Bursaphelenchus xylophilus detection method based on RPA-CRISPR / Cas12b

Abstract

The invention discloses a pine wood nematode detection method based on RPA-CRISPR / Cas12b, and belongs to the technical field of biological detection. According to the invention, a specific Bursaphelenchus xylophilus RPA primer and a specific sgRNA sequence combined with CRISPR / Cas12b are designed, the Bursaphelenchus xylophilus DNA is amplified by using the specific RPA primer, and then a detection signal is amplified by using a CRISPR / Cas12b technology, so that the detection sensitivity is greatly improved. According to the method, a detection result can be obtained within a short time, the detection process is constant in temperature and easy to control, the operation is simple and easy to implement, the sensitivity and the specificity are high, and a new technical scheme is provided for rapid detection of the bursaphelenchus xylophilus.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to a method for detecting Bursaphelenchus xylophilus based on RPA-CRISPR / Cas12b. Background Art

[0002] AaCas12b (C2c1) is derived from Alicyclobacillus acidiphilus and belongs to the type V-B classification in the Class 2 CRISPR system. It is an RNA-guided DNA endonuclease. Under the guidance of a single-guide RNA (sgRNA), the Cas-sgRNA complex recognizes the PAM sequence (-TTN) on the NTS of double-stranded DNA, binds to the homologous region (18 - 20 nt) of the target DNA, and initiates a cis-cleavage reaction in the 3' direction of the sgRNA, with high target recognition specificity. After cis-cleavage of the target sequence, a trans-cleavage reaction will also be triggered, continuously and efficiently cleaving other non-homologous single-stranded nucleic acids in the system. In the field of nucleic acid detection applications, by utilizing the trans-cleavage activity of AaCas12b, in the presence of the detection target region, the labeled SSDNA reporter probe is cleaved to achieve amplified detection of the reporter signal.

[0003] In terms of reaction ability, the substrates recognized by AaCas12b include double-stranded and single-stranded DNA. The difference is that the recognition of double-stranded DNA depends on the upstream PAM site, while the recognition of single-stranded DNA does not depend on the PAM site. Compared with Cas12a, AaCas12b has a wider temperature tolerance range and has good detection activity within the temperature range of 37 - 65°C. However, at present, there are few reports on the application of AaCas12b in nucleic acid detection.

[0004] As a highly destructive alien invasive species, Bursaphelenchus xylophilus has brought a catastrophic blow to the global forest ecosystem, especially to pine plants. It spreads widely to Asia, Europe, etc. through human-mediated means such as the transportation of wood and wood products in international trade. This tiny nematode parasitizes in pine trees, destroys their normal physiological and metabolic functions by feeding on the parenchyma cells of pine trees, causing the pine trees to rapidly lose water and wither, and it often only takes a few months from the onset of the disease to death. According to incomplete statistics, the direct economic losses caused by Bursaphelenchus xylophilus disease reach up to billions of yuan every year, and at the same time, it causes incalculable indirect losses in many aspects such as forest ecological balance, biodiversity protection, and ecological service functions.

