB-down-R and Kpn-algAB-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 3594 to 4144 of SEQ ID NO: 5) was obtained. To amplify the Kpn-algAB gene, the Kpn-algAB gene was first synthesized, and then the synthesized Kpn-algAB gene was used as a template to amplify the Kpn-algAB gene and the promoter P trc and the terminator rrnB (i.e., positions 487 to 3593 of SEQ ID NO: 5), named P trc -Kpn-algAB-T rrnB . The amplification system was referred to Table 1.

[0263] Table 1, PCR amplification system

[0264] Component Volume (50 μL) DNA template 1 μL Forward primer (10 μmol / L) 1 μL Reverse primer (10 μmol / L) 1 μL dNTP mixture (10 mmol / L) 4 μL 5×Buffer 10 μL HS enzyme (5 U / μL) 0.5 μL <![CDATA[ddH2O]]> 32.5 μL

[0265] Using the upstream primer Kpn-algAB-up-F of the aforementioned upstream homologous arm and the downstream primer Kpn-algAB-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Kpn-algAB-T rrnB -Kpn-algAB-T as the amplification template for overlap PCR to prepare a recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles: denaturation (98°C) for 10 s, annealing ((Tm-3 / 5)°C) for 15 s, extension at 72°C (about 1 kb is extended in 1 min with this enzyme activity); continue to extend at 72°C for 10 min; hold at (4°C). The overlap PCR reaction system is shown in Table 2 to obtain a DNA fragment for homologous recombination. The nucleotide sequence of this DNA fragment for homologous recombination P trc -Kpn-algAB-T rrnB is SEQ ID NO:5. Among them, positions 1 to 486 are the upstream homologous arm (486 bp) of the Kpn-algAB gene, positions 487 to 560 are the Ptrc promoter (74 bp), positions 561 to 3506 are the Kpn-algAB gene (2946 bp), positions 3507 to 3593 are the rrnB terminator region (87 bp), and positions 3594 to 4144 are the downstream homologous arm (551 bp) of the Kpn-algAB gene.

[0266] Table 2, Overlap PCR reaction system

[0267] Component Volume (50 μL) Template 2 μL Forward primer of upstream homologous arm (10 μmol / L) 1 μL Reverse primer of downstream homologous arm (10 μmol / L) 1 μL dNTP mixture (10 mmol / L) 4 μL 5×Buffer 10 μL HS enzyme (5 U / μL) 0.5 μL <![CDATA[ddH2O]]> 31.5 μL

[0268] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Kpn-algAB-T rrnB ) and the total amount does not exceed 10 ng.

[0269] 2. Construction of pGRB-sgRNA plasmid

[0270] pGRB was purchased from Addgene, catalog number #71539. It has a pUC18 backbone, including the promoter J23100, the gRNA-Cas9 binding region sequence, and the terminator sequence, ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.

[0271] The pGRB plasmid was constructed by the method of recombining a DNA fragment containing the target sequence with a linearized vector fragment.

[0272] (1) Design of target sequence and primers

[0273] The CRISPR RGEN Tools was used to design the target sequence (PAM: 5’-NGG-3’), and primers for amplifying the sgRNA fragment were designed for the aforementioned target sequence (forward primer F structure: 5’-linearized vector terminal sequence (34bp)-restriction enzyme site-target sequence (excluding PAM sequence)-linearized vector terminal sequence (34bp)-3’, reverse primer R structure: a primer that is reverse complementary to forward primer R). Specifically, in the primer sequences, lowercase letters represent the target sequence:

[0274] gRNA-F: 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcccccttggggagagggttGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3';

[0275] gRNA-R: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACaaccctctccccaagggggcACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'.

[0276] (2) Preparation of DNA fragment containing the target sequence

[0277] The DNA fragment containing the target sequence was prepared by annealing single-stranded DNA. Reaction conditions: pre-denaturation at 95°C for 5 min; annealing at 30 - 50°C for 1 min. Annealing reaction system: gRNA-F (10 μmol / L) 10 μL, gRNA-R (10 μmol / L) 10 μL.

[0278] (3) Preparation of linear vector

[0279] The vector was linearized by reverse PCR amplification. The amplification primers were as follows: pGRB-F: 5'-ACTAGTATTATACCTAGGACTGAGC-3'; pGRB-R: 5'-GTTTTAGAGCTAGAAATAGCAAGTT-3'. The PCR reaction system was referred to Table 1. PCR reaction program (Takara PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles were carried out: denaturation (98°C) for 10 s, annealing ((Tm - 3 / 5)°C) for 15 s, extension at 72°C (this enzyme activity extends about 1 kb per 1 min); continue to extend at 72°C for 10 min; hold (4°C).

[0280] (4) Recombination reaction

[0281] The recombination system is 5×CE II Buffer: 4 μL, linearized cloning vector: 1 μL, DNA fragment containing the target sequence: 1 μL, ExnaseR IⅡ: 2 μL, ddH2O: 12 μL, and the reaction system volume is 20 μL.

[0282] All the recombination enzymes used are enzymes of the IIOne Step Cloning Kit series, and the recombination conditions are: 37 °C, 30 min.

[0283] (5) Transformation of plasmid

[0284] Take 10 μL of the reaction solution in "(4) Recombination reaction", add it to 100 μL of DH5α chemically competent cells, gently mix and incubate on ice for 20 min, heat shock at 42 °C for 45 - 90 s, immediately incubate on ice for 2 - 3 min, add 900 μL of SOC, and resuscitate at 37 °C for 1 h. Centrifuge at 8000 rpm for 2 min, discard part of the supernatant, leave about 200 μL, resuspend the cell pellet and spread it on a plate containing 100 mg / L ampicillin. Invert the plate and incubate overnight at 37 °C. After single colonies grow on the plate, identify them by colony PCR and select positive recombinants.

[0285] (6) Clone identification

[0286] Inoculate the PCR-positive colonies into LB medium containing 100 mg / L ampicillin, incubate overnight for bacteria preservation, extract the plasmid, and identify it by enzyme digestion.

[0287] The plasmid identified as correctly inserted is named pGRB-sgRNA. This pGRB-sgRNA can transcribe RNA with the target nucleotide sequence of SEQ ID NO:6, thus forming a complex with the Cas9 protein, and recognizing the target site of the target gene through base pairing to achieve double-strand break of the target DNA.

[0288] 3. Transformation of plasmid and recombinant DNA fragment

[0289] pREDCas9 is purchased from Addgene, catalog number #71541, carrying the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, with spectinomycin resistance (working concentration: 100 mg / L), and cultured at 32 °C.

[0290] (1) Transformation of pREDCas9

[0291] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing gentamycin and cultured overnight at 32°C. Single colonies growing on the resistant plate were subjected to colony PCR using identification primers to screen for positive recombinants.

[0292] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0293] The positive recombinant obtained in "(1) Transformation of pREDCas9" was cultured at 32°C until the OD 600nm reached 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD 600nm reached 0.6 to 0.7 for the preparation of electrocompetent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of electrocompetent cells and the preparation process followed the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0294] (3) Transformation of pGRB and recombinant DNA fragments

[0295] pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment shown in SEQ ID NO:5) were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9 obtained in "(2) Preparation of electrocompetent cells of the target strain containing pREDCas9". The cells resuscitated and cultured after electrotransformation were spread on an LB plate containing ampicillin and gentamycin and cultured overnight at 32°C. Colony PCR verification was performed using the identification primers Kpn-algAB-up-F and Kpn-algAB-R1, Kpn-algAB-F2 and Kpn-algAB-down-R respectively to screen for positive recombinants and preserve the bacteria.

[0296] Kpn-algAB-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0297] Kpn-algAB-R1: 5'-CGTAAAATTTCAGCGACCGC-3';

[0298] Kpn-algAB-F2: 5'-GGGATTCAGGTCATCGTCGG-3';

[0299] Kpn-algAB-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0300] (4) Elimination of plasmids

[0301] ①Elimination of pGRB

[0302] The positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" were cultured overnight in LB medium containing 0.2% arabinose, appropriately diluted and then spread on LB plates containing gentamycin resistance, and cultured overnight at 32°C. Single colonies were picked and streaked one by one onto LB plates containing ampicillin and gentamycin resistance. Single colonies that did not grow on the ampicillin plate but grew on the gentamycin resistance plate were preserved to obtain positive recombinants.

[0303] ②Elimination of pREDCas9 plasmid

[0304] The positive recombinants obtained from "①Elimination of pGRB" were transferred to LB liquid medium without resistance and cultured overnight at 42°C, appropriately diluted and then spread on LB plates without resistance, and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing gentamycin resistance and without resistance. Single colonies that did not grow on the gentamycin resistance plate but grew on the plate without resistance were preserved to obtain positive single colonies.

[0305] The positive colonies obtained above were sent for sequencing. The strain with correct sequencing results was named recombinant strain YPThr-Kpn-algAB. Recombinant strain YPThr-Kpn-algAB was obtained by inserting the DNA fragment shown by nucleotides 487 to 3593 in SEQ ID NO:5 into the intergenic region of the CGMCC25404 genome that does not encode any genes, that is, by inserting the DNA fragment shown by nucleotides 487 to 3593 in SEQ ID NO:5 between the DNA fragment shown by nucleotides 1 - 486 and the DNA fragment shown by nucleotides 3594 - 4144 in SEQ ID NO:5 of the starting strain while keeping other nucleotide sequences unchanged to obtain a recombinant Escherichia coli.

