Fluorescent quantitative PCR (Polymerase Chain Reaction) primer group, kit and method for detecting aeromonas bacteria and application

By designing a specific fluorescence quantitative PCR primer set, the detection of Aeromonas bacteria was solved, and the problem of low detection sensitivity and inability to cover all kinds of species in the prior art was solved, high sensitivity and strong specificity were achieved, and the abundance of Aeromonas bacteria and the risks of the aquaculture environment were predicted, which significantly improved the timeliness and effect of disease prevention and control.

CN120193103APending Publication Date: 2025-06-24JIANGXI PROVINCIAL FISHERIES SCI RES INST (JIANGXI PROVINCIAL POYANG LAKE FISHERY RES CENT JIANGXI PROVINCIAL FISHERY RESOURCES ECOLOGICAL ENVIRONMENT MONITORING CENT)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510267821.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The prior art cannot effectively detect all kinds of bacteria in Aeromonas, and the detection sensitivity is low, so it cannot cover the prediction of Aeromonas bacterial abundance and risk classification of water aquaculture environment.

Method used

By comparing and screening, Aer-CF1 was obtained as a target, a specific fluorescence quantitative PCR primer set was designed, and the detection method was constructed to achieve high sensitivity, strong specificity and high repeatability detection for Aer-Mobile bacteria, and to predict the abundance of Aer-Mobile bacteria in water.

Benefits of technology

High sensitivity detection of Aeromonas bacteria is achieved, and the entire process from water sample collection to result analysis can be completed within 2 hours, significantly improving timeliness, reducing the incidence of diseases, and providing targeted hierarchical management strategies to ensure the ecological health of the water body.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193103A_ABST
    Figure CN120193103A_ABST
Patent Text Reader

Abstract

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) primer group, a kit, a method and application for detecting aeromonas bacteria. Belongs to the technical field of gene detection. According to the A6-f / A-r primer group, the kit and the detection method, a sequence fragment Aer-CF1 contained in each aeromonas is obtained through sequence alignment, the A6-f / A-r primer group, the kit and the detection method are designed by utilizing the fragment through gene alignment and screening an area with conservative property greater than 99%, the aeromonas bacteria can be effectively detected, and the detection sensitivity of a bacterial liquid can reach 7.7 cfu / mL. The method is high in specificity and repeatability, can be used for accurately identifying the aeromonas in a water body sample, can accurately quantify the abundance threshold of the aeromonas in the aquaculture water body, establishes a water body risk classification system based on flora dynamics, detects the CT value, classifies the water body risk, and determines the water body risk according to the water body risk classification. And a management strategy is deployed and controlled, so that the aquaculture industry is helped to transform to a green and efficient direction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and more particularly to a fluorescent quantitative PCR primer set, a kit, a method and an application for detecting Aeromonas bacteria. Background Art

[0002] Aeromonas is a gram-negative bacillus belonging to the class Gammaproteobacteria, order Aeromonadales, and family Aeromonadaceae. This genus has strong adaptability to various environments and is widely distributed in various ecosystems, particularly in aquatic environments such as rivers, lakes, ponds, and estuaries. As a major pathogen in aquaculture, particularly freshwater aquaculture, Aeromonas can cause a variety of acute and chronic infectious diseases, including red skin disease, enteritis, sepsis, and ulcers. These diseases not only severely impact fish health and growth but also cause significant economic losses. Rapid and accurate identification of Aeromonas in water samples is crucial for diagnosing and monitoring the spread of aquaculture diseases. Initial screening of samples using nucleic acid amplification technology, followed by isolation and culture of positive specimens, can significantly improve detection efficiency and reduce workload. Therefore, the development of a highly sensitive nucleic acid amplification screening method for Aeromonas has important application value.