[0005] Traditional morphological detection methods involve observing and identifying Bursaphelenchus xylophilus under a microscope. However, this requires operators to have profound knowledge of nematode taxonomy and be familiar with the subtle morphological characteristics of different developmental stages of Bursaphelenchus xylophilus, such as the body length, tail shape, and morphology of copulatory spicules of female and male worms. This not only requires long-term professional training but also has a large human judgment error. Different appraisers may have differences in the interpretation of similar characteristics, easily leading to misjudgment or missed judgment. Especially when faced with mixed nematode samples or slightly variant nematode morphologies, it is difficult to ensure accuracy. Immunological detection methods are immunological detection techniques based on antigen-antibody reactions, such as enzyme-linked immunosorbent assay (ELISA). Although the detection speed is improved to a certain extent, it is limited by the specificity of antibodies. Bursaphelenchus xylophilus shares some common antigenic epitopes with other related nematode species, which easily causes cross-reactions, resulting in false positives in the detection results, interfering with the judgment of the real epidemic situation, and having low sensitivity. Therefore, there is an urgent need to develop a more efficient and accurate new method for detecting Bursaphelenchus xylophilus. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for detecting Bursaphelenchus xylophilus based on RPA-CRISPR / Cas12b to solve the problems existing in the above-mentioned prior art. The present invention designs specific RPA primers for Bursaphelenchus xylophilus and specific sgRNA sequences combined with CRISPR / Cas12b. The specific RPA primers are used to amplify the DNA of Bursaphelenchus xylophilus, and then the CRISPR / Cas12b technology is used to amplify the detection signal, thereby greatly improving the detection sensitivity. The method of the present invention can obtain detection results in a relatively short time. The detection process is isothermal and easy to control, and the operation is simple and easy to implement. It has high sensitivity and specificity, providing a new technical solution for the rapid detection of Bursaphelenchus xylophilus.

[0007] To achieve the above purpose, the present invention provides the following solutions:

[0008] The present invention provides an sgRNA for detecting Bursaphelenchus xylophilus, and the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.4.

[0009] The present invention also provides an RPA primer set for detecting Bursaphelenchus xylophilus, and the RPA primer set includes an upstream primer BX6-F as shown in SEQ ID NO.1 and a downstream primer BX6-R as shown in SEQ ID NO.2.

[0010] The present invention also provides the application of the above sgRNA and the above RPA primer set in the preparation of a Bursaphelenchus xylophilus detection product based on PRA-CRISPR / Cas12b, and the product includes reagents or reagent kits.

[0011] The present invention also provides a PRA-CRISPR / Cas12b kit for detecting Bursaphelenchus xylophilus, wherein the PRA-CRISPR / Cas12b kit contains an RPA reaction system and a CRISPR / Cas12b reaction system;

[0012] The above RPA primer set is included in the RPA reaction system;

[0013] The above sgRNA is included in the CRISPR / Cas12b reaction system.

[0014] Furthermore, the CRISPR / Cas12b reaction system further contains AaCas12b protein and ssDNA; the ssDNA is FAM-TTTTTTT-BHQ1.

[0015] The present invention also provides a method for detecting Bursaphelenchus xylophilus based on PRA-CRISPR / Cas12b, comprising the following steps:

[0016] (1) Extract genomic DNA from the sample to be tested;

[0017] (2) Using the genomic DNA described in step (1) as a template, perform an RPA reaction with the RPA reaction system in the above PRA-CRISPR / Cas12b kit to obtain an RPA reaction product;

[0018] (3) Using the RPA reaction product described in step (2) as a template, perform a CRISPR / Cas12b reaction with the CRISPR / Cas12b reaction system in the above PRA-CRISPR / Cas12b kit to obtain a CRISPR / Cas12b reaction product, and detect the fluorescence intensity;

[0019] Determine whether the sample to be tested contains Bursaphelenchus xylophilus according to the fluorescence change.

[0020] Optionally, before performing the CRISPR / Cas12b reaction, it includes the step of purifying the RPA reaction product using a DNA extraction reagent.

[0021] Optionally, in the RPA reaction system, the final concentrations of the upstream primer BX6-F and the downstream primer BX6-R are both 0.48 μM; the temperature of the RPA reaction is 39 °C and the time is 30 min.

[0022] Optionally, in the CRISPR / Cas12b reaction system, the final concentration of the AaCas12b protein is 0.1 - 0.2 μM; the molar ratio of the AaCas12b protein to the sgRNA is 1:0.5 - 1.

[0023] Optionally, the final concentration of ssDNA in the CRISPR / Cas12b reaction system is 1 - 5 μM.

[0024] Optionally, the temperature of the CRISPR / Cas12b reaction is 45 - 55 °C, and the time is 15 - 30 min.