[0306] According to the aforementioned method, using the wild-type strain MG1655 as the starting strain, recombinant strain MG1655-Kpn-algAB was obtained. Recombinant strain MG1655-Kpn-algAB was obtained by inserting the DNA fragment shown by nucleotides 487 to 3593 in SEQ ID NO:5 into the intergenic region of the MG1655 genome that does not encode any genes, that is, by inserting the DNA fragment shown by nucleotides 487 to 3593 in SEQ ID NO:5 between the DNA fragment shown by nucleotides 1 - 486 and the DNA fragment shown by nucleotides 3594 - 4144 in SEQ ID NO:5 of the starting strain while keeping other nucleotide sequences unchanged to obtain a recombinant Escherichia coli.

[0307] Compared with the starting strain, both the recombinant strain YPThr-Kpn-algAB and the recombinant strain MG1655-Kpn-algAB contain the algA gene derived from Klebsiella pneumoniae with the coding sequence of SEQ ID NO:2 and the algB gene derived from Klebsiella pneumoniae with the coding sequence of SEQ ID NO:4, and can express the PTS system α-glucoside-specific EIICB component and 6-phosphoglucosidase derived from Klebsiella pneumoniae with the amino acid sequences shown in SEQ ID NO:1 and SEQ ID NO:3 respectively.

[0308] Example 2. Construction of genetic engineering strains YPThr-Bsa-glvA and MG1655-Bsa-glvA

[0309] The coding sequence of the glvA gene derived from Bacillus safensis is SEQ ID NO:8. The amino acid sequence of 6-phospho-alpha-glucosidase derived from Bacillus safensis expressed by it is SEQ ID NO:7.

[0310] 1. Preparation of DNA fragments for homologous recombination

[0311] The recombinant fragment for the expression of the glvA gene derived from Bacillus safensis consists of the Bsa-glvA gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Bsa-glvA gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0312] Bsa-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0313] Bsa-glvA-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0314] Bsa-glvA-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCAtgaaaaaatttaatattac-3';

[0315] Bsa-glvA-R: 5'-AAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGttaagttaactctggccaaaatg-3';

[0316] Bsa-glvA-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0317] Bsa-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0318] Using the genomic DNA of engineering strain CGMCC25404 as a template, the upstream homologous arm of the Bsa-glvA gene was amplified with Bsa-glvA-up-R and Bsa-glvA-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO:9) was obtained. Using the genomic DNA of engineering strain CGMCC25404 as a template, the downstream homologous arm of the Bsa-glvA gene was amplified with Bsa-glvA-down-R and Bsa-glvA-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 1974 to 2524 of SEQ ID NO:9) was obtained. To amplify the Bsa-glvA gene, the Bsa-glvA gene was first synthesized, and then the synthesized Bsa-glvA gene was used as a template to amplify the Bsa-glvA gene and promoter P trc and terminator rrnB (i.e., positions 487 to 1973 of SEQ ID NO:9), named P trc -Bsa-glvA-T rrnB . The amplification system was referred to Table 1.

[0319] Using the upstream primer Bsa-glvA-up-F of the aforementioned upstream homologous arm and the downstream primer Bsa-glvA-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Bsa-glvA-T rrnBOverlap PCR was performed with the template for amplification to prepare recombinant fragments. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles were carried out: denaturation (98°C) for 10 s, annealing ((Tm - 3 / 5)°C) for 15 s, extension at 72°C (about 1 kb can be extended in 1 min with this enzyme activity); continue to extend at 72°C for 10 min; maintain at (4°C). The overlap PCR reaction system was referred to Table 2 to obtain the DNA fragment for homologous recombination, and this DNA fragment for homologous recombination P trc -Bsa-glvA-T rrnB has the nucleotide sequence of SEQ ID NO:9, in which the 1st to 486th positions are the upstream homologous arm of the Bsa-glvA gene (486 bp), the 487th to 560th positions are the Ptrc promoter (74 bp), the 561st to 1886th positions are the Bsa-glvA gene (1326 bp), the 1887th to 1973rd positions are the rrnB terminator region (87 bp), and the 1974th to 2524th positions are the downstream homologous arm of the Bsa-glvA gene (551 bp).

[0320] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Bsa-glvA-T rrnB ), and the total amount does not exceed 10 ng.

[0321] 2. Transformation of plasmid and recombinant DNA fragment

[0322] pREDCas9 was purchased from Addgene, catalog number #71541, carrying the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, with chlortetracycline resistance (working concentration: 100 mg / L), and cultured at 32°C.

[0323] (1) Transformation of pREDCas9

[0324] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by the electrotransformation method. After the cells were resuscitated and cultured, they were spread on an LB plate containing chlortetracycline and cultured overnight at 32°C. The single colonies growing on the resistant plate were subjected to colony PCR with the identification primers to screen for positive recombinants.

[0325] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0326] The positive recombinants in “(1) Transformation of pREDCas9” were cultured at 32°C until the OD 600nm was 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD600nm When it is 0.6 to 0.7, competent cell preparation is carried out. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for competent cell preparation and the preparation process refer to the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0327] (3) Transformation of pGRB and recombinant DNA fragments

[0328] Electrotransform pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment with the nucleotide sequence of SEQ ID NO:9) simultaneously into the electrocompetent cells containing pREDCas9 obtained from “(2) Preparation of electrocompetent cells of the target strain containing pREDCas9”. Spread the cells after electrotransformation and resuscitation culture on an LB plate containing ampicillin and chlortetracycline, and culture overnight at 32°C. Use the identification primers Bsa-glvA-up-F / Bsa-glvA-R1 and Bsa-glvA-F2 / Bsa-glvA-down-R for colony PCR verification to screen positive recombinants and preserve the bacteria.

[0329] Bsa-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0330] Bsa-glvA-R1: 5'-TCTACGCCAACTTGCTGCTC-3';

[0331] Bsa-glvA-F2: 5'-GTGCGATTACTGGCAAGCAC-3';

[0332] Bsa-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0333] (4) Elimination of plasmids

[0334] ① Elimination of pGRB

[0335] Place the positive recombinants obtained from “(3) Transformation of pGRB and recombinant DNA fragments” in an LB medium containing 0.2% arabinose and culture overnight. After appropriate dilution, spread them on an LB plate with chlortetracycline resistance and culture overnight at 32°C. Pick single colonies and streak them one by one onto LB plates containing ampicillin and chlortetracycline resistance. Select the single colonies that do not grow on the ampicillin plate but grow on the chlortetracycline resistance plate to preserve the bacteria to obtain positive recombinants.

[0336] ② Elimination of pREDCas9 plasmid

[0337] The positive recombinants obtained from "①elimination of pGRB" were transferred to a non-resistant LB liquid medium and cultured overnight at 42°C. After appropriate dilution, they were spread on a non-resistant LB plate and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing chlortetracycline resistance and non-resistance respectively. Single colonies that did not grow on the chlortetracycline-resistant plate but grew on the non-resistant plate were preserved to obtain positive single colonies.

[0338] The obtained positive colonies were sent for sequencing. The strains with correct sequencing results were named recombinant strain YPThr-Bsa-glvA. Recombinant strain YPThr-Bsa-glvA was obtained by inserting the DNA fragment shown by nucleotides 487 to 1973 in SEQ ID NO:9 into the intergenic region of the CGMCC25404 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0339] According to the aforementioned method, using the wild-type strain MG1655 as the starting strain, recombinant strain MG1655-Bsa-glvA was obtained. Recombinant strain MG1655-Bsa-glvA was obtained by inserting the DNA fragment shown by nucleotides 487 to 1973 in SEQ ID NO:9 into the intergenic region of the MG1655 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0340] Compared with the starting strains, both recombinant strain YPThr-Bsa-glvA and recombinant strain MG1655-Bsa-glvA contain the glvA gene derived from Bacillus safensis with the coding sequence of SEQ ID NO:8 and can express 6-phosphoglucosidase derived from Bacillus safensis with the amino acid sequence of SEQ ID NO:7.

[0341] Example 3: Construction of genetically engineered strains YPThr-Cac-glvAC and MG1655-Cac-glvAC

[0342] The glvAC gene derived from Clostridium acetobutylicum includes the glvA gene with the coding sequence SEQ ID NO:11 and the glvC gene with the coding sequence SEQ ID NO:13. The glvA gene expresses 6-phospho-alpha-glucosidase derived from Clostridium acetobutylicum, and its amino acid sequence is SEQ ID NO:10. The glvC gene expresses the alpha-glucoside-specific PTS transporter subunit IIBC, and its amino acid sequence is SEQ ID NO:12.

