Modified aminoacyl-tRNA synthetase, nucleic acid construct and genetic engineering strain

Abstract

The invention provides a modified aminoacyl-tRNA synthetase, a nucleic acid construct and a genetic engineering strain. The recombinant aminoacyl-tRNA synthetase provided by the invention can obviously improve the introduction efficiency of non-natural amino acids in IVTT no matter the recombinant aminoacyl-tRNA synthetase is exogenously added or integrated into cells.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more preferably, to an aminoacyl-tRNA synthetase, its nucleic acid construct, genetically engineered strain, and their applications in cell-free synthesis of non-natural amino acid-containing proteins. Background Art

[0002] Whether it is for protein structure and function research or the production of antibody-drug conjugates, there is an increasing need to introduce new functional groups into the polypeptide chain of proteins. This can be achieved by using an orthogonal protein translation system to incorporate non-natural amino acids with special chemical functional groups into the peptide chain according to a preset genetic codon. Although the introduction of non-natural amino acids can be achieved intracellularly, due to competition with the classical protein translation system and the fact that the special chemically active side chain groups of non-natural amino acids often prevent them from freely crossing the cell membrane, the cell-free in vitro protein translation system has irreplaceable advantages for the large-scale production of non-natural amino acid-containing proteins.

[0003] Since the cell-free in vitro protein translation system is not restricted by the cell membrane, theoretically, the reaction can be promoted by increasing the concentration of the main components in the reaction system. The non-natural amino acid is catalyzed by a specific aminoacyl-tRNA synthetase to form aminoacyl-tRNA, which is transported to the ribosome and, through codon pairing, the non-natural amino acid is assembled into the peptide chain under the catalysis of the ribosome. Among them, the binding ability of non-natural aminoacyl-tRNA to the transport protein and its matching degree with the ribosome are relatively weak compared to classical aminoacyl-tRNA, which is not conducive to the reaction. Therefore, it is necessary to increase the substrate concentration to promote the reaction. The orthogonal aminoacyl-tRNA synthetases used for the introduction of non-natural amino acids are usually obtained by mutating the substrate-binding site of natural aminoacyl-tRNA synthetase, and the change in substrate specificity often comes at the cost of a decrease in catalytic activity. To compensate for this decrease in activity, it is necessary to use a high concentration of enzyme or tRNA or non-natural amino acid to drive the reaction in the direction favorable for peptide chain synthesis.

[0004] The commonly used orthogonal translation system pylrs-tRNA CUA pyl derives from the archaeal Methanosarcina mazei and Methanosarcina barkeri PylRS (MmPylRS, MbPylRS). Due to its special structure, pylrs does not rely on the anticodon loop for tRNA recognition and has substrate recognition plasticity. Through directed evolution, using pylrs

[0005] –tRNA CUA pyl it has been possible to introduce more than 200 non-natural amino acids.

[0006] However, there is a less soluble N-terminal domain in the structures of both MmPylRS and MbPylRS, resulting in poor solubility. Even after codon optimization, it is difficult to increase the expression levels of MmPylRS and MbPylRS in Escherichia coli, and the protein concentration still cannot exceed 8 mg / ml after concentration. The advantages of the cell-free in vitro protein translation system cannot be fully utilized, and the incorporation efficiency of unnatural amino acids is very low, making it unsuitable for practical production applications.

[0007] Methanomethylophilus alvus PylRS (PylRS) is an aminoacyl-tRNA synthetase. This synthetase belongs to the nucleotide category and its full name is pyrrolysyl-tRNA synthetase, usually abbreviated as PylRS. The main function of PylRS is to help prokaryotes synthesize and use a special amino acid, pyrrolysine (Pyl), which does not exist in all known eukaryotes. [1] 。

[0008] Methanomethylophilus alvus is a methane-producing archaeon originally isolated from the stomach of ruminant cattle. PylRS was discovered by sequence analysis of the M. alvus genome and can be used to modify foreign proteins and express new biological activities, so it has important application value in the field of synthetic biology.