[0025] The present invention discloses the following technical effects:

[0026] The present invention establishes a method for detecting Bursaphelenchus xylophilus based on the PRA-CRISPR / Cas12b reaction, which solves the problem of difficult and inaccurate identification of Bursaphelenchus xylophilus. The present invention designs specific RPA primers for Bursaphelenchus xylophilus and specific sgRNA sequences that bind to CRISPR / Cas12b. The DNA of Bursaphelenchus xylophilus is amplified using the specific RPA primers, and then the detection signal is amplified using the CRISPR / Cas12b technology. By optimizing the addition amounts of AaCas12b protein, sgRNA, and reporter molecule during the detection process, the sensitivity is greatly improved. The method of the present invention can obtain detection results in a relatively short time. The detection process is easy to control at a constant temperature, the operation is simple and easy to implement, has high sensitivity and specificity, and the lowest detection limit is 1.536×10 - 4 ng / μL, and can be used for the rapid inspection of Bursaphelenchus xylophilus in biological quarantine, with great application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0028] Figure 1 is the screening result of sgRNA for Bursaphelenchus xylophilus; NC is the blank control (water);

[0029] Figure 2 is the screening result of the CRISPR-Cas12b reaction temperature; NC is the blank control (water);

[0030] Figure 3 is the optimization result of the ratio of AaCas12b protein to sgRNA in the CRISPR-Cas12b reaction system; NC is the blank control (water);

[0031] Figure 4Optimization results of the reporter molecule ssDNA concentration in the CRISPR-Cas12b reaction system; Concentrations 1-5 represent 0.1 μM, 0.5 μM, 1 μM, 2 μM, and 5 μM respectively, and NC is the blank control (water);

[0032] Figure 5 Optimization results of the CRISPR-Cas12b reaction time; NC is the blank control (water);

[0033] Figure 6 Sensitivity detection results of the basic RPA method; M is the Marker, and 1-7 are 1.536×10 2 ng / μL, 1.536×10 1 ng / μL, 1.536×10 0 ng / μL, 1.536×10 -1 ng / μL, 1.536×10- 2 ng / μL, 1.536×10 -3 ng / μL, 1.536×10 -4 ng / μL, and NC is the blank control (water);

[0034] Figure 7 Sensitivity detection results of the RPA-CRISPR-Cas12b fluorescence method; 1-7 are 1.536×10 2 ng / μL, 1.536×10 1 ng / μL, 1.536×10 0 ng / μL, 1.536×10 -1 ng / μL, 1.536×10- 2 ng / μL, 1.536×10 - 3 ng / μL, 1.536×10 -4 ng / μL, and NC is the blank control (water);

[0035] Figure 8 Specificity detection results of the RPA-CRISPR-Cas12b fluorescence method; NC is the blank control (water). Detailed implementation manners

[0036] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0037] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0038] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0039] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0040] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0041] Example 1

[0042] 1. Materials

[0043] 1.1 Test Samples

[0044] The pine wood nematode numbered B00130 is preserved by the Institute of Plant Quarantine, Chinese Academy of Inspection and Quarantine Sciences. Using a DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), the DNA of the test nematode strain was extracted, and the detected concentration was 153.6 ng / μL. As a DNA template, it was stored frozen at -20°C for later use.

[0045] 1.2 Reagents and Instruments

[0046] (1) Reagents

[0047] DNA Isothermal Amplification Kit (TwistAmpTM Basic Kit); DNAsecure New Plant Genomic DNA Extraction Kit (Tiangen DP320-03); 10×AaCas12b Buffer; AaCas12b; sgRNA; Enzyme-Free Water

[0048] (2) Instruments

[0049] Coyote Mini Heating and Cooling Metal Bath Pad3-H; DYY-11 Electrophoresis Apparatus (Beijing Liuyi Instrument Factory); Multifunctional Chemiluminescence Imager (Gene Co., Ltd. - BG-720); Centrifuge (Sigma1-14); Nucleic Acid Concentration Detector (NanoDrop Technology); LightCycler480 Real-Time Fluorescent PCR Instrument (Roche, Switzerland); Table Lamp-Type High-Intensity Ultraviolet Lamp for Experiments (Luyang 3410RB).

