Method for judging resistance of avian salmonella based on resistance indexes
By combining multiple resistance indicators for evaluation, CS-index is formed, which solves the problem of lack of effective disease resistance selection indicators in the prior art, improves the accuracy of evaluation of salmonella resistance to poultry, and provides important support for breeding.
Patent Information
- Application Number
- CN202510146581.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-10
- Publication Date
- 2025-06-24
AI Technical Summary
The existing technology lacks effective disease resistance selection indicators, making it difficult to accurately evaluate poultry's resistance to salmonella infection, resulting in limited breeding effect against salmonella infection.
Multiple resistance indicators were used, including thickness of the intestinal mucosal layer, depth of intestinal glands, number of goblet cells per unit length, ratio of heterophils to lymphocytes and IFN-γ concentration, and comprehensive evaluation was carried out through the minimum-maximum normalization method to form the Salmonella resistance index CS-index.
It improves the evaluation efficiency and accuracy of the resistance to salmonella in poultry, provides important theoretical support for breeding with Salmonella infection, and fills the gap in the selection indicators for salmonella disease resistance in avian.
Smart Images

Figure CN120195170A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of poultry breeding, and in particular to a method for judging the resistance of poultry to Salmonella based on resistance indicators. Background Art
[0002] Poultry diseases cause enormous economic losses to the poultry industry each year. Genetic improvement, which essentially enhances chickens' resistance to pathogens and promotes disease-resistant breeding, is one effective approach to poultry disease prevention and control. Numerous biochemical indices are associated with disease resistance in chickens, including antibody levels, serum mediator levels, and lymphocyte transformation rates. Some of these indices are related to specific pathogens and lack representativeness, while others are influenced by environmental, breed, and nutritional factors, resulting in wide variation and making them difficult to apply to the selection of new disease-resistant chicken lines. Therefore, the selection of new disease-resistant poultry lines remains a significant challenge in breeding. Heterophils serve as the first line of defense against invading microorganisms in cellular immunity. Lymphocytes and heterophils play important roles in both humoral and cellular immune responses in chickens. The heterophil / lymphocyte ratio (H / L) is known to correlate with stress tolerance and disease resistance in poultry (Gross and Siegel, 1986, Wang, 2023). However, the H / L ratio is highly correlated with the body's state. Stress can cause changes in the ratio, making H / L testing highly unstable in production. Furthermore, a single H / L ratio is limited in its ability to indicate disease resistance. Currently, the livestock industry lacks an effective selection metric for disease resistance, creating a critical bottleneck in breeding for disease resistance.
[0003] Salmonella is a widely distributed enteric pathogen with strong environmental adaptability and the ability to survive for long periods of time. Poultry is one of its key reservoirs, and Salmonella often spreads within poultry populations through both horizontal and vertical transmission. This multi-pathway transmission makes it highly susceptible to infection within poultry production, posing a significant challenge to prevention and control efforts. More seriously, Salmonella enters the food chain through contaminated food, posing a threat to human health, particularly in the area of foodborne illness. Poultry infected with Salmonella may not only experience typical symptoms such as acute gastroenteritis and even death, but also significantly impact production performance, including decreased egg production, weight loss, and increased feed-to-weight ratio. In immunocompromised individuals, infection can progress to systemic diseases such as sepsis. This not only threatens poultry health and profitability but also increases the risk of transmission to humans through the food chain. Therefore, controlling Salmonella infection requires safeguarding both poultry health and food safety and public health. In poultry production, Salmonella infection is a prominent problem, particularly in broiler chickens. The high morbidity and mortality rates among chicks, in particular, limit the effectiveness of traditional prevention and control methods. Currently, Salmonella control in breeder farms primarily relies on Salmonella decontamination, supplemented by vaccination, while commercial chickens rely primarily on vaccination, supplemented by antibiotics and drug treatment. However, the number of breeder chickens is far smaller than that of commercial chickens, leading to the emergence of multidrug resistance in Salmonella. This makes Salmonella control increasingly difficult and detrimental in the long term. Against this backdrop, genetic breeding is considered a potential solution to improve poultry disease resistance. The key to breeding for Salmonella resistance lies in accurately assessing poultry's resistance to Salmonella infection, and developing scientifically sound Salmonella resistance indicators is fundamental to achieving this goal. Currently, research has focused on single Salmonella resistance indicators. However, due to the complexity of Salmonella infection, relying solely on a single indicator cannot fully reflect poultry's resistance to Salmonella infection. Therefore, the development of a comprehensive disease resistance assessment system is urgently needed.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] In order to solve the above technical problems, the present invention provides a method for judging the resistance of poultry Salmonella based on resistance indicators.
