Multiplex PCR primer and probe composition for detecting microorganisms, kit and method thereof

Abstract

The invention provides a composition of multiple PCR primers and probes for detecting microorganisms, a kit and a method thereof. The composition comprises 10 pairs of primers and 10 corresponding probes for staphylococcus aureus, salmonella, pseudomonas aeruginosa, clostridium tetani, citrobacter freundii, stenotrophomonas maltophilia, burkholderia cepacia, klebsiella pneumoniae, candida albicans and escherichia coli, the 10 pairs of primers are as shown in SEQ ID No.1-20, and the 10 probes are as shown in SEQ ID No.21-30. The invention further discloses a kit for detecting the staphylococcus aureus, the salmonella, the pseudomonas aeruginosa, the clostridium tetani, the citrobacter freundii, the stenotrophomonas maltophilia, the burkholderia cepacia, the klebsiella pneumoniae, the candida albicans and the escherichia coli. The composition of the primer and the probe is used for detecting microorganisms through multiple PCR, operation is easy and convenient, and the detection accuracy rate is high.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a composition of multiplex PCR primers and probes for detecting microorganisms, a kit and a method thereof. Background Art

[0002] Most cosmetics contain rich nutrients, which are suitable for the growth and reproduction of microorganisms and are very likely to cause microbial contamination. Excessive microbial contamination in cosmetics poses a potential safety hazard to consumers, so the detection of cosmetic microorganisms is an important indicator for measuring the quality of cosmetics.

[0003] Traditional agar plate culture combined with biochemical identification is the gold standard for cosmetic microbial testing. However, the traditional method faces many defects: microbial isolation and culture takes a long time, and biochemical testing also relies on microbial growth reactions, so the testing cycle is long, usually taking 4-5 days; a large amount of solid and liquid culture media must be prepared during the process, which is cumbersome; the operation is complicated; and the biochemical reagents are expensive.

[0004] Molecular biological technologies such as multiplex PCR and real-time fluorescence quantification based on PCR technology are being promoted in the cosmetic microbial detection market due to their good specificity, high sensitivity and rapid detection. However, the detection throughput of the above technologies is still limited, and at most 6 microorganisms can be detected simultaneously. In addition, multiplex PCR relies on gel electrophoresis detection, which is time-consuming and has limited reliability. The DNA stain used in the detection has potential hazards to the environment and human body.

[0005] Biological DNA chips or second-generation sequencing can also achieve the goal of detecting ten types of microorganisms at the same time, but the detection cost is high.

[0006] The development of technology for rapid and simultaneous detection of more than six types of microorganisms will make cosmetic microbial testing more convenient and provide better technical support for the biosafety of cosmetics. This is a technical problem that needs to be urgently addressed in this field. Summary of the invention

[0007] An object of the present invention is to provide a composition of multiplex PCR primers and probes for detecting microorganisms.

[0008] Another object of the present invention is to provide a kit of multiplex PCR primers and probes for detecting microorganisms.

[0009] Another object of the present invention is to provide a method for multiplex PCR detection of microorganisms, which is used to detect Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans and Escherichia coli, and to determine whether a sample to be tested, such as cosmetics, is contaminated by these microorganisms.

[0010] On the one hand, the present invention provides a composition of multiplex PCR primers and probes for detecting microorganisms. Among them, the composition includes 10 pairs of primers and corresponding 10 probes (extended primers) targeting Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. The nucleotide sequences of the 10 pairs of primers are shown in SEQ ID No.1-20 respectively, and the nucleotide sequences of the 10 probes are shown in SEQ ID No.21-30 respectively.

[0011] There are many types of microorganisms that cause cosmetic contamination. The following ten microorganisms (Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli) are all categories of species that need to be detected. Nucleic acid mass spectrometry technology is a detection technology based on time-of-flight mass spectrometry, which can identify and distinguish different nucleic acid sequences by measuring the molecular weight of nucleic acid molecules, and has the advantages of large throughput, many detected genes and SNP sites, and being more comprehensive.