[0050] 2. Experimental Methods

[0051] 2.1 Basic RPA Reaction

[0052] Configure the RPA reaction system according to the TwistAmpTM Basic Kit instructions: First, inject 29.5 μL of Primer Free Rehydration Buffer into the dry powder reaction tube, then add 2.4 μL of the upstream primer (10 μM) and downstream primer (10 μM) to each reaction tube respectively. Subsequently, add 2 μL of the DNA template and 11.2 μL of double-distilled water. Finally, add 2.5 μL of Buffer B and mix well. After mixing, centrifuge the reaction solution instantaneously to the bottom of the tube and place it in a 39°C metal bath for incubation reaction for 30 min.

[0053] Upstream primer BX6-F: TTCTGCACGTTGTGACAGTCGTCTCGCATT (SEQ ID NO.1);

[0054] Downstream primer BX6-R: CGAAGCCCTCTCGCCCCGCACGGACAAACA (SEQ ID NO.2).

[0055] Product purification: After the reaction, add the reaction product 1:1 to the DNA extraction reagent (Tris-saturated phenol:chloroform:isoamyl alcohol ratio is 25:24:1), mix well and centrifuge at 12,000 rpm for 5 min to obtain the basic RPA product. Subsequently, perform electrophoresis detection.

[0056] 2.2 Design of sgRNA

[0057] The sgRNA used in the present invention was synthesized and manufactured by Xunshi Biotechnology Co., Ltd., and its sequence is shown in Table 1.

[0058] Table 1 sgRNA sequences of Bursaphelenchus xylophilus

[0059]

[0060] 2.3 Configuration of the PRA-CRISPR / Cas12b system

[0061] The initial CRISPR-Cas12b reaction system was 50 μL, as shown in Table 2.

[0062] Table 2 CRISPR-Cas12b reaction system

[0063] Reagent Name Volume (μL) Final Concentration AaCas12b (2.5 μM) 2 0.1 μM sgRNA (100 ng / μL) 1 0.1 μM 10x AaCas12b Buffer 5 1x CRISPR ssDNA Reporter (12b-FAM) (100 μM) 0.5 1 μM Purified RPA Amplification Product 1 <![CDATA[RNase-free ddH2O]]> Make up to 50 μL

[0064] Note: Reporter ssDNA: FAM-TTTTTTT-BHQ1.

[0065] 2.4 Reaction conditions

[0066] The initial reaction temperature was 43 °C; FAM fluorescence signals were collected once per minute for continuous detection for 30 min.

[0067] 2.5 Screening of sgRNA

[0068] Using the three sgRNAs designed in Table 1, CRISPR-Cas12b detection was carried out according to the reaction system in Table 2, with water as the blank control, and the sgRNA with the best effect was screened according to the detection results.

[0069] 2.6 Screening of CRISPR-Cas12b reaction temperature

[0070] On the basis of the screening results in 2.5, five different reaction temperatures were set, namely 40 °C, 45 °C, 50 °C, 55 °C, and 60 °C, with water as the blank control, and CRISPR-Cas12b detection was carried out to select the optimal temperature according to the test results.

[0071] 2.7 Optimization of the ratio of AaCas12b protein to sgRNA

[0072] On the basis of the screening results in 2.5 - 2.6, different molar ratios of AaCas12b protein to sgRNA were set as 1:0.5, 1:1, 1:2, 1:5, 1:10, with water as the blank control, and CRISPR-Cas12b detection was carried out to select the best ratio according to the detection results.