[0006] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a method for judging the resistance of poultry Salmonella based on resistance indicators, wherein the resistance indicators include: intestinal mucosal layer thickness, intestinal gland depth, number of goblet cells per unit length, ratio of heterophils to lymphocytes and IFN-γ concentration.
[0007] Preferably, the minimum-maximum normalization method is used to eliminate the influence of different dimensions: first, according to the formula X new =X-X min / X max -X min Normalize each resistance index separately; then according to the formula CS-index=∑0.20×X new Calculate the comprehensive evaluation index; in the formula, X new is the dimensionless value converted by the minimum-maximum normalization method; X max is the maximum value of all measurements, X min The CS-index is the minimum of all measured values; the CS-index is a comprehensive evaluation indicator. The higher the CS-index value, the higher the Salmonella resistance of the individual or variety from which the sample originated.
[0008] Preferably, when the comprehensive evaluation index CS-index value is higher than the median value (0.0447), it is judged that the poultry from which the sample originates is resistant to Salmonella.
[0009] Preferably, the method for measuring the thickness of the intestinal mucosal layer and the depth of the intestinal glands is: using a panoramic slice scanner to scan and image the tissue information on the tissue slice; using browsing analysis software to magnify the scanned image 25-400 times for observation; selecting 3-4 target areas of the tissue for imaging; measuring the thickness of the intestinal mucosal layer and the depth of the intestinal glands at 3-5 locations in each slice, and calculating the average value.
[0010] Preferably, the method for determining the number of goblet cells per unit length is: using a panoramic slice scanner to scan and image all tissue information on the tissue slice; using scanning software to select the intestinal mucosal layer area for 50-800 times imaging; measuring the length of the intestinal glandular epithelium at 4-6 locations in each slice; counting the number of goblet cells in the corresponding length; and calculating the number of goblet cells per unit length = number of goblet cells / length of intestinal glandular epithelium.
[0011] Preferably, the method for determining the ratio of heterophils to lymphocytes is: air-drying a blood smear and then staining it, and calculating the ratio of heterophils to lymphocytes in 50-200 white blood cells after magnification under a microscope.
[0012] Preferably, the IFN-γ concentration in the sample serum is detected using an enzyme-linked immunosorbent assay.
[0013] Preferably, the poultry comprises chicken.
[0014] In a second aspect, the present invention provides an indicator CS-index for judging the resistance of poultry to Salmonella, including: intestinal mucosal layer thickness, intestinal gland depth, number of goblet cells per unit length, ratio of heterophils to lymphocytes and IFN-γ concentration.
[0015] In a third aspect, the present invention provides a kit for determining the resistance of poultry to Salmonella, comprising a reagent for detecting the indicator CS-index.
[0016] Beneficial effects: The present invention provides a method for judging the Salmonella resistance of poultry based on resistance indicators, wherein the resistance indicators include: intestinal mucosal layer thickness, intestinal gland depth, goblet cell number per unit length, heterophil to lymphocyte ratio and IFN-γ concentration. At present, the field of poultry farming lacks effective Salmonella resistance selection indicators, which is a key checkpoint in poultry disease-resistant breeding. The Salmonella resistance index provided by the present invention can not only improve the efficiency and accuracy of disease resistance assessment, but also provide important theoretical support for breeding for resistance to Salmonella infection. The present invention fills the gap in Salmonella resistance selection indicators for poultry and can greatly advance the process of poultry disease-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions of the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.
[0018] Figure 1 The results of the high and low bacterial load groupings and bacterial load and H / L value determination of the test population in Example 1 are shown.
[0019] Figure 2 The changes in cytokines and intestinal morphology in the susceptible and resistant groups under the artificial Salmonella infection conditions in Example 1 are shown.
[0020] Figure 3 This is the correlation analysis of phenotypic groups under the artificial Salmonella infection conditions in Example 1.
[0021] Figure 4 This is the Salmonella resistance index (CS-index) analysis in Example 1.
