KASP molecular marker related to wheat pre-harvest sprouting resistance and application of KASP molecular marker
By discovering the A/C polymorphism of the wheat ear germination resistance gene TaDOG1L4 and designing KASP molecular markers, the problem of complexity of wheat ear germination resistance was solved, and rapid identification and breeding efficiency were achieved.
Patent Information
- Application Number
- CN202510620072.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-06-24
AI Technical Summary
Wheat ear germination is prone to occur during the high-temperature and rainy harvest season, leading to degradation of grain storage substances and degradation of quality, and causing economic losses to growers. The prior art is difficult to effectively solve the complexity of wheat ear germination resistance.
It was discovered that there was A/C polymorphism at the 20th base of the TaDOG1L4 coding region of the wheat ear germination resistance gene, and a KASP molecular marker was designed, and the genotype was analyzed using PCR amplification technology to judge the germination resistance of wheat ears.
A method for quickly identifying the germination resistance of wheat ears is realized, breeding efficiency is improved, and the breeding cycle of ear-resistant germination materials is shortened, cost is reduced by half and efficiency is doubled.
Smart Images

Figure CN120193124A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular markers, and particularly to a KASP molecular marker related to wheat pre-harvest sprouting resistance and its application. Background Art
[0002] During the wheat harvest season, if it encounters high temperature and rainy weather, pre-harvest sprouting is extremely likely to occur, resulting in the degradation of grain storage substances, the decline of quality indicators, and it is difficult to be used for subsequent processing and production. Wheat with pre-harvest sprouting is often not accepted by local grain purchase points. Even if there is a purchase, it is usually much lower than the normal market price, bringing huge economic losses to growers and having a negative impact on food security. Wheat pre-harvest sprouting is a complex quantitative trait affected by multiple factors such as external environment, spike morphology, seed dormancy characteristics, physiological mechanisms, levels of plant hormones such as ABA, and gene regulation. It is the result of the interaction between environmental conditions and genes. Therefore, the resistance mechanism of pre-harvest sprouting has a certain degree of complexity.
[0003] Currently, QTL loci or genes related to pre-harvest sprouting have been found on all 21 chromosomes of wheat, but mainly concentrated on chromosomes 2B, 3A, 3D, and 4A. In breeding, mainly the gene resources of pre-harvest sprouting resistance are utilized to make different wheat varieties have pre-harvest sprouting resistance. Therefore, exploring the major QTL controlling wheat pre-harvest sprouting resistance and developing corresponding molecular markers, and introducing excellent allelic variations into main cultivars by tracking molecular markers to create new materials resistant to pre-harvest sprouting is one of the important ways to rapidly improve wheat pre-harvest sprouting resistance. Summary of the Invention
[0004] The purpose of the present invention is to provide a KASP molecular marker related to wheat pre-harvest sprouting resistance and its application to solve the problems existing in the above-mentioned prior art. The present invention discovers that there is an A / C polymorphism at the 20th base in the coding region (SEQ ID NO.1) of the wheat pre-harvest sprouting resistance gene TaDOG1L4, which is significantly correlated with the wheat germination rate. This provides a new molecular marker for wheat pre-harvest sprouting resistance breeding and lays a foundation for rapidly creating new materials resistant to pre-harvest sprouting.
[0005] To achieve the above purpose, the present invention provides the following solutions:
[0006] The present invention provides a KASP molecular marker related to wheat pre-harvest sprouting resistance, and the nucleotide sequence of the KASP molecular marker is as shown in SEQ ID NO.1, and there is an A / C mutation at the 20th position of the sequence shown in SEQ ID NO.1.
[0007] Preferably, when the genotype of the mutation site at the 20th position of the KASP molecular marker is CC, the wheat shows resistance to pre-harvest sprouting; when the genotype is AA, the wheat shows susceptibility to pre-harvest sprouting.
[0008] The present invention also provides primers for amplifying the KASP molecular marker, and the primers include a universal primer as shown in SEQ ID NO.2 and specific primers as shown in SEQ ID NOs. 3-4.
[0009] The present invention also provides a kit for detecting the KASP molecular marker, including the primers.
[0010] The present invention also provides the application of the KASP molecular marker, the primers or the kit in identifying the resistance of wheat to pre-harvest sprouting.
[0011] The present invention also provides the application of the KASP molecular marker, the primers or the kit in creating wheat varieties resistant to pre-harvest sprouting.