[0009] Recently, Chin et al. discovered pylrs (MaPylRS) from Methanomethylophilus alvus, which has similar catalytic domains and tRNA-binding domains to MmPylRS and MbPylRS, but lacks the N-terminal domain.

[0010] In current scientific research, MaPylRS is mainly applied to the modification of foreign proteins in prokaryotes such as Escherichia coli. [2] There are also reports of successful applications in eukaryotes. [3] 。According to the latest research results, when MaPylRS is expressed in Saccharomyces cerevisiae [4] , it can achieve efficient site-specific insertion of target unnatural amino acids into target proteins. However, in both Escherichia coli and yeast, MaPylRS exists in cells in the form of foreign plasmids, and there is no eukaryotic cell system that directly recombines it into its genome for stable and high-efficiency expression of MaPylRS. [5] 。

[0011] Protein Expression Systems in vitro refer to the synthesis of proteins under non-in vivo conditions such as using cell lysates. By simply adding DNA or RNA templates, RNA polymerase, and necessary components such as amino acids, ATP, and cofactors to the reaction system, the synthesis of target proteins can be completed. Since it does not require the complex metabolic steps of whole cells, this system can achieve rapid and efficient large-scale protein production. Due to its high flexibility and simplified process, it has become one of the widely used tools in the biomedical field and scientific research. [6] Currently, commonly used commercial in vitro protein expression systems include the E. coli system (E.coli extract, ECE). [7] Rabbit reticulocyte Lysate (RRL). [8] Wheat germ extract (WGE). [9] Insect cell extract (ICE).

[10] And human-derived systems.

[11] .

[0012] Due to the lack of the N-terminal domain with low solubility, mapylrs is more easily expressed in E. coli, and the final expression product can be concentrated to 40 mg / ml without precipitation. It is suitable for cell-free non-natural amino acid incorporation systems.

[0013] CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated) is an immune system widely present in bacteria and archaea. As part of the organism's defense mechanism, it can recognize and eliminate foreign DNA or RNA invading host cells and has been developed into an efficient and accurate gene editing tool.

[12] This technology can precisely cut DNA, enabling researchers to increase or decrease specific parts of genes to study their functions and can also be used to treat certain genetic diseases.

[13] 。When using the CRISPR / Cas9 system for gene editing, a specific gRNA sequence needs to be paired with the Cas9 nuclease protein and delivered into target cells. After the gRNA binds to Cas9, it will be transported to the target genome. During the formation of DNA double-strand breaks, the gRNA regulates the Cas9 enzyme to find the PAM sequence (i.e., "protospacer adjacent motif") on the genome and recognize the 20bp sequence upstream of it. Then, the Cas9 enzyme generates a double-strand break at a position 3 bases upstream of the PAM. Meanwhile, if donor DNA is provided, the broken DNA strands can be ligated through the mechanism of homologous recombination (HDR), thus achieving the purpose of gene modification.

[14] 。There are many examples of using the CRISPR / Cas9 system to modify the genome of Saccharomyces cerevisiae, including gene point mutations, gene knockouts, and gene insertions. [15,16] 。For example, the pCAS plasmid widely used in the prior art has both the Cas9 gene sequence and the gRNA element.

[17] ,It can achieve the genome modification of Saccharomyces cerevisiae through a single transformation. Kluyveromyces is a type of yeast fungus and belongs to a species of Saccharomyces cerevisiae. It has a wide range of industrial applications, especially in the food and beverage industries. Kluyveromyces is widely used in the fermentation processes of food and beverages such as dairy products, wine, and beer. It can break down sugars and produce various enzymes, promoting the fermentation process and giving food good taste and flavor. Compared with other Saccharomyces cerevisiae, Kluyveromyces has some unique characteristics, such as higher temperature adaptability and acid resistance. This makes it more suitable for certain industrial applications under specific conditions, such as high-temperature fermentation and acidic environments. In addition, Kluyveromyces also has many advantages as a host system for expressing pharmaceutical proteins. First, through the design of appropriate gene expression vectors and promoter sequences, Kluyveromyces can achieve high-level expression of foreign genes. Second, Kluyveromyces has a complete protein folding and modification system, which can correctly fold complex pharmaceutical proteins and perform necessary glycosylation modifications. Third, Kluyveromyces is easy to culture and can be expressed solubly intracellularly, facilitating the extraction and purification of target proteins, and the engineering production cost is relatively low. Generally speaking, Kluyveromyces is a host system with great potential and can be used for the efficient expression of pharmaceutical proteins.