[0003] Currently, 36 species of Aeromonas have been identified, primarily including Aeromonas caviae, Aeromonas sobria, Aeromonas salmonicida, Aeromonas dhakensis, Aeromonas veronii, and Aeromonas hydrophila. Existing technologies for Aeromonas detection mostly focus on specific Aeromonas species, such as application number 200810122380.0, entitled "A Rapid Dual PCR Detection Kit and Method for Aeromonas and Aeromonas hydrophila." This patent targets two Aeromonas species, providing two sets of detection primers for detecting each. However, these existing technologies cannot cover the detection of all Aeromonas species within the genus Aeromonas, and their detection sensitivity is low.

[0004] Furthermore, current research has found that aquaculture risks are closely linked to the microbial community structure of water bodies. Aeromonas, a conditionally pathogenic bacterium, often poses a risk to the aquaculture industry when its abundance increases abnormally. Real-time monitoring of population changes in this genus can identify environmental risks in advance, which is crucial for safeguarding the ecological health of aquaculture waters. However, currently, no technology exists to predict Aeromonas abundance and classify aquatic aquaculture risk.

[0005] Therefore, how to provide a fluorescent quantitative PCR primer set and its application that can cover the detection of all bacteria in the genus Aeromonas and effectively analyze the abundance of Aeromonas bacteria in the water environment with high detection sensitivity, strong specificity and good repeatability is a problem that technicians in this field urgently need to solve. Summary of the Invention

[0006] In light of this, the present invention provides a fluorescent quantitative PCR primer set, kit, method, and application for detecting Aeromonas bacteria. By using comparative screening to identify the conserved fragment Aer-CF1 of Aeromonas as a target, specific primers are designed to construct a detection method. This method utilizes a single primer set to effectively detect all Aeromonas bacteria, with high sensitivity, specificity, and reproducibility. Furthermore, the method can effectively predict the abundance of Aeromonas bacteria in water, monitor population changes of this genus in real time, and identify risks in aquaculture environments in advance.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A fluorescent quantitative PCR primer set for detecting Aeromonas bacteria, the sequence of the primer set is as follows:

[0009] A6-f: 5'-TGCCGAAGCCGTCAAGAA-3', SEQ ID NO.6;

[0010] Ar: 5'-TGGTGGTGGAGATGCTGAC-3', SEQ ID NO.7.

[0011] Another object of the present invention is to provide: a fluorescent quantitative PCR detection kit for detecting Aeromonas bacteria, comprising the above primer set.

[0012] Preferably, the fluorescent quantitative PCR detection kit further includes 2×AceQ Universal SYBR qPCR MasterMix.

[0013] Another object of the present invention is to provide a fluorescent quantitative PCR detection method for detecting Aeromonas bacteria for non-disease diagnosis and treatment, comprising the following steps:

[0014] (1) Extraction of DNA from test samples;

[0015] (2) performing fluorescent quantitative PCR amplification on the DNA template obtained in step (1) using the fluorescent quantitative PCR primer set to obtain an amplification curve;

[0016] The PCR amplification reaction system was as follows: 20 μL in total: 10 μL of 2× AceQ Universal SYBR qPCR Master Mix, 0.4 μL of forward primer, 0.4 μL of reverse primer, and 1 μL of DNA template, supplemented to 20 μL with ddH O;

[0017] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 1 min;

[0018] (3) Test result judgment criteria: When the CT value is ≤35, it is judged as positive; when the CT value is >35 or there is no CT value, it is judged as negative.

[0019] Another object of the present invention is to provide: use of the fluorescent quantitative PCR primer set or the kit or the detection method for detecting Aeromonas bacteria in detecting the abundance of Aeromonas bacteria.

[0020] Another object of the present invention is to provide: application of the fluorescent quantitative PCR primer set or the kit or the detection method for detecting Aeromonas bacteria in Aeromonas water risk classification.

[0021] Another object of the present invention is to provide: a method for classifying Aeromonas water body risks, using the above-mentioned fluorescent quantitative PCR primer set or the above-mentioned kit or the above-mentioned detection method to detect the abundance of Aeromonas bacteria in the water body, and classifying the water body risk according to the measured CT value.