[0012] The present invention also provides the application of the KASP molecular marker, the primers or the kit in improving the breeding efficiency of wheat resistance to pre-harvest sprouting.
[0013] The present invention also provides a method for identifying the resistance of wheat to pre-harvest sprouting, including the following steps:
[0014] Using the genomic DNA of the wheat material to be tested as a template, amplifying the KASP molecular marker by PCR using the universal primer as shown in SEQ ID NO.2 and the specific primers as shown in SEQ ID NOs. 3-4, and analyzing the genotype of the mutation site of the KASP molecular marker to determine whether the material to be tested has the resistance of wheat to pre-harvest sprouting.
[0015] Preferably, the reaction system for the PCR amplification includes 5 μL of 2×KASP Master Mix, 1.4 μL of KASP Assay Mix, 1 μL of template DNA and 0.08 μL of MgCl2, and make up to 10 μL with ddH2O; wherein, every 100 μL of the KASP Assay Mix includes: 30 μL of the universal primer, 12 μL of each of the two specific primers, and make up to 100 μL with ddH2O;
[0016] The reaction program for the amplification reaction is: 94°C for 15 min; 94°C for 20 s, 65 - 55°C for 1 min, decreasing 1°C for each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 35 cycles.
[0017] Preferably, if the genotype of the mutation site of the amplification product is CC, the wheat material to be tested shows resistance to pre-harvest sprouting; if the genotype is AA, the wheat material to be tested shows susceptibility to pre-harvest sprouting.
[0018] The present invention discloses the following technical effects:
[0019] The present invention has discovered that there is a nucleotide polymorphism at the 740th base in the coding region of the wheat pre-harvest sprouting resistance gene TaDOG1L4 (i.e., the 20th position corresponding to the sequence shown in SEQ ID NO.1), and designed KASP molecular marker primers within the TaDOG1L4 gene, which include 2 specific primers and 1 common primer. The 2 specific primers can specifically bind to the target sequence for amplification, thereby achieving genotyping. The inventors performed alignment in the 10+genome database, designed specific primers at the differentially sequenced sites with frequencies respectively, and designed common primers at their homologous sequences to achieve gene identification. Compared with other molecular marker detections, there is no need to perform gel electrophoresis detection anymore, the efficiency is doubled, and the cost is reduced by half.
[0020] The primer set for amplifying KASP molecular markers of the present invention is applicable to all wheat varieties and can be applied in the molecular assisted breeding of wheat pre-harvest sprouting resistance to shorten the breeding cycle of materials resistant to pre-harvest sprouting. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0022] Figure 1 Schematic diagram for KASP primer development;
[0023] Figure 2 KASP primer evaluation and detection results. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0024] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0025] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded within the range.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0027] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the specification of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0028] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0029] Example 1: Sequence Analysis of the Gene TaDOG1L4 Resistant to Pre-harvest Sprouting in Wheat and Development of KASP Markers
[0030] By searching the literature on genes related to seed dormancy, germination and ABA signaling and the website of BIOCYC (www.biocyc.org), the gene TaDOG1L4 related to pre-harvest sprouting was found, and the gene and literature information are shown in Table 1.