[0012] The present invention has developed a technology for rapidly detecting ten microorganisms simultaneously based on nucleic acid mass spectrometry, making the detection of cosmetic microorganisms more convenient, providing better technical support for the biological safety of cosmetics, and improving the detection efficiency and accuracy of cosmetic microorganism detection.

[0013] According to some specific embodiments of the present invention, in the composition of multiplex PCR primers and probes for detecting microorganisms of the present invention, the forward primer and reverse primer for detecting Staphylococcus aureus are shown in SEQ ID No.1-2, and the probe is shown in SEQ ID No.21;

[0014] The nucleotide sequences of the primers for Salmonella are shown in SEQ ID No.3 and SEQ ID No.4, and the probe is shown in SEQ ID No.22;

[0015] The nucleotide sequences of the primers for Pseudomonas aeruginosa are shown in SEQ ID No.5 and SEQ ID No.6, and the probe is shown in SEQ ID No.23;

[0016] The nucleotide sequences of the primers for Clostridium tetani are shown in SEQ ID No.7 and SEQ ID No.8, and the probe is shown in SEQ ID No.24;

[0017] The nucleotide sequences of the primers for Citrobacter freundii are shown in SEQ ID No. 9 and SEQ ID No. 10, and the probe has the sequence shown in SEQ ID No. 25;

[0018] The nucleotide sequences of the primers for Stenotrophomonas maltophilia are shown in SEQ ID No. 11 and SEQ ID No. 12, and the probe is shown in SEQ ID No. 26;

[0019] The nucleotide sequences of the primers for Burkholderia cepacia are shown in SEQ ID No. 13 and SEQ ID No. 14, and the probe is shown in SEQ ID No. 27;

[0020] The nucleotide sequences of the primers for Klebsiella pneumoniae are shown in SEQ ID No. 15 and SEQ ID No. 16, and the probe is shown in SEQ ID No. 28;

[0021] The nucleotide sequences of the primers for Candida albicans are shown in SEQ ID No. 17 and SEQ ID No. 18, and the probe is shown in SEQ ID No. 29;

[0022] The nucleotide sequences of the primers for Escherichia coli are shown in SEQ ID No. 19 and SEQ ID No. 20, and the probe is shown in SEQ ID No. 30.

[0023] The present invention also provides a kit for detecting microorganisms by multiplex PCR, wherein the kit comprises the composition of the multiplex PCR primers and probes for detecting microorganisms as described above.

[0024] According to some specific embodiments of the present invention, in the kit of the present invention, the kit further comprises at least one of Multiplex PCR Mix, water, SAP Buffer, SAP enzyme, and Extend Reaction Mix.

[0025] The present invention also provides a method for detecting microorganisms by multiplex PCR for non-diagnostic purposes, wherein the method comprises performing multiplex PCR amplification using the composition of the multiplex PCR primers and probes for detecting microorganisms as described above, and detecting whether Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and / or Escherichia coli are present in the sample to be tested.

[0026] According to some specific embodiments of the present invention, in the method of the present invention, the sample to be tested is a cosmetic, and the method comprises the following steps:

[0027] Multiplex PCR amplification: Prepare a multiplex PCR reaction system containing the above-mentioned 10 pairs of primers and the sample to be tested, and perform a multiplex PCR amplification reaction to obtain a PCR amplification reaction product;

[0028] SAP enzyme digestion reaction: Mix the PCR amplification reaction product with SAP Buffer, SAP enzyme, and water, and perform a SAP enzyme digestion reaction to obtain a SAP enzyme digestion reaction product;

[0029] Single-base extension reaction: Mix the SAP enzyme digestion reaction product with the above-mentioned probes to prepare a single-base extension reaction system, and perform a single-base extension reaction to obtain a single-base extension reaction product;

[0030] Mass spectrometry detection: The single-base extension reaction product is purified and centrifuged, and the supernatant obtained by centrifugation is taken for mass spectrometry detection to obtain a detection result.