[0022] Preferably, when the CT value of a single tested water body is ≤18, it is a high-risk water body; when 18≤CT value≤22, it is a medium-risk water body; and when the CT value is ≥22, it is a low-risk water body.

[0023] Another object of the present invention is to provide a hierarchical management strategy for Aeromonas in water bodies, which is based on the above-mentioned risk types and is specifically as follows:

[0024] Low risk: Regulating the balance of microflora through microecological preparations;

[0025] Medium risk: start the water circulation purification system;

[0026] High risk: Implement isolation, disinfection and preventive treatment.

[0027] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) The present invention establishes a fluorescent quantitative PCR primer set, kit, method and application for the detection of Aeromonas bacteria. By comparative screening, the conserved fragment Aer-CF1 of Aeromonas was obtained as a target, specific primers were designed, and a standard curve was constructed. The sensitivity, specificity and repeatability of the method were systematically evaluated, and it was applied to the detection of environmental water samples. The results showed that the method was effective at 7.7×10 0 ~7.7×10 7 The test showed good linearity within the cfu / mL range, with a detection sensitivity of up to 7.7 cfu / mL. Repeatability experiments demonstrated intra-group coefficients of variation of less than 1.68%. Specificity testing revealed that Ct values ​​were only detected for Aeromonas dakar, Aeromonas hydrophila, Aeromonas veseri, and Aeromonas caviae, while no Ct values ​​were detected for the other 13 test bacteria, including Citrobacter freundii, Citrobacter moorei, and Enterobacter fumigatus.

[0029] (2) The present invention can identify aquaculture environmental risks in advance by accurately monitoring the abundance threshold of pathogens, providing farmers with a critical intervention window, which is of great value in protecting the ecological health of aquaculture water bodies. At the same time, an early warning system based on bacterial community dynamics can be established based on the present invention. When the abundance of Aeromonas reaches the early warning threshold, ecological intervention measures such as probiotic regulation and water purification can be taken in a timely manner, which can reduce the incidence of diseases by more than 60%, significantly reduce the problem of antibiotic abuse, and help the aquaculture industry transform towards a green and efficient direction.

[0030] (3) This patent constructs a quantitative model for "Aeromonas abundance-disease risk" with a detection sensitivity of 7.7 CFU / mL. The entire process from water sample collection to result analysis can be completed within 2 hours. Compared with traditional bacterial culture methods (which require 48-72 hours), this significantly improves timeliness, gaining critical time for disease prevention and control.

[0031] (4) Based on the test results, farmers can adopt targeted hierarchical management strategies: Level 1 warning (low risk): regulating the balance of the bacterial flora through microecological preparations; Level 2 warning (medium risk): starting the water circulation purification system; Level 3 warning (high risk): implementing isolation, disinfection and preventive treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0033] Figure 1 As: Electrophoresis diagram of primer pair A6-f / A-rPCR;

[0034] Figure 2 As: Electrophoresis diagram of primer pair A3-f / A-rPCR;

[0035] Figure 3 As: Electrophoresis diagram of primer pair AV4-f / A-rPCR;

[0036] Figure 4 As: Electrophoresis diagram of primer pair AV6-f / A-rPCR;

[0037] Figure 5 As: Electrophoresis diagram of primer pair AD2-f / A-rPCR;

[0038] Figure 6 The sensitivity of nucleic acid conventional PCR in Example 3 is:

[0039] Figure 7 The standard curve established in Example 4 is:

[0040] in Figure 1-Figure 5 Lanes 1-23 correspond to the strain numbers in Table 1; lane M is DL2000 marker;

[0041] Figure 6 Lanes 1-8 correspond to different gradients of nucleic acid, 1 for 10 0 , 2 is 10 -1 , 3 is 10 -2 、4 is 10 -3 、5 is 10 -4 、6 is 10 -5 、7 is 10 -6 , 8 is 10 -7 , 9 is the negative control, and M is the DL2000 marker. DETAILED DESCRIPTION

[0042] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0043] The experimental reagents and instruments used in the examples of the present invention are as follows:

[0044] The reagents used mainly include: bacterial genomic DNA extraction kit: MiniBEST Bacteria Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, JAPAN).