[0022] Figure 5 This is an analysis of the differences in serum immunity and intestinal indicators between the Salmonella susceptible group and the Salmonella resistant group in the control group in Example 1. DETAILED DESCRIPTION
[0023] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are also within the scope of protection of the present invention.
[0024] The endpoints and any values of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and the individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.
[0025] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.
[0026] In the examples provided herein, if specific techniques or conditions are not specified, the experiments were performed according to those described in literature in the field or according to the product instructions. Reagents or instruments used without manufacturer's indication are conventional products available through regular channels.
[0027] In the following examples, the experimental materials used were "Guangming No. 2" white broiler chickens of the B line. Experimental age: chicks were transferred to the isolation chamber of the Beijing Academy of Agriculture and Forestry Sciences at 1 day old and fed with Salmonella Enteritidis (SE) for 3 consecutive days starting at 6 days old. The concentration of the enteritidis Salmonella liquid was 8.5×10 8 CFU·mL -1 , blood sampling and sample collection were performed on the jugular vein at 9 days of age.
[0028] In the following examples, the H / L ratio was determined as follows: a fresh blood sample was collected from each chicken and smeared onto a microscope slide. The resulting blood smear was air-dried and then stained using Giemsa stain. All 100 white blood cells, including heterophils, lymphocytes, and monocytes, were counted using a Leica DM500 microscope at 100x magnification. The H / L ratio was calculated by dividing the number of heterophils by the number of lymphocytes.
[0029] In the following examples, the method for determining the concentrations of serum IFN-γ, IL-6, IL-8, and IgA is as follows: an enzyme-linked immunosorbent assay (ELISA) kit is used to detect the concentrations of IFN-γ, IL-6, IL-8, and IgA in serum. The sample, standard, and HRP-labeled detection antibody are added sequentially to the coated microwells pre-coated with the target antibody, incubated, and thoroughly washed. The color is developed using the substrate TMB, which converts to blue under the catalysis of peroxidase and to a final yellow under the action of acid. The concentrations of IFN-γ, IL-6, IL-8, and IgA in serum are calculated based on the standard curve.
[0030] In the following examples, genomic DNA (gDNA) was purified using the phenol-chloroform method. Liver DNA extraction was performed by mixing liver homogenate with 800µl of lysis buffer (Tris 6.43%, EDTA 4.94%, NaCl 62.07%, SDS 26.56%) and 30µl of proteinase K, shaking for 10 minutes, and incubating in a 56°C water bath overnight. DNA extraction was performed by adding equal volumes of phenol, chloroform, and absolute ethanol and gently shaking the solution until it turned milky white. Real-time quantitative PCR (RT-qPCR) was performed to measure bacteria (SE) in the liver using gDNA from chickens artificially challenged with Salmonella. Quantitative real-time PCR was performed using the qPCR Master Mix (2x) Kit according to the manufacturer's instructions. The total reaction volume was 20µl. Salmonella primers were used to quantify the total Salmonella load in the liver, and a standard curve of y = -3.3517x + 45.296 was used for calculation. The RT-qPCR program was as follows: 95°C for 15 min; 95°C for 10 s, 60°C for 32 s (40 cycles); 95°C for 15 s; 60°C for 1 min; 95°C for 15 s. The primers for Salmonella were: F:TCCCTGAATCTGAGAAAGAAAAACTC (SEQ ID NO: 01); R:TTGATGTGGGTTGGTTCGTCACT (SEQ ID NO: 02).
[0031] In the following examples, samples for intestinal morphology were collected as follows: cecal samples were fixed with 4% paraformaldehyde. Once fixed, they were trimmed, dehydrated, embedded, sectioned, stained, mounted, and examined under a microscope. The intestinal morphology was determined using a panoramic slide scanner (PANNORAMIC DESK / MIDI / 250 / 1000). The slides were then imaged at 100x magnification using CaseViewer 2.4. Three to four target regions of tissue were selected for imaging, ensuring that the tissue filled the entire field of view and that the background lighting was consistent across all images. Intestinal gland depth, muscularis layer thickness, and mucosal layer thickness were measured at three to five locations within each slide, and the average values were calculated. Data were plotted using Prism 9 software. The PANNORAMIC panoramic slide scanner was used to scan all tissue sections. A selected region of the intestinal mucosa was imaged at 200x magnification using CaseViewer 2.4 scanning software. The tissue was imaged at 200x magnification, ensuring that the tissue filled the entire field of view and that the background lighting was consistent across all images. After imaging, image analysis software was used to measure the length of the intestinal glandular epithelium at five locations within each section, using millimeters as the standard unit. The number of goblet cells within each corresponding length was counted, and the number of goblet cells per unit length was calculated as: number of goblet cells / intestinal glandular epithelium length. Data were plotted using Prism 9 software.