[0343] 1. Preparation of DNA fragments for homologous recombination

[0344] The recombinant fragment for the expression of the glvAC gene derived from Clostridium acetobutylicum consists of the Cac-glvAC gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Cac-glvAC gene as templates, the upstream and downstream homologous arm primers were designed as follows:

[0345] Cac-glvAC-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0346] Cac-glvAC-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0347] Cac-glvAC-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCAtgaaaaaattttcagttgt-3';

[0348] Cac-glvAC-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGttatgactttataagtaatc-3';

[0349] Cac-glvAC-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0350] Cac-glvAC-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0351] Using the genomic DNA of the engineering strain CGMCC25404 as a template, the upstream homologous arm of the Cac-glvAC gene was amplified with Cac-glvAC-up-R and Cac-glvAC-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 14) was obtained. Using the genomic DNA of the engineering strain CGMCC25404 as a template, the downstream homologous arm of the Cac-glvAC gene was amplified with Cac-glvAC-down-R and Cac-glvAC-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 3570 to 4120 of SEQ ID NO: 14) was obtained. To amplify the Cac-glvAC gene, the Cac-glvAC gene was first synthesized, and then the synthesized Cac-glvAC gene was used as a template to amplify the Cac-glvAC gene and promoter P trc and terminator rrnB (i.e., positions 487 to 3569 of SEQ ID NO: 14), named P trc -Cac-glvAC-T rrnB . The amplification system was referred to Table 1.

[0352] Using the upstream primer Cac-glvAC-up-F of the aforementioned upstream homologous arm and the downstream primer Cac-glvAC-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Cac-glvAC-T rrnB were used as amplification templates for overlap PCR to prepare a recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95 °C) for 5 min; then 30 cycles were carried out: denaturation (98 °C) for 10 s, annealing ((Tm - 3 / 5) °C) for 15 s, extension at 72 °C (about 1 kb was extended in 1 min with this enzyme activity); continue to extend at 72 °C for 10 min; maintain (4 °C). The overlap PCR reaction system was referred to Table 2, and a DNA fragment for homologous recombination was obtained. This DNA fragment for homologous recombination P trc -Cac-glvAC-T rrnBThe nucleotide sequence is SEQ ID NO:14, where positions 1 to 486 are the upstream homologous arm of the Cac-glvAC gene (486 bp), positions 487 to 560 are the Ptrc promoter (74 bp), positions 561 to 3482 are the Cac-glvAC gene (2922 bp), positions 3483 to 3569 are the rrnB terminator region (87 bp), and positions 3570 to 4120 are the downstream homologous arm of the Cac-glvAC gene (551 bp).

[0353] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Cac-glvAC-T rrnB ), and the total amount does not exceed 10 ng.

[0354] 2. Transformation of plasmids and recombinant DNA fragments

[0355] pREDCas9 was purchased from Addgene, catalog number #71541, carrying an elimination system for the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system, with resistance to spectinomycin (working concentration: 100 mg / L), and cultured at 32 °C.

[0356] (1) Transformation of pREDCas9

[0357] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing spectinomycin and cultured overnight at 32 °C. Single colonies growing on the resistance plate were subjected to colony PCR with identification primers to screen for positive recombinants.

[0358] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0359] The positive recombinants in “(1) Transformation of pREDCas9” were cultured at 32 °C until the OD 600nm reached 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD 600nm reached 0.6 to 0.7 for the preparation of competent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of competent cells and the preparation process followed the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0360] (3) Transformation of pGRB and recombinant DNA fragments

[0361] Co-transform pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment with the nucleotide sequence of SEQ ID NO: 14) into the electrocompetent cells containing pREDCas9 obtained from "(2) Preparation of electrocompetent cells for transformation of the target strain containing pREDCas9" by electroporation. Spread the bacteria after resuscitation culture after electroporation on an LB plate containing ampicillin and gentamycin, and culture overnight at 32 °C. Use the identification primers Cac-glvAC-up-F / Cac-glvAC-R1 and Cac-glvAC-F2 / Cac-glvAC-down-R for colony PCR verification, screen for positive recombinants and preserve the bacteria.

[0362] Cac-glvAC-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0363] Ca-glvAC-R1: 5'-AGAGCTTCTAGACAGGCACG-3';

[0364] Cac-glvAC-F2: 5'-CTTTGGAGCTGCCATGTTTG-3';

[0365] Cac-glvAC-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0366] (4) Elimination of plasmids

[0367] ① Elimination of pGRB

[0368] Place the positive recombinants obtained from "(3) Transformation of pGRB and the recombinant DNA fragment" in an LB medium containing 0.2% arabinose and culture overnight. Dilute appropriately and spread on an LB plate with gentamycin resistance, and culture overnight at 32 °C. Pick single colonies and streak them one by one onto LB plates with ampicillin and gentamycin resistance respectively. Select the single colonies that do not grow on the ampicillin plate but grow on the gentamycin resistance plate to preserve the bacteria, and obtain positive recombinants.

[0369] ② Elimination of the pREDCas9 plasmid

[0370] Transfer the positive recombinants obtained from "① Elimination of pGRB" to a non-resistant LB liquid medium and culture overnight at 42 °C. Dilute appropriately and spread on a non-resistant LB plate, and culture overnight at 37 °C. Pick single colonies and streak them one by one onto LB plates with gentamycin resistance and non-resistance respectively. Select the single colonies that do not grow on the gentamycin resistance plate but grow on the non-resistant plate to preserve the bacteria, and obtain positive single colonies.

[0371] The obtained positive colonies were sent for sequencing, and the strains with correct sequencing results were named recombinant strain YPThr-Cac-glvAC. The recombinant strain YPThr-Cac-glvAC was obtained by inserting the DNA fragment shown by the nucleotides at positions 487 to 3569 in SEQ ID NO:14 into the spacer region of the CGMCC25404 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0372] According to the aforementioned method, using the wild-type strain MG1655 as the starting strain, the recombinant strain MG1655-Cac-glvAC was obtained. The recombinant strain MG1655-Cac-glvAC was obtained by inserting the DNA fragment shown by the nucleotides at positions 487 to 3569 in SEQ ID NO:14 into the spacer region of the MG1655 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0373] Compared with the starting strains, both the recombinant strain YPThr-Cac-glvAC and the recombinant strain MG1655-Cac-glvAC contain the glvA gene from Clostridium acetobutylicum with the coding sequence of SEQ ID NO:11 and the glvC gene from Clostridium acetobutylicum with the coding sequence of SEQ ID NO:13, and can express the 6-phosphoglucosidase from Clostridium acetobutylicum with the amino acid sequence shown by SEQ ID NO:10 and the PTS system α-glucoside-specific EIICB component with the amino acid sequence shown by SEQ ID NO:12.

[0374] Example 4: Construction of genetic engineering strains YPThr-Pdu-glvA and MG1655-Pdu-glvA

[0375] 1. Preparation of DNA fragments for homologous recombination

[0376] The coding sequence of the glvA gene from Paenibacillus durus is SEQ ID NO:16, and the amino acid sequence of the 6-phosphoglucosidase from Paenibacillus durus it expresses is SEQ ID NO:15.

[0377] The recombinant fragment for the expression of the glvA gene from Paenibacillus durus consists of the Pdu-glvA gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Pdu-glvA gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0378] Pdu-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0379] Pdu-glvA-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0380] Pdu-glvA-F: 5'-ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCAtgagtaaaaagtttactgt-3';

[0381] Pdu-glvA-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGttatttcaattctggccagaag-3';

[0382] Pdu-glvA-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0383] Pdu-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0384] Using the genomic DNA of the engineered strain CGMCC25404 as a template, the upstream homologous arm of the Pdu-glvA gene was amplified with Pdu-glvA-up-R and Pdu-glvA-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 17) was obtained. Using the genomic DNA of the engineered strain CGMCC25404 as a template, the downstream homologous arm of the Pdu-glvA gene was amplified with Pdu-glvA-down-R and Pdu-glvA-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 1977 to 2527 of SEQ ID NO: 17) was obtained. To amplify the Pdu-glvA gene, the Pdu-glvA gene was first synthesized, and then the synthesized Pdu-glvA gene was used as a template to amplify the Pdu-glvA gene and promoter P with primers Pdu-glvA-F and Pdu-glvA-R trcand the terminator rrnB (i.e., positions 487 to 1976 of SEQ ID NO: 17), named P trc -Pdu-glvA-T rrnB 。The amplification system refers to Table 1.

[0385] Using the upstream primer Pdu-glvA-up-F of the upstream homologous arm and the downstream primer Pdu-glvA-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Pdu-glvA-T rrnB -Pdu-glvA-T trc -Pdu-glvA-T rrnB as the amplification template for overlap PCR to prepare the recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles: denaturation (98°C) for 10 s, annealing ((Tm - 3 / 5)°C) for 15 s, extension at 72°C (about 1 kb is extended in 1 min with this enzyme activity); continue to extend at 72°C for 10 min; hold at (4°C). The overlap PCR reaction system refers to Table 2 to obtain the DNA fragment for homologous recombination. The nucleotide sequence of the DNA fragment P

[0386] Note: The template is composed of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Pdu-glvA-T rrnB ), and the total amount does not exceed 10 ng.

[0387] 2. Transformation of plasmids and recombinant DNA fragments

[0388] pREDCas9 was purchased from Addgene, catalog number #71541, carrying the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system, with chloramphenicol resistance (working concentration: 100 mg / L), cultured at 32°C.

[0389] (1) Transformation of pREDCas9

[0390] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing gentamycin and cultured overnight at 32°C. Single colonies growing on the resistant plate were subjected to colony PCR using identification primers to screen for positive recombinants.