[0031] According to some specific embodiments of the present invention, in the method of the present invention, in the multiplex PCR reaction system, the concentration of the sample to be tested is 1 ng / μL - 200 ng / μL, and the concentration of each primer is 0.1 μM - 0.4 μM; the reaction conditions for the multiplex PCR amplification are: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, with 40 cycles; final extension at 72°C for 5 minutes.

[0032] According to some specific embodiments of the present invention, in the method of the present invention, the reaction conditions for the SAP enzyme digestion reaction are: incubation at 37°C for 30 minutes, and enzyme inactivation at 85°C for 5 minutes.

[0033] According to some specific embodiments of the present invention, in the method of the present invention, in the single-base extension reaction system, the concentration of each probe is 0.5 μM - 1 μM, and the reaction conditions for the single-base extension reaction are: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, with 5 cycles, annealing at 52°C for 5 seconds and extension at 80°C for 5 seconds, with 40 cycles, and the total reaction of denaturation, annealing, and extension is cycled 40 times; final extension at 72°C for 3 minutes.

[0034] According to some specific embodiments of the present invention, in the method of the present invention, the cosmetic is lotion, emulsion, or cream, and the method further includes a process of pre-treating the cosmetic to obtain a cosmetic bacterial enrichment solution, and this process includes the steps:

[0035] Weigh the cosmetic sample aseptically, dilute it with physiological saline, inoculate it into SCDLP medium or cooked meat medium, extract DNA from the culture product, and control the DNA concentration of the DNA extraction product to be 1 ng / μL - 200 ng / μL for the multiplex PCR reaction system.

[0036] According to some specific embodiments of the present invention, in the method of the present invention, the addition volume of the resin purification solution in each reaction for mass spectrometry detection is 16 μL; the steps of the mass spectrometry detection are: dropping 0.5 μL of matrix in the middle of the target plate well, waiting for at least 5 min for sufficient drying, then adding 0.7 μL of the supernatant, waiting for 20 min until sufficient drying and crystallization, and then performing on-machine determination.

[0037] The technical solution of the present invention has the following beneficial technical effects:

[0038] Simple operation, high PCR multiplicity and transformation success rate: good results can be obtained for the detection of 10 - 50 multiple pathogens, and the maximum can reach 60 species.

[0039] High cost performance: simultaneously detecting 10 - 50 SNP sites, without fluorescence labeling, with the lowest consumable cost and sample usage. High accuracy: by designing primers and extension probes in both forward and reverse directions, specific genes of pathogenic bacteria can be effectively detected, with an accuracy rate of 100%.

[0040] High sample throughput: more than 3000 samples can be processed per day, with a throughput higher than qPCR.

[0041] High-quality data: automatically analyzing data, completing a pathogenic bacteria detection report, and giving a credibility analysis of the sample status and results obtained by mass spectrometry. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It is a schematic diagram of the experimental operation of the present invention.

[0043] Figure 2 It is the nucleic acid mass spectrometry diagram of Staphylococcus aureus, the positive control of the present invention.

[0044] Figure 3 It is the nucleic acid mass spectrometry diagram of Salmonella enterica, the positive control of the present invention.

[0045] Figure 4 It is the nucleic acid mass spectrometry diagram of Pseudomonas aeruginosa, the positive control of the present invention.

[0046] Figure 5 It is the nucleic acid mass spectrometry diagram of Clostridium tetani, the positive control of the present invention.

[0047] Figure 6 It is the nucleic acid mass spectrometry diagram of Citrobacter freundii, the positive control of the present invention.

[0048] Figure 7 It is the nucleic acid mass spectrometry diagram of Stenotrophomonas maltophilia, the positive control of the present invention.

[0049] Figure 8 It is the nucleic acid mass spectrometry diagram of Burkholderia cepacia, the positive control of the present invention.

[0050] Figure 9This is the nucleic acid mass spectrometry diagram of Klebsiella pneumoniae as the positive control of the present invention.