[0031] Table 1 Gene and Literature Information
[0032]
[0033] Obtain the gene sequences in wheat according to the retrieved literature. In the wheat "10+" genome (which has been publicly disclosed in the following literature: Walkowiak S, Gao L, Monat C, Haberer G, Kassa MT, Brinton J, Ramirez-Gonzalez RH, Kolodziej MC, Delorean E, Thambugala D, Klymiuk V, Byrns B, Gundlach H, Bandi V, Siri JN, Nilsen K, Aquino C, Himmelbach A, Copetti D, Ban T, Venturini L, Bevan M, Clavijo B, Koo DH, Ens J, Wiebe K, N'Diaye A, Fritz AK, Gutwin C, Fiebig A, Fosker C, Fu BX, Accinelli GG, Gardner KA, Fradgley N, Gutierrez-Gonzalez J, Halstead-Nussloch G, Hatakeyama M, Koh CS, Deek J, Costamagna AC, Fobert P, Heavens D, Kanamori H, Kawaura K, Kobayashi F, Krasileva K, Kuo T, McKenzie N, Murata K, Nabeka Y, Paape T, Padmarasu S, Percival-Alwyn L, Kagale S, Scholz U, Sese J, Juliana P, Singh R, Shimizu-Inatsugi R, Swarbreck D, Cockram J, Budak H, Tameshige T, Tanaka T, Tsuji H, Wright J, Wu J, Steuernagel B, Small I, Cloutier S, Keeble-Gagnère G, Muehlbauer G, Tibbets J, Nasuda S, Melonek J, Hucl PJ, Sharpe AG, Clark M, Legg E, Bharti A, Langridge P, Hall A, Uauy C, Mascher M, Krattinger SG, Handa H, Shimizu KK, Distelfeld A, Chalmers K, Keller B, Mayer KFX, Poland J, Stein N, McCartney CA, Spannagl M, Wicker T, Pozniak CJ. Multiple wheat genomes reveal global variation in modern breeding.Nature. 2020 Dec; 588(7837): 277 - 283. doi: 10.1038 / s41586 - 020 - 2961 - x. Epub 2020 Nov 25. PMID: 33239791; PMCID: PMC7759465. In the website that can be accessed, such as http: / / 202.194.139.32 / , obtain the CDS of candidate wheat genes in the "10 +" materials, perform sequence alignment through the software DNAMAN, use the sequence 20 bp upstream of the single - nucleotide polymorphism (SNP) site that will cause amino acid changes as the specific primer, design the forward and reverse primers of the KASP molecular marker 200 bp downstream of the SNP site, and finally evaluate the artificially designed primers using the Ensembleplants website (http: / / plants.ensembl.org / ).
[0034] The wheat pre - harvest sprouting resistance gene TaDOG1L4 is located on chromosome 3A, and there is a C / A polymorphism at the 740th base in its coding region. The schematic diagram of primer design is shown in Figure 1 .
[0035] The KASP marker system contains 2 specific primers and 1 universal primer. A specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence is added to the front end of one specific primer; a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence is added to the front end of the other specific primer. The primer sequences were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0036] Table 2 Primer names and sequences
[0037]
[0038] Example 2: Genotyping of the KASP marker combination of TaDOG1L4 in the wheat natural population
[0039] Experimental materials: Wheat (names are shown in Table 3), including local wheat varieties, conventional bred varieties, and foreign wheat varieties. All materials were preserved and provided by the Crop Genetics and Breeding Team of the Wheat Research Institute, Sichuan Agricultural University.
[0040] Table 3 Biological material information
[0041]
[0042]
[0043]
[0044] Harvest the above wheat germplasm at the dough stage, thresh it, and air-dry it at room temperature for 7 days until the seed moisture content reaches 10-12%. Then, take 50 seeds of each material, make 3 replicates, and place them in a seed incubator (temperature 25°C, relative humidity 100%) for germination culture. Count the seed germination rate at 7 days. Using the rupture of the epidermal layer of the grain embryo as the germination standard, count the number of germinated grains in each group respectively, and then calculate the average germination rate. The 7-day grain germination rate is shown in Table 3. Germination Rate (GR) = (number of germinated seeds / total number of seeds) × 100%.
[0045] Take the leaves of all the test materials in Table 3 respectively, and extract genomic DNA by the conventional CTAB method (this extraction method is a conventional method. For the extraction method used in this example, refer to the literature (Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components [J]. Plant molecular biology reporter, 1997, 15: 8-15).
[0046] Perform PCR amplification using wheat genomic DNA as a template. The total volume of the KASP (PCR) reaction system is 10 μL, including 5 μL of 2×KASP MasterMix (Beijing JiaCheng), 1.4 μL of KASP AssayMix, 1 μL of wheat template DNA with a concentration of 100 ng / μL, 0.08 μL of MgCl2, and ddH2O is added to make up to 10 μL;
[0047] Among them, every 100 μL of the KASP AssayMix includes: 12 μL of TaDOG1_A_740_FAM with a concentration of 100 μM, 12 μL of TaDOG1_A_740_HEX with a concentration of 100 μM, 30 μL of the universal primer TaDOG1_A_740_COM with a concentration of 100 μM, and ddH2O is added to make up to 100 μL;
[0048] The KASP (PCR) reaction program is: 94°C for 15 min; 94°C for 20 s, 65 - 55°C for 1 min, with a decrease of 1°C for each cycle, a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, a total of 35 cycles. Analyze the PCR results by scanning with a KASP fluorescence analyzer (Bio-Rad model CFX96 Touch Real-Time PCR Detection System).