[0391] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0392] The positive recombinant obtained in "(1) Transformation of pREDCas9" was cultured at 32°C until the OD 600nm reached 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD 600nm reached 0.6 to 0.7 for the preparation of electrocompetent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of electrocompetent cells and the preparation process followed the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0393] (3) Transformation of pGRB and the recombinant DNA fragment

[0394] pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment with the nucleotide sequence of SEQ ID NO:17) were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9 obtained in "(2) Preparation of electrocompetent cells of the target strain containing pREDCas9". The cells after electrotransformation and resuscitation were spread on an LB plate containing ampicillin and gentamycin and cultured overnight at 32°C. Colony PCR verification was carried out using the identification primers Pdu-glvA-up-F / Pdu-glvA-R1 and Pdu-glvA-F2 / Pdu-glvA-down-R to screen for positive recombinants and preserve the bacteria.

[0395] Pdu-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0396] Pdu-glvA-R1: 5'-CTGCAGAAACTTGCTGCTCC-3';

[0397] Pdu-glvA-F2: 5'-ATATCATAGCCGGAGCATGC-3';

[0398] Pdu-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0399] (4) Elimination of plasmids

[0400] ① Elimination of pGRB

[0401] The positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" were cultured overnight in LB medium containing 0.2% arabinose, appropriately diluted and then spread on LB plates containing streptomycin resistance, and cultured overnight at 32°C. Single colonies were picked and streaked one by one onto LB plates containing ampicillin and streptomycin resistance. Single colonies that did not grow on the ampicillin plate but grew on the streptomycin resistance plate were preserved to obtain positive recombinants.

[0402] ② Elimination of pREDCas9 plasmid

[0403] The positive recombinants obtained from "① Elimination of pGRB" were transferred to LB liquid medium without resistance and cultured overnight at 42°C, appropriately diluted and then spread on LB plates without resistance, and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing streptomycin resistance and without resistance. Single colonies that did not grow on the streptomycin resistance plate but grew on the plate without resistance were preserved to obtain positive single colonies.

[0404] The positive colonies obtained above were sent for sequencing, and the strains with correct sequencing results were named recombinant strain YPThr-Pdu-glvA. Recombinant strain YPThr-Pdu-glvA is a recombinant Escherichia coli obtained by inserting the DNA fragment shown by nucleotides 487 to 1976 in SEQ ID NO:17 into the intergenic region of the CGMCC25404 genome that does not encode any genes, and keeping other nucleotide sequences unchanged.

[0405] According to the foregoing method, using the wild-type strain MG1655 as the starting strain, recombinant strain MG1655-Pdu-glvA was obtained. Recombinant strain MG1655-Pdu-glvA is a recombinant Escherichia coli obtained by inserting the DNA fragment shown by nucleotides 487 to 1976 in SEQ ID NO:17 into the intergenic region of the MG1655 genome that does not encode any genes, and keeping other nucleotide sequences unchanged.

[0406] Compared with the starting strains, both recombinant strain YPThr-Pdu-glvA and recombinant strain MG1655-Pdu-glvA contain the glvA gene from Paenibacillus durus with the coding sequence of SEQ ID NO:16 and can express 6-phosphoglucosidase from Paenibacillus durus with the amino acid sequence of SEQ ID NO:15.

[0407] Example 5: Construction of genetic engineering bacteria YPThr-Bsm-glvC and MG1655-Bsm-glvC

[0408] 1. Preparation of DNA fragments for homologous recombination

[0409] The coding sequence of the glvC gene (Bsm-glvC gene) derived from Bacillus smithii 7_3_47FAA is SEQ ID NO: 19, which can encode a 6-phosphoglucosidase derived from Bacillus smithii 7_3_47FAA with the amino acid sequence of SEQ ID NO: 18.

[0410] The recombinant fragment for the expression of the glvC gene derived from Bacillus smithii 7_3_47FAA consists of the Bsm-glvC gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Bsm-glvC gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0411] Bsm-glvC-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0412] Bsm-glvC-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0413] Bsm-glvC-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGATGCAAAAAATCCAGCG-3';

[0414] Bsm-glvC-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTCATCCAGTTTTGCTGCTTTC-3';

[0415] Bsm-glvC-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0416] Bsm-glvC-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0417] Using the genomic DNA of the engineering strain CGMCC 25404 as a template, the upstream homologous arm of the Bsm-glvA gene was amplified with Bsm-glvC-up-R and Bsm-glvC-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 20) was obtained. Using the genomic DNA of the engineering strain CGMCC 25404 as a template, the downstream homologous arm of the Bsm-glvC gene was amplified with Bsm-glvC-down-R and Bsm-glvC-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 2244 to 2794 of SEQ ID NO: 20) was obtained. To amplify the Bsm-glvC gene, the Bsm-glvC gene was first synthesized, and then the synthesized Bsm-glvC gene was used as a template to amplify the Bsm-glvC gene and the promoter P trc and the terminator rrnB (i.e., positions 487 to 2243 of SEQ ID NO: 20), named P trc -Bsm-glvC-T rrnB . The amplification system was referred to Table 1.

[0418] Using the upstream primer Bsm-glvC-up-F of the aforementioned upstream homologous arm and the downstream primer Bsm-glvC-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Bsm-glvC-T rrnB were used as amplification templates for overlap PCR to prepare a recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95 °C) for 5 min; then 30 cycles were carried out: denaturation (98 °C) for 10 s, annealing ((Tm - 3 / 5) °C) for 15 s, extension at 72 °C (about 1 kb was extended in 1 min with this enzyme activity); continued extension at 72 °C for 10 min; maintained at (4 °C). The overlap PCR reaction system was referred to Table 2, and a DNA fragment for homologous recombination was obtained. The nucleotide sequence of the DNA fragment P trc -Bsm-glvC-T rrnB is SEQ ID NO: 20, in which positions 1 to 486 are the upstream homologous arm of the Bsm-glvC gene (486 bp), positions 487 to 560 are the Ptrc promoter (74 bp), positions 561 to 2156 are the Bsm-glvC gene (1596 bp), positions 2157 to 2243 are the rrnB terminator region (87 bp), and positions 2244 to 2794 are the downstream homologous arm of the Bsm-glvC gene (551 bp).

[0419] Note: The template consists of equimolar amplification fragments of upstream and downstream homologous arms and the target gene (P trc -Bsm-glvC-T rrnB ), and the total amount does not exceed 10 ng.

[0420] 2. Transformation of plasmid and recombinant DNA fragment

[0421] pREDCas9 was purchased from Addgene, catalog number #71541, carrying an elimination system of gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system, with resistance to chlortetracycline (working concentration: 100 mg / L), and cultured at 32 °C.

[0422] (1) Transformation of pREDCas9

[0423] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing chlortetracycline and cultured overnight at 32 °C. Single colonies growing on the resistant plate were subjected to colony PCR with identification primers to screen for positive recombinants.

[0424] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0425] The positive recombinants in “(1) Transformation of pREDCas9” were cultured at 32 °C until the OD 600nm reached 0.1 to 0.2, then 0.1 M IPTG was added (to make the final concentration 0.1 mM), and the culture was continued until the OD 600nm reached 0.6 to 0.7 for the preparation of electrocompetent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of electrocompetent cells and the preparation process followed the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0426] (3) Transformation of pGRB and recombinant DNA fragment

[0427] pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment shown in SEQ ID NO:20) were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9 obtained in “(2) Preparation of electrocompetent cells of the target strain containing pREDCas9”. The cells resuscitated and cultured after electroporation were spread on an LB plate containing ampicillin and chlortetracycline and cultured overnight at 32 °C. Colony PCR verification was carried out using the identification primers Bsm-glvC-up-F / Bsm-glvC-R1 and Bsm-glvC-F2 / Bsm-glvC-down-R to screen for positive recombinants and preserve the bacteria.

[0428] Bsm-glvC-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0429] Bsm-glvC-R1: 5'-TTTTTCGCGTCCTGGAGTCG-3';

[0430] Bsm-glvC-F2: 5'-GAATACTTGTAGGGTTGGCG-3';

[0431] Bsm-glvC-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0432] (4) Elimination of plasmids

[0433] ① Elimination of pGRB

[0434] The positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" were cultured overnight in LB medium containing 0.2% arabinose, appropriately diluted and then spread on an LB plate with streptomycin resistance, and cultured overnight at 32 °C. Single colonies were picked and streaked one by one onto an LB plate with ampicillin and streptomycin resistance. The single colonies that did not grow on the ampicillin plate but grew on the streptomycin resistance plate were preserved to obtain positive recombinants.

[0435] ② Elimination of pREDCas9 plasmid

[0436] The positive recombinants obtained from "① Elimination of pGRB" were transferred to a non-resistant LB liquid medium and cultured overnight at 42 °C, appropriately diluted and then spread on a non-resistant LB plate, and cultured overnight at 37 °C. Single colonies were picked and streaked one by one onto an LB plate with streptomycin resistance and a non-resistant LB plate. The single colonies that did not grow on the streptomycin resistance plate but grew on the non-resistant plate were preserved to obtain positive single colonies.