[0045] PCR reaction reagents: Fluorescent quantitative PCR reaction reagent AceQ Universal SYBR qPCR Master Mix (Vazyme, CHINA).

[0046] The instruments included: qPCR gene amplification instrument (Jena Analytical Instruments Co., Ltd., Germany); gradient PCR instrument (Eppendorf AG, Germany); gel imaging analysis system (Bio-Rad, USA); and electrophoresis instrument (Beijing Liuyi Biotechnology Co., Ltd.).

[0047] The test strains used in the examples of the present invention are as follows:

[0048] The strains used in the examples were 23 strains of Aeromonas, and the details of the strains used are shown in Table 1. The strains used were stored in the Aquatic Animal Nutrition and Disease Control Laboratory of Jiangxi Fishery Science Research Institute.

[0049] Table 1 Strain information

[0050]

[0051]

[0052] Example 1

[0053] Primer design and synthesis

[0054] First, using the core gene libraries of common Aeromonas species in the NCBI database, such as Aeromonas hydrophila, Aeromonas veseri, Aeromonas daka, and Aeromonas caviae, a bioinformatics sequence alignment was performed to obtain a fragment with a conserved sequence in all Aeromonas species, a similarity greater than 98.5%, and an appropriate base pair length (approximately 300 bp). This fragment was named Aer-CF1, and its sequence is shown below: Aer-CF1:

[0055] 5'-CTGGTCAAGAAAGGCGAGATGAACTTCGACGTAGTTATCGCATCCCCGGATGCC ATGCGCGTTGTTGGTCAGCTGGGTCAAATCCTGGGCCCGCGCGGTCTGATGCCGAACCCGAAAGTTGGTACTGTAGCTCCTAACGTTGCCGAAGCCGTCAAGAACGCCAAGGCTGGTCAGGTCCGTTACCGTAATGACAAGAACGGTAT CATTCACACCACCCTGGGCAAGGTTTCTTTCCAACGAAGTTCAGCTGAAAGAAAGCTTGGAAGCTCTGCTGGTTGCCCTGAAAAAGGCCAAGCCGTCTTCCGCCAAGGGTGTATTCATCAAGAAAGTCAGCATCTCCACCACCA-3', SEQ ID NO.1.

[0056] Then, we screened the NCBI database for known Aeromonas Aer-CF1 fragments using blast comparison. We downloaded these fragments locally and selected five fragments for each bacterium. Using these fragments, we identified regions with greater than 99% conservation through gene alignment. Five pairs of upstream and downstream primers were designed and submitted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The primer sequences are shown in Table 2.

[0057] Table 2 Primer sequence information

[0058]

[0059] Example 2

[0060] Primer specificity screening

[0061] The strains listed in Table 1 were used as test strains, and a conventional PCR method was used to extract bacterial DNA using a kit. The bacterial DNA was used as a template to test the specificity of the primers listed in Table 2.

[0062] The reaction system was 25 μL, composed of 12.5 μL of 2×PCR Mix (Thermo Fisher), 1 μL of upstream primer, 1 μL of downstream primer, 9.5 μL of ddH 2 O, and 1 μL of DNA template.

[0063] The PCR reaction conditions were: 94°C pre-denaturation for 4 minutes, followed by 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 1 minute. After 35 cycles, 5 μL of the PCR product was electrophoresed on a 1.2% agarose gel. The experimental results are shown in the figure. Figure 1-Figure 5 shown.