[0032] In the following examples, the method for developing a resistance index (CS-index) is as follows: normalization and calculation of the comprehensive index use the minimum-maximum normalization method to eliminate the influence of different dimensions. Five indicators, including mucosal thickness, glandular depth, goblet cell count per unit length, H / L ratio, and IFN-γ, are normalized according to formula (1). The comprehensive index is calculated according to formula (2).
[0033] Formula (1): X new =X-X min / X max -X min ; Among them, X new is the dimensionless value converted by the minimum-maximum normalization method; X max is the maximum value of all measurements, X min is the minimum of all measured values.
[0034] Formula (2): D = ∑0.20 × X new ; Among them, D represents the comprehensive evaluation index; X new It is a dimensionless value converted by the minimum-maximum normalization method.
[0035] Example 1 In this example, a Salmonella resistance and susceptibility test population was first constructed to screen for serum markers against Salmonella infection and intestinal morphology.
[0036] To screen for important markers that influence chickens' resistance to Salmonella infection, the bacterial load in the liver tissue of individuals in the artificial Salmonella infection group was measured. Based on the median value of the tissue bacterial load (3.5523), the individuals were divided into a high bacterial load group (H-SE) and a low bacterial load group (L-SE). The difference between the high and low bacterial load groups was extremely significant ( P <0.01) ( Figure 1 Figure A). According to the extreme values of liver tissue bacterial load, the patients were divided into a resistant group (R-SE) and a susceptible group (S-SE). Compared with the susceptible group, the liver tissue bacterial load and H / L value of the resistant group were significantly reduced ( P <0.05; Figure 1 Figures B and C in the middle).
[0037] This example further provides a differential analysis of serum immune factors and intestinal morphology between resistant and susceptible white-feathered broiler chickens under artificial Salmonella infection conditions.
[0038] Analysis of changes in serum cytokines and intestinal morphology in the resistant and susceptible groups after Salmonella infection ( Figure 2 The levels of inflammatory factors (IFN-γ, IL-6, and IL-8) and immunoglobulin IgA in chicken serum were detected by Elisa, and the thickness of the intestinal muscle layer, the thickness of the intestinal mucosal layer, the depth of the glands, and the number of goblet cells were determined by intestinal sections. The results showed that the IFN-γ level in the S-SE group was significantly higher than that in the R-SE group, while the IgA level was significantly lower than that in the R-SE group ( P <0.05). The number of goblet cells and gland depth in the R-SE group were significantly higher than those in the S-SE group ( P <0.05).
[0039] This example further provides a phenotype-group correlation analysis of artificial Salmonella infection groups.
[0040] The correlation coefficients between liver bacterial load and H / L value, serum inflammatory factors and intestinal morphology were analyzed, and the correlation heatmap was drawn to evaluate the correlation between liver bacterial load and H / L value, serum inflammatory factors and intestinal morphology ( Figure 3 As shown in the figure, the bacterial load was significantly positively correlated with H / Ln and IFN-γ, and significantly negatively correlated with gland depth, the number of goblet cells per unit length, and the thickness of the mucosal layer.
[0041] Based on the above results, this example selected indicators that were significantly correlated with the Salmonella load and further developed a Salmonella resistance index (CS-index). PCA results ( Figure 4Figure A in the middle) shows that the comprehensive selection index (CS-index) can separate the H-SE group from the L-SE group; in order to verify the accuracy of this resistance index, the ROC curve analysis method was further used. ROC curve results ( Figure 4 Figure B) shows that the AUC values of H / L, mucosal layer thickness, glandular depth, goblet cell number, and IFN-γ were 61.1863, 60.77, 67.4298, 62.7471, and 64.9324, respectively, while the AUC value of the comprehensive index was 75.3382, which was significantly higher than that of any single index, indicating that this index has a high accuracy in distinguishing between the susceptible and resistant groups of Salmonella.