[0073] 2.8 Optimization of the concentration of reporter ssDNA

[0074] Based on the screening results in 2.5 - 2.7, the final concentrations of the reporter ssDNA were adjusted to 0.1 μM, 0.5 μM, 1 μM, 2 μM, and 5 μM respectively. Using water as the blank control, CRISPR-Cas12b detection was carried out, and the optimal reporter concentration was screened according to the detection results.

[0075] 2.9 Optimization of the reaction time of the CRISPR-Cas12b system

[0076] Based on the screening results in 2.5 - 2.8, six reaction times were set, namely 3 min, 7 min, 11 min, 15 min, 19 min, and 23 min. Using water as the blank control, CRISPR-Cas12b detection was carried out, and the optimal reaction time was selected according to the test results.

[0077] 2.10 Sensitivity test of the basic RPA method and the RPA-CRISPR-Cas12b fluorescence detection system for Bursaphelenchus xylophilus

[0078] Based on the screening results in 2.5 - 2.9, the extracted DNA of Bursaphelenchus xylophilus was serially diluted 10-fold, and the lowest dilution concentration was 1.536×10 -5 ng / μL. 2 μL of DNA was taken as the template for each concentration gradient, and 3 replicates were set for each concentration gradient. Using water as the blank control, RPA-CRISPR / Cas12b detection was carried out, and the detection limits of the RPA method and the RPA-CRISPR / Cas12b fluorescence detection system were determined according to the detection results.

[0079] 2.11 Specificity test of the RPA-CRISPR-Cas12b fluorescence detection system for Bursaphelenchus xylophilus

[0080] Based on the screening results in 2.5 - 2.9, Bursaphelenchus xylophilus (numbers: B00103, B00105, B00116, B00130, B00142, B00160), Bursaphelenchus mucronatus (B00205), Bursaphelenchus doui (B00302), Bursaphelenchus conicaudatus (B00601), and Bursaphelenchus fraudulentus (B00701) preserved by the Institute of Plant Quarantine, Chinese Academy of Inspection and Quarantine were used as the test nematodes. The specific source information is shown in Table 3. Using water as the blank control, the specificity of the RPA-CRISPR / Cas12b reaction was tested, and the specificity was determined according to the detection results.

[0081] Table 3 Numbers and sources of the test nematodes

[0082] Serial Number Accession Number Name Source Location 1 B00103 Bursaphelenchus xylophilus Canada 2 B00105 Bursaphelenchus xylophilus USA 3 B00116 Bursaphelenchus xylophilus Spain 4 B00130 Bursaphelenchus xylophilus South Korea 5 B00142 Bursaphelenchus xylophilus Canada 6 B00106 Bursaphelenchus xylophilus Liaoning 7 B00205 Bursaphelenchus mucronatus Greece 8 B00302 Bursaphelenchus doui South Korea 9 B00601 Bursaphelenchus conicaudatus Ningbo 10 B00701 Bursaphelenchus fraudulentus Ningbo

[0083] 3. Results and analysis

[0084] 3.1 Screening of sgRNA

[0085] The fluorescence signals of RPA-CRISPR / Cas12b were detected using different sgRNAs respectively. The results are as Figure 1 shown. It can be seen that both sgRNA1 and sgRNA2 can detect relatively high fluorescence signals. The average peak starting time of sgRNA1 is 7.77, and the average peak starting time of sgRNA2 is 6.91. The fluorescence signal detected by sgRNA3 is relatively low, and it does not reach the plateau until the end of the reaction. Considering comprehensively, sgRNA2 with a lower average peak starting time was selected for subsequent experiments.

[0086] 3.2 Screening of CRISPR-Cas12b reaction temperature

[0087] The fluorescence signals of RPA-CRISPR / Cas12b were detected using sgRNA2 respectively. The results are as Figure 2 shown. When the reaction temperature is 45 °C, 50 °C, and 55 °C, it can enter the plateau phase and the curve is relatively smooth. At the reaction temperatures of 40 °C and 60 °C, it does not reach the plateau until the end of the reaction. Under the reaction conditions of 55 °C, the whole reaction enters the plateau phase in the shortest time and has the highest fluorescence value. To ensure the complete reaction of the experiment, considering comprehensively, the CRISPR-Cas12b reaction temperature was determined to be 55 °C.