[0014] References

[0015] 1.Yanagisawa T,Seki E,Tanabe H,Fujii Y,Sakamoto K,Yokoyama S.CrystalStructure of Pyrrolysyl-tRNA Synthetase from a Methanogenic Archaeon ISO4-G1and Its Structure-Based Engineering for Highly-Productive Cell-Free GeneticCode Expansion with Non-Canonical Amino Acids.Int J Mol Sci.2023Mar 26;24(7):6256.doi:10.3390 / ijms24076256.PMID:37047230;PMCID:PMC10094482.

[0016] 2.Kobayashi T,Yanagisawa T,Sakamoto K,Yokoyama S.Recognition of non-alpha-amino substrates by pyrrolysyl-tRNA synthetase.J Mol Biol.2009Feb 6;385(5):1352-60.doi:10.1016 / j.jmb.2008.11.059.Epub 2008Dec 11.PMID:19100747.

[0017] 3.Beránek V,Willis JCW,Chin JW.An Evolved Methanomethylophilus alvusPyrrolysyl-tRNA Synthetase / tRNA Pair Is Highly Active and Orthogonal inMammalian Cells.Biochemistry.2019 Feb 5;58(5):387-390.doi:10.1021 / acs.biochem.8b00808.Epub 2018 Sep 27.PMID:30260626;PMCID:PMC6365905.

[0018] 4. Stieglitz JT, Lahiri P, Stout MI, Van Deventer JA. Exploration of Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetase Activity in Yeast. ACS Synth Biol. 2022 May 20; 11(5): 1824 - 1834. doi: 10.1021 / acssynbio.2c00001. Epub 2022 Apr 13. PMID: 35417129; PMCID: PMC10112046.

[0019] 5. Avila-Crump S, Hemshorn ML, Jones CM, Mbengi L, Meyer K, Griffis JA, Jana S, Petrina GE, Pagar VV, Karplus PA, Petersson EJ, Perona JJ, Mehl RA, Cooley RB. Generating Efficient Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetases for Structurally Diverse Non-Canonical Amino Acids. ACS Chem Biol. 2022 Dec 16; 17(12): 3458 - 3469. doi: 10.1021 / acschembio.2c00639. Epub 2022 Nov 16. PMID: 36383641; PMCID: PMC9833845.

[0020] 6. Craig D, Howell MT, Gibbs CL, Hunt T, Jackson RJ. Plasmid cDNA-directed protein synthesis in a coupled eukaryotic in vitro transcription-translation system. Nucleic Acids Res. 1992 Oct 11; 20(19): 4987 - 95. doi: 10.1093 / nar / 20.19.4987. PMID: 1383935; PMCID: PMC334274.

[0021] 7. Kim DM, Kigawa T, Choi CY, Yokoyama S. A highly efficient cell-free protein synthesis system from Escherichia coli. Eur J Biochem. 1996 Aug 1;239(3):881-6. doi:10.1111 / j.1432-1033.1996.0881u.x. PMID:8774739.

[0022] 8. Jackson RJ, Hunt T. Preparation and use of nuclease-treated rabbit reticulocyte lysates for the translation of eukaryotic messenger RNA. Methods Enzymol. 1983;96:50-74. doi:10.1016 / s0076-6879(83)96008-1. PMID:6656641.

[0023] 9. Erickson AH, Blobel G. Cell-free translation of messenger RNA in a wheat germ system. Methods Enzymol. 1983;96:38-50. doi:10.1016 / s0076-6879(83)96007-x. PMID:6656637.

[0024] 10. Ezure T, Suzuki T, Higashide S, Shintani E, Endo K, Kobayashi S, Shikata M, Ito M, Tanimizu K, Nishimura O. Cell-free protein synthesis system prepared from insect cells by freeze-thawing. Biotechnol Prog. 2006 Nov-Dec;22(6):1570-7. doi:10.1021 / bp060110v. PMID:17137303.