[0051] Figure 10 This is the nucleic acid mass spectrometry diagram of Candida albicans as the positive control of the present invention.

[0052] Figure 11 This is the nucleic acid mass spectrometry diagram of Escherichia coli as the positive control of the present invention.

[0053] Figure 12 This is the nucleic acid mass spectrometry diagram for the mixed detection of DNA templates of ten microorganisms.

[0054] Figure 13 This is the nucleic acid mass spectrometry diagram after the mixed amplification of B.cep-0F / B.cep-0R and nine other pairs of microorganism primers.

[0055] Figure 14 This is the nucleic acid mass spectrometry diagram after the mixed extension of the extension primer Salm-0Probe and other microorganism extension primers. Detailed implementation manners

[0056] For a clearer understanding of the technical features, objectives, and beneficial effects of the present invention, the technical solution of the present invention will be described in detail below, but it should not be construed as a limitation on the scope of implementation of the present invention.

[0057] Example 1

[0058] This example provides primers for multiplex PCR reactions and probes (extension primers) for single-base extension reactions for detecting multiple microorganisms in cosmetics. Specifically, the experimental operation schematic diagram is as Figure 1 shown:

[0059] Nucleic acid mass spectrometry technology is a detection technology based on time-of-flight mass spectrometry. It can identify and distinguish different nucleic acid sequences by measuring the molecular weights of nucleic acid molecules, and has the advantages of large throughput, many detected genes and SNP sites, and being more comprehensive.

[0060] The present invention uses nucleic acid mass spectrometry technology to specifically detect multiple microorganisms potentially contaminating cosmetics. In this example, specific primers are designed for Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. The specific primers include forward primers and reverse primers for multiplex PCR reactions, as well as extension primers for single-base extension reactions.

[0061] The information of the multiplex PCR primer set is shown in Table 1.

[0062] Table 1

[0063]

[0064] The information of the single-base extension primer sets is shown in Table 2.

[0065] Table 2

[0066]

[0067] Comparative Example 1

[0068] This comparative example provides primers for multiplex PCR reactions and probes (extension primers) for single-base extension reactions for detecting multiple microorganisms in cosmetics. Among them, the forward primer for the multiplex PCR reaction of Burkholderia cepacia was replaced with B.cep-0F, and its sequence is: ACGTTGGATGCCATGAACGTCGAYTAYCTYTT (SEQ ID No.31), and the reverse primer was replaced with B.cep-0R, and its sequence is ACGTTGGATGGAAAGTATAGCAATCTTTGAAG (SEQ ID No.32). The primer and probe sequences of the other 9 microorganisms are the same as those in Example 1.

[0069] Comparative Example 2

[0070] This comparative example provides primers for multiplex PCR reactions and probes (extension primers) for single-base extension reactions for detecting 7 microorganisms including Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Citrobacter freundii, Klebsiella pneumoniae, Candida albicans, and Escherichia coli in cosmetics. Among them, the extension primer of Salmonella was replaced with Salm-0Probe, and its sequence is CTTCTCATCGACAACCTAACTTC (SEQ ID No.33), the molecular weight before extension is 6878.5 Da, the extended base is G, and the molecular weight after extension is 7162.8 Da. The primer and probe sequences of the other 6 microorganisms are the same as those listed in Example 1.

[0071] Test Example

[0072] This test example provides a method for simultaneously detecting multiple cosmetic microorganisms, and determines the ability of the primer and probe compositions provided in Example 1, Comparative Example 1, and Comparative Example 2 to detect multiple cosmetic microorganisms. The experimental operation schematic diagram is as Figure 1 shown, and specifically includes the following steps:

[0073] I. Nucleic acid purification

[0074] (1) Sample type: contaminated cosmetics;

[0075] (2) Pre-enrichment: Weigh 10 g of the sample aseptically, dilute it 1:10 with normal saline, and aspirate two 10 mL aliquots of the 1:10 diluted sample homogenate. Inoculate one aliquot into 90 mL of SCDLP enrichment broth and incubate it in an incubator at 36 °C ± 1 °C for 24 hours. Inoculate the other aliquot into 90 mL of cooked meat medium and incubate it anaerobically at 36 °C ± 1 °C for 48 hours. At the same time, weigh 10 g of the sample and add it to 90 mL of SCDLP, and incubate it in an incubator at 30 °C ± 1 °C for 48 h to obtain 3 cultured samples.