[0064] Result analysis: From Figure 1-Figure 5 As can be seen, primer pair A6-f / Ar amplifies a single target band of 206 bp for all Aeromonas bacteria. No bands were amplified for other bacteria. Other primer pairs were less specific or amplified multiple bands. This indicates that primer pair A6-f / Ar amplifies Aeromonas with strong specificity and an appropriate fragment size, making it suitable as a candidate primer for fluorescent quantitative PCR of Aeromonas.

[0065] Example 3:

[0066] Ordinary PCR nucleic acid sensitivity test

[0067] Based on the primer set A6-f / Ar of Example 2, sensitivity testing of conventional PCR was performed as follows:

[0068] (1) Preparation of nucleic acid gradient concentration: The Aeromonas DNA in Table 1 was extracted using the kit and the DNA concentration was 25.418 ng / μL as determined by micro-spectrophotometer. After 10-fold gradient dilution, 10 -1 , 10 -2 , dilute to 10 -7 The gradient concentrations are: original DNA concentration is 25.418ng / μL, 10 -1 The gradient was 2.418 ng / μL, 10 -2 The gradient is 2.418×10 -1 ng / μL, 10 -3 The gradient is 2.418×10 -2 ng / μL, 10 -4 The gradient is 2.418×10 -3 ng / μL, 10 -5 The gradient is 2.418×10 -4 ng / μL, 10 -6 The gradient is 2.418×10 -5 ng / μL, 10 -7 The gradient is 2.418×10 -6 ng / μL;

[0069] (2) Ordinary PCR amplification: take the above gradient 10 -1 -10 -5 PCR amplification reaction was performed using diluted nucleic acid as template and ddH2O as blank control template;

[0070] Reaction system: 25 μL, 2× PCR Mix 12.5 μL, upstream primer A6-f 1 μL, downstream primer Ar 1 μL, ddH2O 8.5 μL, DNA template 2 μL;

[0071] PCR reaction program: 94℃ pre-denaturation for 4 minutes, then 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles, and then extension reaction at 72℃ for 7 minutes. After the reaction is completed, 5μL of PCR product was electrophoresed on 1.2% agarose gel. The experimental results are as follows Figure 6 As shown;

[0072] Result analysis: Figure 6 As shown, 10 -5 Gradient concentrations and above can show very clear bands, 10 -6 Gradient concentrations can also show faint bands. Therefore, the sensitivity of this primer set for detecting nucleic acids in conventional PCR is 2.418×10 -5 ng / μL.

[0073] Example 4

[0074] Establishment of standard curve and sensitivity test of bacterial solution for fluorescence quantitative PCR detection method

[0075] A fluorescent quantitative PCR detection method for detecting Aeromonas bacteria comprises the following steps:

[0076] (1) For the Aeromonas culture in Table 1, adjust the bacterial solution concentration to be consistent, mix evenly, and perform 10-fold dilution to obtain 11 dilution gradients (10 0 ~10 10 ) samples, using the MiniBEST Bacteria Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, JAPAN) kit to extract nucleic acid DNA of various concentrations as DNA templates;

[0077] (2) The DNA template obtained in step (1) was subjected to fluorescence PCR detection using primer set A6-f / Ar (the test was repeated three times with the same gradient setting). A standard curve was prepared with the logarithm of the number of Aeromonas strains as the horizontal axis and the Ct value as the vertical axis. The minimum detection limit, amplification efficiency (E) and correlation coefficient (R) of the method were obtained. 2 ), the experimental results are shown in Table 3 and Figure 7 shown.

[0078] The PCR amplification reaction system was as follows: 20 μL in total: 10 μL of 2× AceQ Universal SYBR qPCR Master Mix, 0.4 μL of forward primer, 0.4 μL of reverse primer, and 1 μL of DNA template, supplemented to 20 μL with ddH O;

[0079] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and 72°C for 1 min, for 40 cycles.