[0042] In this example, the comprehensive selection index (CS-index) under Salmonella uninfected conditions was calculated, and the middle value (0.0447) was used as the threshold. The group with a value above the threshold of 0.0447 was the resistant group (R-Ctrl), and the group with a value below the threshold of 0.0447 was the susceptible group (S-Ctrl).
[0043] The control group was divided into a resistant group (R-Ctrl) and a susceptible group (S-Ctrl) according to the comprehensive indicators. The results showed that the CS-index, mucosal thickness, glandular depth and goblet cells in the S-Ctrl group were significantly lower than those in the R-Ctrl group, while the serum IL-6 and IL-8 levels were significantly higher than those in the R-Ctrl group ( P <0.05). It was confirmed that CS-index can effectively distinguish between poultry resistant and susceptible to Salmonella ( Figure 5 ).
[0044] The comprehensive Salmonella resistance index provided by this invention integrates multi-dimensional data, including key factors such as the physiological status and immune response of poultry, to accurately distinguish between resistant and susceptible individuals. This assessment index not only improves the efficiency and accuracy of disease resistance assessment but also provides important theoretical support for Salmonella-resistant breeding. Through the application of this system, it is expected to achieve efficient and sustainable development of poultry production, while also contributing to food safety and public health.
[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. A method for judging the resistance of poultry Salmonella based on resistance indexes, characterized in that: The resistance indexes include: intestinal mucosal layer thickness, intestinal gland depth, goblet cell number per unit length, heterophil to lymphocyte ratio and IFN-γ concentration.
2. The method for judging the resistance of poultry Salmonella based on resistance index according to claim 1, characterized in that: Use the minimum-maximum normalization method to eliminate the influence of different dimensions: first, according to the formula X new =X-X min / X max -X min Each resistance index was normalized separately; According to the formula CS-index = ∑0.20 × X new Calculate the comprehensive evaluation index; in the formula, X new is the dimensionless value converted by the minimum-maximum normalization method; X max is the maximum value of all measurements, X min is the minimum value of all measured values; CS-index is a comprehensive evaluation index.
3. The method for judging the resistance of poultry Salmonella based on resistance index according to claim 2, characterized in that: When the CS-index value was higher than the median value of the control group, the poultry from which the sample came was judged to be resistant to Salmonella; Preferably, the median value of the control group is 0.0447.
4. The method for judging the resistance of poultry Salmonella based on resistance index according to any one of claims 1 to 3, characterized in that: The method for measuring the intestinal mucosal layer thickness and intestinal gland depth is as follows: use a panoramic slice scanner to scan and image the tissue information on the tissue slice; use browsing and analysis software to magnify the scanned image by 25-400 times for observation; select 3-4 target areas of the tissue for imaging; measure the intestinal mucosal layer thickness and intestinal gland depth at 3-5 locations in each slice, and calculate the average value.
5. The method for judging the resistance of poultry Salmonella based on resistance index according to any one of claims 1 to 3, characterized in that: The method for determining the number of goblet cells per unit length is as follows: use a panoramic slice scanner to scan and image all tissue information on the tissue slice; use scanning software to select the intestinal mucosal layer area for 50-800 times imaging; measure the length of the intestinal glandular epithelium at 4-6 locations in each slice; count the number of goblet cells in the corresponding length; calculate the number of goblet cells per unit length = number of goblet cells / length of intestinal glandular epithelium.
6. The method for judging the resistance of poultry Salmonella based on resistance index according to any one of claims 1 to 3, characterized in that: The ratio of heterophils to lymphocytes is determined by air-drying a blood smear, staining it, and calculating the ratio of heterophils to lymphocytes in 50-200 white blood cells under microscope magnification.
7. The method for judging the resistance of poultry Salmonella based on resistance indexes according to any one of claims 1 to 3, characterized in that: The IFN-γ concentration in serum samples was detected by enzyme-linked immunosorbent assay.
8. The method for judging the resistance of poultry Salmonella based on resistance indexes according to any one of claims 1 to 7, characterized in that: The poultry includes chickens.
9. CS-index, an indicator for judging the resistance of poultry to Salmonella, is characterized by: include: Intestinal mucosal layer thickness, intestinal gland depth, number of goblet cells per unit length, ratio of heterophils to lymphocytes and IFN-γ concentration.
10. A kit for determining the resistance of poultry to Salmonella, characterized in that: Comprising a reagent for detecting the indicator CS-index as claimed in claim 9.