[0076] (3) DNA extraction and purification: Mix the 3 cultured samples together, and use a lysis-type bacterial genomic DNA extraction kit (Yisheng Biotech Co., Ltd., 18806ES50) to extract DNA according to the instructions. Use a micro ultraviolet spectrophotometer (Thermo Fisher, A30221) to detect the DNA concentration, and any value within the range of 1 ng / μL - 200 ng / μL is acceptable.

[0077] II. Multiplex PCR amplification

[0078] Take out the multiplex PCR reaction reagent in the nucleic acid mass spectrometry general reagent (Beijing Xinhui Prue Biotechnology Co., Ltd., XH002) from -20 °C and melt it at room temperature. According to the actual number of samples, configure the PCR reaction system according to Table 3 and perform thermal cycling according to Table 4. The multiplex PCR amplification system is shown in Table 3.

[0079] Table 3

[0080]

[0081] The multiplex PCR reaction conditions are shown in Table 4.

[0082] Table 4

[0083]

[0084] III. Shrimp alkaline phosphatase (SAP) enzymatic digestion reaction

[0085] Take out the SAP reaction reagent in the nucleic acid mass spectrometry general reagent from -20 °C and melt it at room temperature. After the multiplex PCR reaction, configure the SAP reaction system, and the SAP reaction system is shown in Table 5.

[0086] Table 5

[0087]

[0088] The SAP reaction conditions are shown in Table 6.

[0089] Table 6

[0090]

[0091] IV. Single-base Extension Reaction

[0092] Take out the single-base extension reaction reagent in the nucleic acid mass spectrometry general reagent from -20°C and melt it at room temperature. After the SAP reaction is completed, set up the PCR single-base extension reaction system. The single-base extension reaction system is shown in Table 7.

[0093] Table 7

[0094]

[0095] The single-base extension reaction conditions are shown in Table 8.

[0096] Table 8

[0097]

[0098] V. Mass Spectrometry Detection

[0099] (1) Resin Purification

[0100] 1. Add resin purification solution: Vortex and mix the resin purification solution in the nucleic acid mass spectrometry general reagent, and add 18 μL to each reaction; since the resin tends to settle, vortex and mix it again every 5 seconds.

[0101] 2. Purification: Place the sample in a shaker and mix at 20 rpm for 30 min.

[0102] 3. Centrifugation: After completion, centrifuge at 2000 rpm for 1 min, and the supernatant is ready for testing.

[0103] (2) Spotting

[0104] Take out the matrix in the nucleic acid mass spectrometry general reagent, add 0.5 μL of the matrix dropwise in the middle of the well of the supporting target plate, wait for at least 20 min, and after thorough drying, add 0.7 μL of the supernatant, wait for at least 20 min, and after thorough drying and crystallization, perform the measurement on the machine.

[0105] Test Results:

[0106] Use the primer and probe composition in Example 1 to detect the DNA and DNA mixed samples of various strain cultures, and at the same time compare the test results with the sequencing results of the "gold standard". The positive controls for various strains (the positive control is the test result of the DNA sample of the detected bacteria) are as Figure 2-11 shown, Figure 2 which is the nucleic acid mass spectrometry diagram of Staphylococcus aureus, the positive control of the present invention; Figure 3 which is the nucleic acid mass spectrometry diagram of Salmonella, the positive control of the present invention; Figure 4 which is the nucleic acid mass spectrometry diagram of Pseudomonas aeruginosa, the positive control of the present invention; Figure 5The nucleic acid mass spectrometry diagram of Clostridium tetani, which is the positive control of the present invention; Figure 6 The nucleic acid mass spectrometry diagram of Citrobacter freundii, which is the positive control of the present invention; Figure 7 The nucleic acid mass spectrometry diagram of Stenotrophomonas maltophilia, which is the positive control of the present invention; Figure 8 The nucleic acid mass spectrometry diagram of Burkholderia cepacia, which is the positive control of the present invention; Figure 9 The nucleic acid mass spectrometry diagram of Klebsiella pneumoniae, which is the positive control of the present invention; Figure 10 The nucleic acid mass spectrometry diagram of Candida albicans, which is the positive control of the present invention; Figure 11 The nucleic acid mass spectrometry diagram of Escherichia coli, which is the positive control of the present invention; The results show that the extension efficiency of the extension primers of the corresponding strain nucleic acid mass spectrometry is greater than 90% (greater than 20% is judged as positive), and the nucleic acid mass spectrometry detection result is completely consistent with the sequencing result, which can prove the reliable accuracy of the results of the present invention. Using the primer and probe composition in Example 1 to co-amplify the DNA templates of ten microorganisms and detect the nucleic acid mass spectrometry diagram as Figure 12 shown. The results show that multiple microbial probes can be extended. It overcomes the compatibility of 10 primers and effectively amplifies the R & D difficulty of ten target DNAs.

[0107] The replaced B.cep-0F / B.cep-0R primers in Comparative Example 1 are ineffective in the extension of multiplex PCR amplification. When B.cep-0F / B.cep-0R is mixed with the other nine pairs of microbial primers for amplification, the probe of Burkholderia cepacia cannot be extended. The nucleic acid mass spectrometry diagram detected after B.cep-0F / B.cep-0R is mixed with the other nine pairs of microbial primers for amplification is as Figure 13 shown. It is speculated that this pair of primers may not be compatible with the other nine pairs of primers.

[0108] The replaced single-base extension primer in Comparative Example 2 has a low extension efficiency in the extension of multiplex PCR amplification. When the extension primer Salm-0Probe is mixed with the other microbial extension primers, the peak intensity after the extension of this extension primer is significantly lower than that of the other extension primers. The nucleic acid mass spectrometry diagram detected after the extension primer Salm-0Probe is mixed with the other microbial extension primers for extension is as Figure 14 shown. Since there are strains of seven microorganisms in the initial stage of the kit R & D, this figure is the extension detection results of seven microorganisms, namely Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Citrobacter freundii, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. After replacing the probe with Salm-Probe in Example 1, the peak intensity is similar to that of the other extension primers after extension. The peak intensity of some extension primers is not enough, less than 50% of that of the other extension primers, and continuous debugging is required. This is also one of the difficulties in the R & D of the nucleic acid mass spectrometry multiplex microbial detection kit.

Claims

1. A composition of multiplex PCR primers and probes for detecting microorganisms, characterized in that, The composition includes 10 pairs of primers and corresponding 10 probes targeting Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. The nucleotide sequences of the 10 pairs of primers are shown in SEQ ID No.1 - 20 respectively, and the nucleotide sequences of the 10 probes are shown in SEQ ID No.21 - 30 respectively.