[0080] Table 3 Sensitivity test results

[0081]

[0082]

[0083] Result analysis: Standard curve of fluorescence PCR reaction: y = -3.0366x + 37.826 ( Figure 6 , Table 3). Figure 6 , Table 3 shows that at 7.7×10 0 ~7.7×10 7 cfu / mL concentration range, E = 1.1, R 2 =0.9981, showing a good linear relationship, and E=1.1 meets the requirement (0.9-1.1), and the detection sensitivity can reach 7.7 cfu / mL.

[0084] Example 5

[0085] Specificity test

[0086] The nucleic acid samples of Aeromonas dakar, Aeromonas veseri, Aeromonas hydrophila, and other 15 other common aquatic pathogens, including Citrobacter freundii and Pseudomonas ayutans, were selected as templates for specific detection. Three replicates were tested for each strain. The experimental results are shown in Table 4:

[0087] Table 4 Specificity test results

[0088]

[0089]

[0090]

[0091] Note: “—” indicates that the Ct value was not detected

[0092] Results: As shown in Table 4, only Aeromonas dakar, Aeromonas hydrophila, Aeromonas veseri, and Aeromonas caviae had Ct values ​​detected, while the remaining test strains, including Citrobacter freundii, Citrobacter mossii, Enterobacter fumigatus, Pseudomonas ayusi, Pseudomonas alkylans, Pseudomonas licheniformis, Serratia marcescens, Serratia rubrum, Salmonella enterica, Pectobacterium pectinatum, Pantoea ananatum, Luckia nondecarboxylans, and Pantoea agglomerans, had no Ct values ​​detected. These results indicate that the method established in this study has good specificity.

[0093] Example 6

[0094] Repeatability test

[0095] Using the mixed bacterial solution of Aeromonas, intra-group repeatability tests were performed on nucleic acid samples with three dilution gradients. Each group was tested 10 times. The experimental results are shown in Table 5.

[0096] Table 5 Repeatability test results

[0097]

[0098] Result analysis: The results of the repeatability test (Table 5) showed that the three concentration gradients (7.7×10 6 ~7.7×10 4 The intra-group coefficient of variation of the fluorescence quantitative PCR detection results of the samples with a concentration of 100 cfu / mL was less than 2%, indicating that the established method had good reproducibility.

[0099] Example 7

[0100] Environmental sample testing

[0101] Water samples were collected from aquaculture water bodies in Yongxiu County (YXAu) and Ruijin City (RJWi) in Jiangxi Province, stored at low temperatures, and transported back to the laboratory. After sedimentation, the supernatant was vacuum filtered through a 0.22 μm polyethersulfone membrane. The filtered membrane was placed in a 5 mL centrifuge tube and rapidly frozen in liquid nitrogen for 3–5 minutes before being transferred to a -80°C ultra-low temperature freezer. The filtered membrane was sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for high-throughput sequencing to analyze the microbial community structure. After sequencing, the returned nucleic acid samples were analyzed using a newly established fluorescence quantitative PCR method for Aeromonas. The results are shown in Table 6.

[0102] Table 6 Fluorescence quantitative PCR test results of environmental samples

[0103]

[0104] Result analysis: The water sample test results showed (Table 6): There was a good linear relationship between the fluorescence quantitative PCR results and the environmental microbial high-throughput sequencing results. The CT value was around 20, indicating that the abundance of Aeromonas in the environmental sample was When the CT value is around 30, it means that the abundance of Aeromonas in the environmental sample is the following.

[0105] Example 8

[0106] Testing for Aeromonas in diseased ponds, healthy control ponds, and water sources. Water samples were collected from the pond with an outbreak of Aeromonas vernix (T group), the healthy control pond (PC group), and the water source pond (NC group). High-throughput sequencing and quantitative PCR were performed on the environmental samples according to the methods in Example 6. Results: OTU abundance information was obtained for each sample group, from which the relative abundance of Aeromonas was determined. The results are shown in Table 7.