[0088] 3.3 Optimization of the ratio of AaCas12b protein to sgRNA

[0089] To improve the detection effect on the samples, the fluorescence detection of CRISPR-Cas12b was carried out according to the ratios of AaCas12b protein to sgRNA set in 2.7 respectively. The results are as Figure 3 shown. When AaCas12b / sgRNA is 1:0.5, the detection effect is the best, the detected fluorescence value is relatively high, and it enters the plateau phase first. When AaCas12b / sgRNA is 1:1, the detection effect is also good, but it is relatively worse than 1:0.5. When AaCas12b / crRNA is 1:2, 1:5, and 1:10, it does not reach the plateau until the end of the reaction. Considering comprehensively, the ratio of AaCas12b protein to sgRNA of 1:0.5 was selected for subsequent experiments.

[0090] 3.4 Optimization of the concentration of the reporter molecule ssDNA

[0091] According to the concentration gradient of the reporter molecule ssDNA set in 2.8, the fluorescence signals of CRISPR-Cas12b were detected respectively. The results are as Figure 4As shown, when the concentration of the reporter molecule was 1 μM, 2 μM, and 5 μM, an obvious plateau appeared in the fluorescence signal, and the time to reach the plateau was the fastest when the concentration of the reporter molecule was 2 μM; when the concentration of the reporter molecule was 0.1 μM and 0.5 μM, the plateau was not reached until the end of the reaction. Considering comprehensively, the concentration of the reporter molecule was selected as 2 μM for subsequent experiments.

[0092] Based on the above experimental results, the optimized CRISPR-Cas12b reaction system is shown in Table 4.

[0093] Table 4 Optimized CRISPR-Cas12b reaction system

[0094] Reagent Name Volume (μL) Final Concentration AaCas12b (2.5 μM) 2 0.1 μM sgRNA (100 ng / μL) 0.5 0.05 μM 10x AaCas12b Buffer 5 1x CRISPR ssDNA Reporter (12b-FAM) (100 μM) 1 2 μM Purified RPA Amplification Product 1 <![CDATA[RNase free dH2O]]> Make up to 50 μL

[0095] 3.5 Optimization of the reaction time of the CRISPR-Cas12b system

[0096] According to the six reaction times set in 2.9, the optimal reaction time of the CRISPR-Cas12b system was screened out, and the results are as Figure 5 shown. Obvious fluorescence appeared in the products of the six reaction times under the irradiation of the excitation light source, while no fluorescence appeared in the blank control; the fluorescence intensities at 15 min, 19 min, and 23 min were significantly higher than those at 3 min, 7 min, and 11 min. After comprehensive consideration, 15 min with similar fluorescence intensity and the shortest time was selected as the optimal reaction time.

[0097] 3.6 Sensitivity test of the basic RPA method and the RPA-CRISPR-Cas12b fluorescence method detection system for Bursaphelenchus xylophilus

[0098] The extracted DNA of Bursaphelenchus xylophilus was diluted by 10-fold gradients, with concentrations of 1.536×10 2 -1.536×10 -4 ng / μL, and based on this as a template, basic RPA detection was carried out, with each sample repeated 3 times. The results are as Figure 6 shown. It can be seen that Bursaphelenchus xylophilus with concentrations of 1.536×10 2 -1.536×10 -2 ng / μL all had bands, indicating that the lowest detection limit of the basic RPA method was 1.536×10 - 2 ng / μL.