2. The composition of multiplex PCR primers and probes for detecting microorganisms according to claim 1, wherein the nucleotide sequences of the primers targeting Staphylococcus aureus are shown in SEQ ID No.1 and SEQ ID No.2, and the probe is shown in SEQ ID No.21; the nucleotide sequences of the primers targeting Salmonella are shown in SEQ ID No.3 and SEQ ID No.4, and the probe is shown in SEQ ID No.22; the nucleotide sequences of the primers targeting Pseudomonas aeruginosa are shown in SEQ ID No.5 and SEQ ID No.6, and the probe is shown in SEQ ID No.23; the nucleotide sequences of the primers targeting Clostridium tetani are shown in SEQ ID No.7 and SEQ ID No.8, and the probe is shown in SEQ ID No.24; the nucleotide sequences of the primers targeting Citrobacter freundii are shown in SEQ ID No.9 and SEQ ID No.10, and the probe is shown in SEQ ID No.25; the nucleotide sequences of the primers targeting Stenotrophomonas maltophilia are shown in SEQ ID No.11 and SEQ ID No.12, and the probe is shown in SEQ ID No.26; the nucleotide sequences of the primers targeting Burkholderia cepacia are shown in SEQ ID No.13 and SEQ ID No.14, and the probe is shown in SEQ ID No.27; the nucleotide sequences of the primers targeting Klebsiella pneumoniae are shown in SEQ ID No.15 and SEQ ID No.16, and the probe is shown in SEQ ID No.28; the nucleotide sequences of the primers targeting Candida albicans are shown in SEQ ID No.17 and SEQ ID No.18, and the probe is shown in SEQ ID No.29; the forward primer and reverse primer for detecting Escherichia coli are shown in SEQ ID No.19 - 20, and the probe is shown in SEQ ID No.

30.

3. A kit for detecting microorganisms by multiplex PCR, characterized in that, The kit includes the composition of multiplex PCR primers and probes for detecting microorganisms according to claim 1 or 2.

4. The kit according to claim 3, characterized in that, The kit further includes at least one of Multiplex PCR Mix, SAP Buffer, SAP enzyme, and Extend Reaction Mix.

5. A method for multiplex PCR detection of microorganisms for non-diagnostic purposes, characterized in that, The method includes performing multiplex PCR amplification using the composition of multiplex PCR primers and probes for detecting microorganisms described in claim 1 or 2, and detecting whether Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans and / or Escherichia coli exist in the sample to be tested.

6. The method according to claim 5, characterized in that, The sample to be tested is a cosmetic, and the method includes the following steps: Multiplex PCR amplification: Prepare a multiplex PCR reaction system containing 10 pairs of primers in claim 1 and the sample to be tested, and perform a multiplex PCR amplification reaction to obtain a PCR amplification reaction product; SAP enzyme digestion reaction: Mix the PCR amplification reaction product with SAP Buffer and SAP enzyme and perform a SAP enzyme digestion reaction to obtain a SAP enzyme digestion reaction product; Single-base extension reaction: Mix the SAP enzyme digestion reaction product with the probes in claim 1 to prepare a single-base extension reaction system, and perform a single-base extension reaction to obtain a single-base extension reaction product; Mass spectrometry detection: The single-base extension reaction product is purified and centrifuged, and the supernatant obtained by centrifugation is taken for mass spectrometry detection to obtain a detection result.

7. The method according to claim 6, wherein In the multiplex PCR reaction system, the concentration of the sample to be tested is 1 ng / μL - 200 ng / μL, and the concentration of each primer is 0.1 μM - 0.4 μM; The reaction conditions for multiplex PCR amplification are: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, for 40 cycles; final extension at 72°C for 5 minutes.

8. The method according to claim 6, wherein The reaction conditions for the SAP enzyme digestion reaction are: incubation at 37°C for 30 minutes, enzyme inactivation at 85°C for 5 minutes.

9. The method according to claim 6, wherein In the single-base extension reaction system, the concentration of each probe is 0.5 μM - 1 μM, and the reaction conditions for the single-base extension reaction are: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds, for 5 cycles, annealing at 52°C for 5 seconds and extension at 80°C for 5 seconds, for 40 cycles, and the total reaction of denaturation, annealing and extension is cycled 40 times; final extension at 72°C for 3 minutes.

10. The method according to claim 6, characterized in that, The cosmetic is lotion, emulsion or cream, and the method further includes a process of pre-treating the cosmetic to obtain a cosmetic enrichment broth, and this process includes the steps: Aseptically weigh the cosmetic sample, dilute it with physiological saline, inoculate it into SCDLP medium or chopped meat medium, extract DNA from the culture product, and control the DNA concentration of the DNA extraction product to be 1 ng / μL - 200 ng / μL for the multiplex PCR reaction system.

Images