[0437] The positive colonies obtained above were sent for sequencing. The strains with correct sequencing results were named recombinant strain YPThr-Bsm-glvC. The recombinant strain YPThr-Bsm-glvC was obtained by inserting the DNA fragment shown by nucleotides at positions 487 to 2243 in SEQ ID NO: 20 into the intergenic region of the CGMCC25404 genome that does not encode any genes, and keeping other nucleotide sequences unchanged to obtain recombinant Escherichia coli.

[0438] According to the foregoing method, using the wild-type strain MG1655 as the starting strain, the recombinant strain MG1655-Bsm-glvC was obtained. The recombinant strain MG1655-Bsm-glvC was obtained by inserting the DNA fragment shown by nucleotides 487 to 2243 in SEQ ID NO:20 into the spacer region of the MG1655 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0439] Compared with the starting strain, both the recombinant strain YPThr-Bsm-glvC and the recombinant strain MG1655-Bsm-glvC contain the glvC gene derived from Bacillus smithii 7_3_47FAA with the coding sequence of SEQ ID NO:19, and can express the 6-phosphoglucosidase derived from Bacillus smithii 7_3_47FAA with the amino acid sequence of SEQ ID NO:18.

[0440] Example 6. Construction of genetically engineered strains YPThr-Fmo-glvA and MG1655-Fmo-glvA

[0441] The coding sequence of the glvA gene (Fmo-glvA gene) derived from Fusobacterium mortiferum is SEQ ID NO:22, and it can encode the 6-phosphoglucosidase derived from Fusobacterium mortiferum with the amino acid sequence of SEQ ID NO:21.

[0442] 1. Preparation of DNA fragments for homologous recombination

[0443] The recombinant fragment for the expression of the glvA gene derived from Fusobacterium mortiferum consists of the Fmo-glvA gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Fmo-glvA gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0444] Fmo-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0445] Fmo-glvA-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0446] Fmo-glvA-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAACAATTTTCTATTTT-3';

[0447] Fmo-glvA-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTATTTCAAAACTGGCCAAT-3';

[0448] Fmo-glvA-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0449] Fmo-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0450] Using the genomic DNA of the engineering strain CGMCC25404 as a template, the upstream homologous arm of the Fmo-glvA gene was amplified with Fmo-glvA-up-R and Fmo-glvA-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 23) was obtained. Using the genomic DNA of the engineering strain CGMCC25404 as a template, the downstream homologous arm of the Fmo-glvA gene was amplified with Fmo-glvA-down-R and Fmo-glvA-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 1974 to 2524 of SEQ ID NO: 23) was obtained. To amplify the Fmo-glvA gene, the Fmo-glvA gene was first synthesized, and then the synthesized Fmo-glvA gene was used as a template to amplify the Fmo-glvA gene and the promoter P trc and the terminator rrnB (i.e., positions 487 to 1975 of SEQ ID NO: 23), named P trc -Fmo-glvA-T rrnB . The amplification system was referred to Table 1.

[0451] Using the upstream primer Fmo-glvA-up-F of the aforementioned upstream homologous arm and the downstream primer Fmo-glvA-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Fmo-glvA-T rrnBOverlap PCR was performed with the template for amplification to prepare recombinant fragments. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95°C) for 5 min; then 30 cycles were carried out: denaturation (98°C) for 10 s, annealing ((Tm - 3 / 5)°C) for 15 s, extension at 72°C (about 1 kb can be extended in 1 min with this enzyme activity); continue to extend at 72°C for 10 min; maintain at (4°C). The overlap PCR reaction system was referred to Table 2 to obtain the DNA fragment for homologous recombination, and this DNA fragment for homologous recombination P trc -Fmo-glvA-T rrnB has the nucleotide sequence of SEQ ID NO: 23, in which the 1st to 486th positions are the upstream homologous arm (486 bp) of the Fmo-glvA gene, the 487th to 560th positions are the Ptrc promoter (74 bp), the 561st to 1886th positions are the Fmo-glvA gene (1326 bp), the 1887th to 1973rd positions are the rrnB terminator region (87 bp), and the 1974th to 2524th positions are the downstream homologous arm (551 bp) of the Fmo-glvA gene.

[0452] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Fmo-glvA-T rrnB ), and the total amount does not exceed 10 ng.

[0453] 2. Transformation of plasmid and recombinant DNA fragment

[0454] pREDCas9 was purchased from Addgene, catalog number #71541, carrying the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, with spectinomycin resistance (working concentration: 100 mg / L), and cultured at 32°C.

[0455] (1) Transformation of pREDCas9

[0456] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing spectinomycin and cultured overnight at 32°C. Single colonies growing on the resistant plate were subjected to colony PCR with identification primers to screen for positive recombinants.

[0457] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0458] The positive recombinants in “(1) Transformation of pREDCas9” were cultured at 32°C until the OD 600nm was 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD600nm When it is 0.6 to 0.7, competent cell preparation is carried out. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for competent cell preparation and the preparation process refer to the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0459] (3) Transformation of pGRB and recombinant DNA fragments

[0460] Electrotransform pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment shown in SEQ ID NO: 23) simultaneously into the electrocompetent cells containing pREDCas9 obtained from "(2) Preparation of electrocompetent cells of the target strain containing pREDCas9". Spread the bacteria after resuscitation culture after electrotransformation on an LB plate containing ampicillin and chlortetracycline, and culture overnight at 32°C. Use the identification primers Fmo-glvA-up-F / Fmo-glvA-R1 and Fmo-glvA-F2 / Fmo-glvA-down-R for colony PCR verification, screen positive recombinants and preserve the bacteria.

[0461] Fmo-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0462] Fmo-glvA-R1: 5'-CCCTCTATCCATGCCTCAAC-3';

[0463] Fmo-glvA-F2: 5'-CAAGAAACTTGCGGACCAGG-3';

[0464] Fmo-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0465] (4) Elimination of plasmids

[0466] ① Elimination of pGRB

[0467] Place the positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" in an LB medium containing 0.2% arabinose and culture overnight. Dilute appropriately and spread on an LB plate with chlortetracycline resistance, and culture overnight at 32°C. Pick single colonies and streak them one by one onto an LB plate containing ampicillin and chlortetracycline resistance. Select the single colonies that do not grow on the ampicillin plate and grow on the chlortetracycline resistance plate to preserve the bacteria, and obtain positive recombinants.

[0468] ② Elimination of pREDCas9 plasmid

[0469] The positive recombinants obtained from "①elimination of pGRB" were transferred to a non-resistant LB liquid medium and cultured overnight at 42°C. After appropriate dilution, they were spread on a non-resistant LB plate and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing kirromycin resistance and non-resistance respectively. Single colonies that did not grow on the kirromycin-resistant plate but grew on the non-resistant plate were preserved to obtain positive single colonies.

[0470] The obtained positive colonies were sent for sequencing. The strains with correct sequencing results were named recombinant strain YPThr-Fmo-glvA. Recombinant strain YPThr-Fmo-glvA was obtained by inserting the DNA fragment shown by nucleotides at positions 487 to 1973 in SEQ ID NO:23 into the intergenic region of the CGMCC25404 genome that does not encode any gene, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0471] According to the aforementioned method, using the wild-type strain MG1655 as the starting strain, recombinant strain MG1655-Fmo-glvA was obtained. Recombinant strain MG1655-Fmo-glvA was obtained by inserting the DNA fragment shown by nucleotides at positions 487 to 1973 in SEQ ID NO:23 into the intergenic region of the MG1655 genome that does not encode any gene, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0472] Compared with the starting strains, both recombinant strain YPThr-Fmo-glvA and recombinant strain MG1655-Fmo-glvA contain the glvA gene from Fusobacterium mortiferum with the coding sequence of SEQ ID NO:22 and can express the 6-phosphoglucosidase from Fusobacterium mortiferum with the amino acid sequence of SEQ ID NO:21.

[0473] Example 7. Construction of genetic engineering strains YPThr-Lsa-glvA and MG1655-Lsa-glvA

[0474] The coding sequence of the glvA gene (Lsa-glvA gene) from Lentibacillus salicampi is SEQ ID NO:25, which can encode the 6-phosphoglucosidase from Lentibacillus salicampi with the amino acid sequence of SEQ ID NO:24.

[0475] 1. Preparation of DNA fragments for homologous recombination

[0476] The recombinant fragment for the expression of the glvA gene from Lentibacillus salicampi consists of the Lsa-glvA gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Lsa-glvA gene as templates, the upstream and downstream homologous arm primers were designed as follows:

[0477] Lsa-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0478] Lsa-glvA-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0479] Lsa-glvA-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAAAAATTTTCTATTAC-3';

[0480] Lsa-glvA-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAACTTAATTCAGGCCAAT-3';

[0481] Lsa-glvA-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0482] Lsa-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0483] Using the genomic DNA of the engineered strain CGMCC 25404 as a template, the upstream homologous arm of the Lsa-glvA gene was amplified with Lsa-glvA-up-R and Lsa-glvA-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 26) was obtained. Using the genomic DNA of the engineered strain CGMCC 25404 as a template, the downstream homologous arm of the Lsa-glvA gene was amplified with Lsa-glvA-down-R and Lsa-glvA-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 1974 to 2524 of SEQ ID NO: 26) was obtained. To amplify the Lsa-glvA gene, the Lsa-glvA gene was first synthesized, and then the synthesized Lsa-glvA gene was used as a template to amplify the Lsa-glvA gene and the promoter P trc and the terminator rrnB (i.e., positions 487 to 1973 of SEQ ID NO: 26), named P trc -Lsa-glvA-T rrnB . The amplification system was referred to Table 1.