[0107] Table 7 Aeromonas detection in diseased ponds, healthy control ponds and water sources

[0108]

[0109] Results: High-throughput sequencing results showed that there were 5 species of Aeromonas bacteria at the species level, of which 1 was identified as Aeromonas viridis, and the other 4 were classified as unclassified at the species level. The average abundance of Aeromonas in each group in this study was as follows: Healthy Group The water source group had a mean CT value of 0. The diseased group had a mean CT value of 20.25 ± 0.87, the healthy group had a mean CT value of 33.87 ± 0.36, and the water source group had a mean CT value of 39.44 ± 0.75. This indicates that a Ct value of 20 can be used as an early warning indicator for the occurrence of Aeromonas disease in water quality. A Ct value of 18-22 indicates medium risk, below 18 indicates high risk, and above 22 indicates low risk. Based on the test results, targeted tiered management strategies are provided:

[0110] Level 1 warning (low risk): Regulate the balance of the microbiome through microecological preparations;

[0111] Level 2 warning (medium risk): Activate the water circulation purification system;

[0112] Level 3 warning (high risk): Implement isolation, disinfection and preventive treatment.

[0113] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0114] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A fluorescent quantitative PCR primer set for detecting Aeromonas bacteria, characterized in that: The sequence of the primer set is as follows: A6-f: 5'-TGCCGAAGCCGTCAAGAA-3', SEQ ID NO.6; Ar: 5'-TGGTGGTGGAGATGCTGAC-3', SEQ ID NO.

7.

2. A fluorescent quantitative PCR detection kit for detecting Aeromonas bacteria, characterized in that: Comprising the primer set according to claim 1.

3. The fluorescent quantitative PCR detection kit for detecting bacteria of the genus Monospermum according to claim 2, characterized in that: Also included is 2× AceQ Universal SYBR qPCR MasterMix.

4. A fluorescent quantitative PCR detection method for detecting Aeromonas bacteria for non-disease diagnosis and treatment, characterized in that: The steps include: (1) Extraction of DNA from test samples; (2) using the fluorescent quantitative PCR primer set described in claim 1 to perform fluorescent quantitative PCR amplification on the DNA template obtained in step (1) to obtain an amplification curve; The PCR amplification reaction system was as follows: 20 μL in total: 10 μL of 2×AceQ Universal SYBR qPCR Master Mix, 0.4 μL of forward primer, 0.4 μL of reverse primer, 1 μL of DNA template, supplemented to 20 μL with ddH2O; The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and 72°C for 1 min, for 40 cycles; (3) Test result judgment criteria: When the CT value is ≤35, it is judged as positive; when the CT value is greater than 35 or there is no CT value, it is judged as negative.

5. Use of the fluorescent quantitative PCR primer set according to claim 1, the kit according to any one of claims 2-3, or the detection method according to claim 4 in detecting the abundance of Aeromonas bacteria.

6. Use of the fluorescent quantitative PCR primer set of claim 1, the kit of any one of claims 2-3, or the detection method of claim 4 in the risk classification of Aeromonas water bodies.

7. A method for classifying Aeromonas water risk, characterized in that: The abundance of Aeromonas bacteria in water bodies is detected using the fluorescent quantitative PCR primer set described in claim 1, the kit described in any one of claims 2-3, or the detection method described in claim 4, and the water body risk is classified according to the measured CT value.

8. The method according to claim 7, characterized in that When the CT value of a single tested water body is ≤18, it is a high-risk water body; when the CT value is 18≤≤22, it is a medium-risk water body; when the CT value is ≥22, it is a low-risk water body.

9. A hierarchical management strategy for Aeromonas in water, characterized in that: Based on the risk types described in claim 8, water body classification management is carried out as follows: Low risk: Regulate the balance of bacterial flora through microecological preparations; Medium risk: start the water circulation purification system; High risk: Implement isolation, disinfection and preventive treatment.

Citation Information

Patent Citations

  • Rapid detection kit of Aeromonas and Aeromonas hydrophila by double PCR and detection method

    CN101736073B