[0049] The fluorescence detection results are as Figure 2Shown as follows: all markers were successfully genotyped, FAM was orange, HEX was blue, heterozygous was green, and blank was black. That is: if the fluorescence detection result is type A (blue, genotype AA), type B (orange, genotype CC), it indicates that the genotype of the sample wheat is homozygous; if the fluorescence detection result is type C (green), it indicates that the genotype of the sample wheat is heterozygous; if the fluorescence detection result is type D (black), it indicates that the genotype of the sample wheat is blank.
[0050] All markers were successfully genotyped, and the genotyping results are listed in Table 3, and the results of the t-test are shown in Table 4. The genotyping results showed that the diversity of the 740th base in the TaDOG1L4 gene was associated with the germination rate, and the wheat materials carrying the genotype CC had better pre-harvest sprouting resistance than those carrying the genotype AA. Therefore, the breeding efficiency of wheat materials resistant to pre-harvest sprouting can be improved by detecting the genotype of the TaDOG1L4 marker in wheat materials.
[0051] Table 4 Results of t-test for molecular markers
[0052]
[0053] As can be seen from the above examples, the 20th base of the partial fragment (SEQ ID NO.1) in the coding region of the wheat pre-harvest sprouting resistance gene TaDOG1L4 is C / A, and this site can be used as an SNP marker related to the pre-harvest sprouting trait of wheat. When the genotype at this SNP marker in the wheat gene is CC, the wheat shows resistance to pre-harvest sprouting; when the genotype at this SNP marker in the wheat gene is AA, the wheat shows susceptibility to pre-harvest sprouting.
[0054] SEQ ID NO.1 is:
[0055] CTGGCCACGGAGATCCTGA C GCCGCGGCAGGCGGTGGAGATGCTGATGGCAGCCAAGCAGCTGCACCTGGCGGTGCGCGACTGGAGCCGCCGGAAGGAGGAGGGCGCCCAGAACGCGCGTCTGCCGCTCGCAGCCGCAGCGACGACCGCCCCCTCGGGCTCAAAACCATGA.
[0056] Note: The bold and underlined bases are SNP sites.
[0057] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A KASP molecular marker associated with wheat spike sprouting resistance, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, and there is an A / C mutation at position 20 of the sequence shown in SEQ ID NO.
1.
2. The KASP molecular marker according to claim 1, characterized in that When the genotype of the mutation site at position 20 of the KASP molecular marker is CC, the wheat exhibits resistance to ear sprouting; when the genotype is AA, the wheat exhibits susceptible to ear sprouting.
3. A primer for amplifying the KASP molecular marker according to claim 1 or 2, characterized in that: The primers include a universal primer as shown in SEQ ID NO.2, and specific primers as shown in SEQ ID NO.3-4.
4. A kit for detecting the KASP molecular marker according to claim 1, characterized in that: Comprising the primer described in claim 3.
5. Use of the KASP molecular marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in identifying wheat spike sprouting resistance.
6. Use of the KASP molecular marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in the creation of wheat varieties resistant to ear sprouting.
7. Use of the KASP molecular marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in improving the breeding efficiency of wheat spike sprouting resistance.
8. A method for identifying wheat ear germination resistance, characterized in that: The following steps are involved: The genomic DNA of the wheat material to be tested was used as a template, and PCR amplification was performed using the universal primers shown in SEQ ID NO.2 and the specific primers shown in SEQ ID NO.3-4. The KASP molecular marker according to claim 1 or 2, wherein the genotype of the mutation site of the KASP molecular marker is analyzed to determine whether the material to be tested has wheat ear sprout resistance.
9. The method according to claim 8, characterized in that The PCR amplification reaction system includes 2×KASPMaster Mix 5 μL, KASPAssay Mix 1.4 μL, template DNA 1 μL and MgCl2 0.08 μL, which are supplemented to 10 μL with ddH2O; wherein, every 100 μL of the KASPAssay Mix includes: universal primer 30 μL, two specific primers 12 μL each, which are supplemented to 100 μL with ddH2O; The reaction procedure of the PCR amplification is: 94°C for 15 min; 94°C for 20 s, 65-55°C for 1 min, decreasing 1°C in each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 35 cycles.
10. The method according to claim 8, characterized in that If the genotype of the mutation site of the amplified product is CC, the wheat material to be tested is resistant to ear sprouting; if the genotype is AA, the wheat material to be tested is susceptible to ear sprouting.