[0484] Using the upstream primer Lsa-glvA-up-F of the aforementioned upstream homologous arm and the downstream primer Lsa-glvA-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Lsa-glvA-T rrnB were used as amplification templates to perform overlap PCR to prepare a recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95 °C) for 5 min; then 30 cycles were carried out: denaturation (98 °C) for 10 s, annealing ((Tm - 3 / 5) °C) for 15 s, extension at 72 °C (about 1 kb was extended in 1 min by this enzyme activity); continue to extend at 72 °C for 10 min; maintain (4 °C). The overlap PCR reaction system was referred to Table 2, and a DNA fragment for homologous recombination was obtained. The nucleotide sequence of the DNA fragment P trc -Lsa-glvA-T rrnB is SEQ ID NO: 26, in which positions 1 to 486 are the upstream homologous arm of the Lsa-glvA gene (486 bp), positions 487 to 560 are thePtrc promoter (74 bp), positions 561 to 1886 are the Lsa-glvA gene (1326 bp), positions 1887 to 1973 are the rrnB terminator region (87 bp), and positions 1974 to 2524 are the downstream homologous arm of the Lsa-glvA gene (551 bp).

[0485] Note: The template consists of equimolar amplification fragments of the upstream and downstream homologous arms and the target gene (P trc -Lsa-glvA-T rrnB ), and the total amount does not exceed 10 ng.

[0486] 2. Transformation of plasmid and recombinant DNA fragment

[0487] pREDCas9 was purchased from Addgene, catalog number #71541, carrying an elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system, with streptomycin resistance (working concentration: 100 mg / L), and cultured at 32 °C.

[0488] (1) Transformation of pREDCas9

[0489] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing streptomycin and cultured overnight at 32 °C. Single colonies growing on the resistant plate were subjected to colony PCR using identification primers to screen for positive recombinants.

[0490] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0491] The positive recombinants in “(1) Transformation of pREDCas9” were cultured at 32 °C until the OD 600nm was 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD 600nm was 0.6 to 0.7 for the preparation of competent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of competent cells and the preparation process followed the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0492] (3) Transformation of pGRB and recombinant DNA fragment

[0493] pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment shown in SEQ ID NO: 26) were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9 obtained in “(2) Preparation of electrocompetent cells of the target strain containing pREDCas9”. The cells resuscitated and cultured after electroporation were spread on an LB plate containing ampicillin and streptomycin and cultured overnight at 32 °C. Colony PCR verification was performed using the identification primers Lsa-glvA-up-F / Lsa-glvA-R1 and Lsa-glvA-F2 / Lsa-glvA-down-R to screen for positive recombinants and preserve the bacteria.

[0494] Lsa-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0495] Lsa-glvA-R1: 5'-CTACCGCAACTTGCTGTTCC-3';

[0496] Lsa-glvA-F2: 5'-CAACTATTGCAGGTGCCTGT-3';

[0497] Lsa-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0498] (4) Elimination of plasmids

[0499] ① Elimination of pGRB

[0500] The positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" were cultured overnight in LB medium containing 0.2% arabinose, appropriately diluted and then spread on LB plates containing gentamycin resistance, and cultured overnight at 32 °C. Single colonies were picked and streaked one by one onto LB plates containing ampicillin and gentamycin resistance. The single colonies that did not grow on the ampicillin plate but grew on the gentamycin resistance plate were preserved to obtain positive recombinants.

[0501] ② Elimination of pREDCas9 plasmid

[0502] The positive recombinants obtained from "① Elimination of pGRB" were transferred to LB liquid medium without resistance and cultured overnight at 42 °C, appropriately diluted and then spread on LB plates without resistance, and cultured overnight at 37 °C. Single colonies were picked and streaked one by one onto LB plates containing gentamycin resistance and without resistance. The single colonies that did not grow on the gentamycin resistance plate but grew on the plate without resistance were preserved to obtain positive single colonies.

[0503] The positive colonies obtained above were sent for sequencing. The strains with correct sequencing results were named recombinant strain YPThr-Lsa-glvA. The recombinant strain YPThr-Lsa-glvA was obtained by inserting the DNA fragment shown by the nucleotides at positions 487 to 1973 in SEQ ID NO:26 into the intergenic region of the CGMCC25404 genome that does not encode any genes, and keeping other nucleotide sequences unchanged to obtain recombinant Escherichia coli.

[0504] According to the foregoing method, using the wild-type strain MG1655 as the starting strain, the recombinant strain MG1655-Lsa-glvA was obtained. The recombinant strain MG1655-Lsa-glvA was obtained by inserting the DNA fragment shown by nucleotides 487 to 1973 in SEQ ID NO:26 into the intergenic region of the MG1655 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0505] Compared with the starting strain, both the recombinant strain YPThr5-Lsa-glvA and the recombinant strain MG16555-Lsa-glvA contain the glvA gene from Lentibacillus salicampi with the coding sequence of SEQ ID NO:25, and can express the 6-phosphoglucosidase from Lentibacillus salicampi with the amino acid sequence of SEQ ID NO:24.

[0506] Example 8: Construction of genetically engineered bacteria YPThr-Bsp-glvA and MG1655-Bsp-glvA

[0507] The coding sequence of the glvA gene (Bsp-glvA gene) from Bacillus sp. (Bacillus sp.V3-13) is SEQ ID NO:28, and it can encode the 6-phosphoglucosidase from Bacillus sp. with the amino acid sequence of SEQ ID NO:27.

[0508] 1. Preparation of DNA fragments for homologous recombination

[0509] The recombinant fragment for the expression of the glvA gene from Bacillus sp. consists of the Bsp-glvA gene and its upstream and downstream homologous arms (upstream homologous arm - downstream homologous arm). Using the primer design software primer5, with the upstream and downstream sequences of the Bsp-glvA gene as templates, upstream and downstream homologous arm primers were designed as follows:

[0510] Bsp-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0511] Bsp-glvA-up-R: 5'-GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAActccccaagggggcgagggg-3';

[0512] Bsp-glvA-F: 5'-AATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAAAAGTTTTCAATTGT-3';

[0513] Bsp-glvA-R: 5'-ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAGCTTATCACAGGAACGG-3';

[0514] Bsp-glvA-down-F: 5'-GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATagggttagggtgagggggcg-3';

[0515] Bsp-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0516] Using the genomic DNA of the engineering strain CGMCC25404 as a template, the upstream homologous arm of the Bsp-glvA gene was amplified with Bsp-glvA-up-R and Bsp-glvA-up-F. The amplification system was referred to Table 1, and the upstream homologous arm of 486 bp (i.e., positions 1 to 486 of SEQ ID NO: 29) was obtained. Using the genomic DNA of the engineering strain CGMCC25404 as a template, the downstream homologous arm of the Bsp-glvA gene was amplified with Bsp-glvA-down-R and Bsp-glvA-down-F. The amplification system was referred to Table 1, and the downstream homologous arm of 551 bp (i.e., positions 2004 to 2554 of SEQ ID NO: 29) was obtained. To amplify the Bsp-glvA gene, the Bsp-glvA gene was first synthesized, and then the synthesized Bsp-glvA gene was used as a template to amplify the Bsp-glvA gene and the promoter P trc and the terminator rrnB (i.e., positions 487 to 2003 of SEQ ID NO: 29), named P trc -Bsp-glvA-T rrnB . The amplification system was referred to Table 1.

[0517] Using the upstream primer Bsp-glvA-up-F of the aforementioned upstream homologous arm and the downstream primer Bsp-glvA-down-R of the downstream homologous arm as amplification primers, the upstream homologous arm, the downstream homologous arm, and P trc -Bsp-glvA-T rrnBOverlap PCR was performed using the template for amplification to prepare the recombinant fragment. Overlap PCR reaction conditions (Takara PrimeSTAR HS enzyme): pre-denaturation (95 °C) for 5 min; then 30 cycles were carried out: denaturation (98 °C) for 10 s, annealing ((Tm - 3 / 5) °C) for 15 s, extension at 72 °C (this enzyme activity extends approximately 1 kb in 1 min); continue to extend at 72 °C for 10 min; hold at (4 °C). The overlap PCR reaction system was referred to Table 2 to obtain the DNA fragment for homologous recombination, and this DNA fragment for homologous recombination, P trc -Bsp-glvA-T rrnB has the nucleotide sequence of SEQ ID NO:29, where positions 1 to 486 are the upstream homologous arm of the Bsp-glvA gene (486 bp), positions 487 to 560 are the Ptrc promoter (74 bp), positions 561 to 1916 are the Bsp-glvA gene (1356 bp), positions 1917 to 2003 are the rrnB terminator region (87 bp), and positions 2004 to 2554 are the downstream homologous arm of the Bsp-glvA gene (551 bp).