[0099] The extracted DNA of Bursaphelenchus xylophilus was diluted by 10-fold gradients, with concentrations of 1.536×10 2 -1.536×10 -4 ng / μL, and based on this as a template, RPA-CRISPR-Cas12b fluorescence method detection was carried out, with each sample repeated 3 times. The results are asFigure 7 As shown, it can be seen that pine wood nematodes with a concentration of 1.536×10 2 -1.536×10 -4 ng / μL all have fluorescence signals, indicating that the lowest detection limit of the RPA-CRISPR-Cas12b fluorescence method is 1.536×10 -4 ng / μL.

[0100] The above results show that the RPA-CRISPR-Cas12b fluorescence method has higher sensitivity than the conventional RPA method.

[0101] 3.7 Specificity test of the RPA-CRISPR-Cas12b fluorescence detection system for pine wood nematodes

[0102] Using the pine wood nematodes and other nematodes recorded in Table 3 as templates, the above-screened system configuration was used for detection. Each sample was repeated three times, and the fluorescence detection results were used to determine whether the detection method used was specific. The results are as Figure 8 shown. It can be seen that obvious amplification curves can be observed for the pine wood nematode population, while no amplification curves can be observed for other nematode populations and the blank control.

[0103] The above results show that the RPA-CRISPR-Cas12b fluorescence detection method of the present invention has strong specificity.

[0104] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A sgRNA for detecting pine wood nematodes, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

4.

2. An RPA primer set for detecting pine wood nematodes, characterized in that: The RPA primer set includes an upstream primer BX6-F as shown in SEQ ID NO.1 and a downstream primer BX6-R as shown in SEQ ID NO.

2.

3. Use of the sgRNA according to claim 1 and the RPA primer set according to claim 2 in preparing a pine wood nematode detection product based on PRA-CRISPR / Cas12b, characterized in that: The product comprises a reagent or a kit.

4. A PRA-CRISPR / Cas12b kit for detecting pine wood nematodes, characterized in that: The PRA-CRISPR / Cas12b kit comprises an RPA reaction system and a CRISPR / Cas12b reaction system; The RPA reaction system comprises the RPA primer set according to claim 2; The CRISPR / Cas12b reaction system comprises the sgRNA according to claim 1.

5. The PRA-CRISPR / Cas12b kit according to claim 4, characterized in that The CRISPR / Cas12b reaction system also includes AaCas12b protein and ssDNA; the ssDNA is FAM-TTTTTTT-BHQ1.

6. A method for detecting pine wood nematodes based on PRA-CRISPR / Cas12b, characterized in that: The steps include: (1) Extracting genomic DNA from the sample to be tested; (2) using the genomic DNA described in step (1) as a template, performing an RPA reaction using the RPA reaction system in the PRA-CRISPR / Cas12b kit described in claim 4 or 5 to obtain an RPA reaction product; (3) using the RPA reaction product described in step (2) as a template, performing a CRISPR / Cas12b reaction using the CRISPR / Cas12b reaction system in the PRA-CRISPR / Cas12b kit described in claim 4 or 5 to obtain a CRISPR / Cas12b reaction product, and detecting the fluorescence intensity; Whether the sample to be tested contains pine wood nematodes is determined according to the fluorescence change.

7. The pine wood nematode detection method according to claim 6, characterized in that: In the RPA reaction system, the final concentrations of the upstream primer BX6-F and the downstream primer BX6-R were both 0.48 μM; the temperature of the RPA reaction was 39° C., and the reaction time was 30 min.

8. The pine wood nematode detection method according to claim 6, characterized in that: The final concentration of the AaCas12b protein in the CRISPR / Cas12b reaction system is 0.1-0.2 μM; the molar ratio of the AaCas12b protein to the sgRNA is 1:0.5-1.

9. The pine wood nematode detection method according to claim 6, characterized in that: The final concentration of ssDNA in the CRISPR / Cas12b reaction system is 1-5 μM.

10. The pine wood nematode detection method according to claim 6, characterized in that: The temperature of the CRISPR / Cas12b reaction is 45-55°C and the reaction time is 15-30 minutes.

Images