[0518] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homologous arms and the target gene (P trc -Bsp-glvA-T rrnB ), and the total amount does not exceed 10 ng.

[0519] 2. Transformation of plasmid and recombinant DNA fragment

[0520] pREDCas9 was purchased from Addgene, catalog number #71541, carrying the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system, with chlortetracycline resistance (working concentration: 100 mg / L), and cultured at 32 °C.

[0521] (1) Transformation of pREDCas9

[0522] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of the starting strain CGMCC25404 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing chlortetracycline and cultured overnight at 32 °C. Single colonies growing on the resistant plate were subjected to colony PCR using identification primers to screen for positive recombinants.

[0523] (2) Preparation of electrocompetent cells of the target strain containing pREDCas9

[0524] The positive recombinant from “(1) Transformation of pREDCas9” was cultured at 32 °C until the OD 600nm was 0.1 to 0.2, then 0.1 M IPTG was added (to make its final concentration 0.1 mM), and the culture was continued until the OD600nm When it is 0.6 to 0.7, competent cell preparation is carried out. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for competent cell preparation and the preparation process refer to the conventional standard operation to obtain electrocompetent cells containing pREDCas9.

[0525] (3) Transformation of pGRB and recombinant DNA fragments

[0526] Electrotransform pGRB-sgRNA and the donor DNA fragment (i.e., the DNA fragment shown in SEQ ID NO: 29) simultaneously into the electrocompetent cells containing pREDCas9 obtained from "(2) Preparation of electrocompetent cells of the target strain containing pREDCas9". Spread the cells after electrotransformation and resuscitation culture on an LB plate containing ampicillin and kirromycin, and culture overnight at 32°C. Use the identification primers Bsp-glvA-up-F / Bsp-glvA-R1 and Bsp-glvA-F2 / Bsp-glvA-down-R for colony PCR verification, screen positive recombinants and preserve the bacteria.

[0527] Bsp-glvA-up-F: 5'-TATGAGGCGCTCTCTGTTCC-3';

[0528] Bsp-glvA-R1: 5'-TGCACTTGGAACAGTTCTGG-3';

[0529] Bsp-glvA-F2: 5'-AACTATTGCGGGTGCATGTG-3';

[0530] Bsp-glvA-down-R: 5'-CGCCGCGATGGACGGCCAG-3'.

[0531] (4) Elimination of plasmids

[0532] ① Elimination of pGRB

[0533] Place the positive recombinants obtained from "(3) Transformation of pGRB and recombinant DNA fragments" in an LB medium containing 0.2% arabinose and culture overnight. Dilute appropriately and spread on an LB plate with kirromycin resistance, and culture overnight at 32°C. Pick single colonies and streak them one by one onto an LB plate containing ampicillin and kirromycin resistance. Select the single colonies that do not grow on the ampicillin plate but grow on the kirromycin resistance plate to preserve the bacteria, and obtain positive recombinants.

[0534] ② Elimination of pREDCas9 plasmid

[0535] The positive recombinants obtained by "①elimination of pGRB" were transferred to a non-resistant LB liquid medium and cultured overnight at 42°C. After appropriate dilution, they were spread on a non-resistant LB plate and cultured overnight at 37°C. Single colonies were picked and streaked one by one onto LB plates containing streptomycin resistance and non-resistance respectively. Single colonies that did not grow on the streptomycin-resistant plate but grew on the non-resistant plate were preserved to obtain positive single colonies.

[0536] The positive colonies obtained above were sent for sequencing. The strains with correct sequencing results were named recombinant strain YPThr-Bsp-glvA. Recombinant strain YPThr-Bsp-glvA was obtained by inserting the DNA fragment shown by nucleotides 487 to 2003 in SEQ ID NO:29 into the intergenic region of the CGMCC25404 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0537] According to the foregoing method, using the wild-type strain MG1655 as the starting strain, recombinant strain MG1655-Bsp-glvA was obtained. Recombinant strain MG1655-Bsp-glvA was obtained by inserting the DNA fragment shown by nucleotides 487 to 2003 in SEQ ID NO:29 into the intergenic region of the MG1655 genome that does not encode any genes, while keeping other nucleotide sequences unchanged, resulting in a recombinant Escherichia coli.

[0538] Compared with the starting strains, both recombinant strain YPThr-Bsp-glvA and recombinant strain MG1655-Bsp-glvA contain the glvA gene (Bsp-glvA gene) from Bacillus sp. with the coding sequence of SEQ ID NO:28 and can express 6-phosphoglucosidase from Bacillus sp. with the amino acid sequence of SEQ ID NO:27.

[0539] Example 9: Verification of L-threonine production performance in strains expressing modified maltose hydrolysis system enzyme genes

[0540] Inoculate the strains MG1655, MG1655-Kpn-algAB, MG1655-Bsa-glvA, MG1655-Cac-glvAC, MG1655-Pdu-glvA, MG1655-Bsm-glvC, MG1655-Fmo-glvA, MG1655-Lsa-glvA, and the engineered strains of CGMCC25404, YPThr-Kpn-algAB, YPThr-Bsa-glvA, YPThr-Cac-glvAC, YPThr-Pdu-glvA, YPThr-Bsm-glvC, YPThr-Fmo-glvA, YPThr-Lsa-glvA, YPThr-Bsp-glvA onto slant media and culture at 37°C for 12 h. Scrape a loopful of slant seeds with an inoculation loop and inoculate into a 500 mL Erlenmeyer flask containing 30 mL of seed medium, seal with nine layers of gauze, and culture at 37°C and 200 rpm for 7 - 10 h. Then, take 1 mL of the culture of each strain and inoculate it into 50 mL of shake flask fermentation medium, and ferment at 37°C and 200 rpm for 36 h. Determine the content of L-threonine by HPLC. Perform three parallels for each strain and process the data using one-way ANOVA. P < 0.05 (*) indicates significant difference, and P < 0.01 (**) indicates extremely significant difference. The test results are shown in Table 3.

[0541] Slant medium: Peptone 16 g / L, yeast powder 10 g / L, NaCl 5 g / L, agar 15 - 20 g / L, the rest is water, pH 7.0 - 7.2;

[0542] The composition of the seed medium is: Glucose 1 - 5 g / L, peptone 5 - 10 g / L, beef extract 5 - 10 g / L, yeast powder 1 - 5 g / L, NaCl 1 - 2.5 g / L, the rest is water, pH 7.0 - 7.2;

[0543] Shake flask fermentation medium: Glucose 40 g / L, (NH4)2SO4 12 g / L, KH2PO4 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, calcium carbonate 0.5 g / L, the rest is water, adjust the pH to 7.0 with sodium hydroxide.

[0544] Table 3 L-threonine production of engineered strains

[0545]

[0546] The results are shown in Table 3. For both the high-yield L-threonine strain CGMCC25404 and the model strain MG1655, enhancing the expression of enzymes in the maltose hydrolysis system from different sources increased the L-threonine yield. Enhancing the expression intensity of the algAB gene from Klebsiella pneumoniae promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 33.46 g / L, and the L-threonine yield increased by 8.88%; enhancing the expression intensity of the glvA gene from Bacillus safensis promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 32.55 g / L, and the L-threonine yield increased by 5.92%; enhancing the expression intensity of the glvAC gene from Clostridium acetobutylicum promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 32.19 g / L, and the L-threonine yield increased by 4.75%; enhancing the expression intensity of the glvA gene from Paenibacillus durus promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 to 31.02 g / L, and the increase in the L-threonine yield was not significant; enhancing the expression intensity of the glvC gene from Bacillus smithii 7_3_47FAA promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 31.98 g / L, and the L-threonine yield increased by 4.07%; enhancing the expression intensity of the glvA gene from Fusobacterium mortiferum promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 30.82 g / L, and the increase in the L-threonine yield was not significant; enhancing the expression intensity of the glvA gene from Lentibacillus salicampi promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 33.82 g / L, and the L-threonine yield increased by 10.06%; enhancing the expression intensity of the glvA gene from Bacillus sp. promoted the accumulation concentration of L-threonine in the CGMCC25404 strain to increase from 30.73 g / L to 31.74 g / L, and the L-threonine yield increased by 3.29%.

[0547] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, the present invention is intended to include any modifications, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in the present invention.

Claims

1. At least one of the following uses: A1), use of maltose hydrolysis system enzymes and / or biological materials related to the maltose hydrolysis system enzymes in the preparation of threonine; A2), use of the maltose hydrolysis system enzyme and / or biological materials related to the maltose hydrolysis system enzyme in improving the threonine production of microorganisms; A3), use of the maltose hydrolysis system enzyme and / or biological materials related to the maltose hydrolysis system enzyme in constructing an engineered bacterium producing threonine; A4), use of the maltose hydrolysis system enzyme and / or biological materials related to the maltose hydrolysis system enzyme in constructing a recombinant microorganism with high threonine production; the threonine production of the recombinant microorganism is higher than that of the starting strain; The maltose hydrolysis system enzymes include at least one or more of the following: B1), maltose hydrolysis system enzymes from Klebsiella pneumoniae; B2), maltose hydrolysis system enzymes from Bacillus safensis; B3), maltose hydrolysis system enzymes from Clostridium acetobutylicum; B4), maltose hydrolysis system enzymes from Paenibacillus durus; B5), maltose hydrolysis system enzymes from Bacillus smithii; B6), maltose hydrolysis system enzymes from Fusobacterium mortiferum; B7), maltose hydrolysis system enzymes from Lentibacillus salicampi; B8), maltose hydrolysis system enzyme from Bacillus sp.

2. The use according to claim 1, characterized in that: The Klebsiella pneumoniae-derived maltose hydrolysis system enzyme comprises a Klebsiella pneumoniae-derived PTS system α-glucosidase-specific EIICB component and 6-phosphoglucosidase, and the Klebsiella pneumoniae-derived PTS system α-glucosidase-specific EIICB component comprises at least one of the following proteins: a1), a protein whose amino acid sequence comprises SEQ ID NO.1; a2), a protein related to the maltose hydrolysis system enzyme obtained by replacing and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a1), which has a homology of more than 70% with the amino acid sequence shown in a1); a3), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1) or a2); The 6-phosphoglucosidase derived from Klebsiella pneumoniae comprises at least one of the following: a4), a protein whose amino acid sequence comprises SEQ ID NO.3; a5), a protein related to the maltose hydrolysis system enzyme obtained by replacing and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a4), which has more than 70% identity with the amino acid sequence shown in a4); a6), a fusion protein obtained by connecting a tag to the N-terminus or / and the N-terminus of a1) or a2); The maltose hydrolysis system enzyme derived from Bacillus safensis includes 6-phosphoglucosidase derived from Bacillus safensis, and the 6-phosphoglucosidase derived from Bacillus safensis includes at least one of the following: a7), a protein whose amino acid sequence comprises SEQ ID NO.7; a8), a protein related to the maltose hydrolysis system enzyme obtained by replacing and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a7), which has more than 70% identity with the amino acid sequence shown in a7); a9), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a7) or a8); The Clostridium acetobutylicum-derived maltose hydrolysis system enzyme includes a 6-phosphoglucosidase derived from Clostridium acetobutylicum and a PTS-phosphotransferase IIBC component derived from Clostridium acetobutylicum, wherein the 6-phosphoglucosidase derived from Clostridium acetobutylicum comprises at least one of the following: a10), a protein whose amino acid sequence comprises SEQ ID NO.10; a11), a protein related to a maltose hydrolysis system enzyme obtained by replacing and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a10), which has a homology of more than 70% with the amino acid sequence shown in a10); a12), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a10) or a11); The Clostridium acetobutylicum derived PTS-phosphotransferase IIBC component comprises at least one of the following: a13), a protein whose amino acid sequence comprises SEQ ID NO.12; a14), a protein related to the maltose hydrolysis system enzyme obtained by replacing and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a13), having a homology of more than 70% with the amino acid sequence shown in a13); a15), a fusion protein obtained by connecting a tag to the N-terminus or / and N-terminus of a13) or a14); The maltose hydrolysis system enzyme derived from Paenibacillus durus includes 6-phosphoglucosidase derived from Paenibacillus durus, and the 6-phosphoglucosidase derived from Paenibacillus durus includes at least one of the following: a16), a protein whose amino acid sequence comprises SEQ ID NO.15; a17), a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a16), which has a homology of more than 70% with the amino acid sequence shown in a16), and is related to the maltose hydrolysis system enzyme; a18), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a16) or a17); The maltose hydrolysis system enzyme derived from Bacillus smithii includes 6-phosphoglucosidase derived from Bacillus smithii, and the 6-phosphoglucosidase derived from Bacillus smithii comprises at least one of the following: a19), a protein whose amino acid sequence comprises SEQ ID NO.18; a20), a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence of the protein shown in a19), having a homology of more than 70% with the amino acid sequence shown in a19), and being related to the maltose hydrolysis system enzyme; a21), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a19) or a20); The maltose hydrolysis system enzyme derived from Fusobacterium mortiferum includes 6-phosphoglucosidase derived from Fusobacterium mortiferum, and the 6-phosphoglucosidase derived from Fusobacterium mortiferum includes at least one of the following: a22), a protein whose amino acid sequence comprises SEQ ID NO.21; a23), a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a22), which has more than 70% identity with the amino acid sequence shown in a22), and is related to the maltose hydrolysis system enzyme; a24), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a22) or a23); The maltose hydrolysis system enzyme derived from Lentibacillus salicampi includes 6-phosphoglucosidase derived from Lentibacillus salicampi, and the 6-phosphoglucosidase derived from Lentibacillus salicampi comprises at least one of the following: a25), a protein whose amino acid sequence comprises SEQ ID NO.24; a26), a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a25), which has a homology of more than 70% with the amino acid sequence shown in a25), and is related to the maltose hydrolysis system enzyme; a27), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a25) or a26); The maltose hydrolysis system enzyme derived from Bacillus sp. includes 6-phosphoglucosidase derived from Bacillus sp., and the 6-phosphoglucosidase derived from Bacillus sp. includes at least one of the following: a28), a protein whose amino acid sequence comprises SEQ ID NO.27; a29), a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a28), which has a homology of more than 70% with the amino acid sequence shown in a28), and is related to the maltose hydrolysis system enzyme; a30), a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a28) or a29).

3. The use according to claim 1 or 2, characterized in that: The biological material associated with the maltose hydrolysis system enzyme comprises at least one of the following: C1), a nucleic acid molecule encoding the maltose hydrolysis system enzyme; C2), an expression cassette and / or construct containing the nucleic acid molecule; C3), a DNA fragment and / or a recombinant vector containing the nucleic acid molecule and / or the expression cassette and / or the construct.

4. The use according to claim 3, characterized in that: The nucleic acid molecule encoding the maltose hydrolysis system enzyme is the coding gene of the maltose hydrolysis system enzyme or the RNA transcribed from the coding gene, The coding genes of the maltose hydrolysis system enzyme derived from Klebsiella pneumoniae include algA gene and algB gene, and the algA gene includes at least one of the following: g1), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.2; g2), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g1); The algB gene comprises at least one of the following: g3), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.4; g4), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g3); The coding genes of the maltose hydrolysis system enzymes derived from Bacillus safensis include at least one of the following: g5), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.8; g6), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g5); The coding genes of the maltose hydrolysis system enzymes derived from Clostridium acetobutylicum include glvA gene and glvC gene, and the glvA gene includes at least one of the following: g7), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.11; g8), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g7); The glvC gene comprises at least one of the following: g9), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.13; g10), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g9); The coding genes of the maltose hydrolysis system enzymes derived from Paenibacillus durus include at least one of the following: g11), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.16; g12), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g11); The coding genes of the maltose hydrolysis system enzymes derived from Bacillus smithii include at least one of the following: g13), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.19; g14), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g13); The gene encoding the maltose hydrolysis system enzyme from Fusobacterium mortiferum comprises at least one of the following: g15), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.22; g16), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g15); The gene encoding the maltose hydrolysis system enzyme from Lentibacillus salicampi comprises at least one of the following: g17), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.25; g18), a nucleic acid molecule having more than 70% identity with the nucleic acid molecule described in g17); The gene encoding the maltose hydrolysis system enzyme from Bacillus sp. comprises at least one of the following: g19), a nucleic acid molecule whose coding sequence comprises SEQ ID NO.28; g20) A nucleic acid molecule that has more than 70% identity with the nucleic acid molecule described in g19).

5. The biomaterial as claimed in any one of claims 1 to 4.

6. A method for increasing the threonine production of a recipient microorganism and / or constructing a recombinant microorganism with high threonine production, characterized in that: The method includes M1 or M2: The M1 comprises the step of causing the recipient microorganism to contain or express the maltose hydrolysis system enzyme described in claim 1, so as to increase the threonine production of the recipient microorganism and / or obtain a recombinant microorganism with high threonine production; The M2 comprises the step of introducing the nucleic acid molecule, expression cassette and / or construct and / or the DNA fragment and / or recombinant vector described in any one of claims 3 to 5 into the recipient microorganism to increase the threonine production of the recipient microorganism.

7. A recombinant microorganism, characterized in that: The recombinant microorganism comprises at least one of the following: D1), a recombinant microorganism containing and / or expressing the maltose hydrolysis system enzyme according to any one of claims 1 to 4; D2), a recombinant microorganism containing a gene encoding the maltose hydrolysis system enzyme described in D1); D3), ​​a recombinant microorganism containing an expression cassette and / or construct encoding the gene described in D2); D4), a recombinant microorganism containing the coding gene described in D2) and / or the DNA fragment and / or recombinant vector of the expression cassette and / or construct described in D3); D5) A recombinant microorganism prepared by the method of claim 7.

8. A composition for preparing threonine, characterized in that: The composition contains the recombinant microorganism prepared by the method of claim 6 and / or contains the recombinant microorganism according to claim 7.

9. Use of the recombinant microorganism prepared by the method of claim 6, the recombinant microorganism of claim 7 and / or the composition of claim 8 in the preparation of threonine.

10. A method for preparing threonine, characterized in that: The method comprises the steps of preparing threonine by using the recombinant microorganism obtained by the method of claim 6 as a fermentation strain, preparing threonine by using the recombinant microorganism of claim 7 or 8 as a fermentation strain, and / or preparing threonine by using the composition of claim 8.