[0025] 11. Mikami S, Kobayashi T, Masutani M, Yokoyama S, Imataka H. A human cell-derived in vitro coupled transcription / translation system optimized for production of recombinant proteins. Protein Expr Purif. 2008 Dec; 62(2): 190 - 8. doi: 10.1016 / j.pep.2008.09.002. Epub 2008 Sep 11. PMID: 18814849.

[0026] 12. Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 2014 Apr; 32(4): 347 - 55. doi: 10.1038 / nbt.2842. Epub 2014 Mar 2. PMID: 24584096; PMCID: PMC4022601.

[0027] 13. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012 Aug 17; 337(6096): 816 - 21. doi: 10.1126 / science.1225829. Epub 2012 Jun 28. PMID: 22745249; PMCID: PMC6286148.

[0028] 14. Bibikova M, Carroll D, Segal DJ, Trautman JK, Smith J, Kim YG, Chandrasegaran S. Stimulation of homologous recombination through targeted cleavage by chimeric nucleases. Mol Cell Biol. 2001 Jan; 21(1):289 - 97. doi:10.1128 / MCB.21.1.289 - 297.2001. PMID:11113203; PMCID:PMC88802.

[0029] 15. DiCarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Genome engineering in Saccharomyces cerevisiae using CRISPR - Cas systems. Nucleic Acids Res. 2013 Apr; 41(7):4336 - 43. doi:10.1093 / nar / gkt135. Epub 2013 Mar 4. PMID:23460208; PMCID:PMC3627607.

[0030] 16. Bao Z, Xiao H, Liang J, Zhang L, Xiong X, Sun N, Si T, Zhao H.

[0031] Homology - integrated CRISPR - Cas(HI - CRISPR) system for one - step multigene disruption in Saccharomyces cerevisiae. ACS Synth Biol. 2015 May 15; 4(5):585 - 94. doi:10.1021 / sb500255k. Epub 2014 Sep 19. PMID:25207793.

[0032] 17. Ryan OW, Skerker JM, Maurer MJ, Li X, Tsai JC, Poddar S, Lee ME, DeLoache W, Dueber JE, Arkin AP, Cate JH. Selection of chromosomal DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3:e03703. doi: 10.7554 / eLife.03703. PMID: 25139909; PMCID: PMC4161972. Summary of the Invention

[0033] To overcome the deficiencies of the prior art, the present invention designs a histidine tag at the N-terminus and C-terminus of the MaPylRS gene, as well as a thrombin cleavage site for convenient tag excision. It is found that the setting of adding sequences at the N-terminus or C-terminus not only promotes the stability of the enzyme, makes it easier to purify, but also further improves the catalytic activity of the enzyme.

[0034] In addition, in existing literature reports and commercial kits, the MaPylRS protein is added manually from outside, or plasmids containing its expression structure are introduced by transformation / transfection, etc., which have adverse effects on the judgment of experimental results, the complexity and stability of experimental results, and the production cost of target proteins. The present invention integrates the MaPylRS gene into the Kluyveromyces yeast genome through the CRISPR / Cas9 high-efficiency gene editing system to achieve stable and efficient expression of the MaPylRS gene in yeast without the need for antibiotic screening and maintenance, and on this basis, realizes the insertion of unnatural amino acids into the target protein.

[0035] The first invention of the present invention provides a recombinant aminoacyl-tRNA synthetase having the structure shown in Formula I:

[0036] A1 - A2 - A3 - A4 (I):

[0037] In Formula I,

[0038] A1 is absent or is a histidine tag;

[0039] A2 is absent or is a thrombin cleavage site;

[0040] A3 is absent or is a tag protein;

[0041] A4 is an aminoacyl-tRNA synthetase;

[0042] "-" is independently a bond or an amino acid linking sequence,

[0043] And at least one of A1 to A3 exists.

[0044] The connection between A1 to A4 can be either from the N-terminus to the C-terminus or from the C-terminus to the N-terminus.

[0045] Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS), or TrP-tRNA synthetase (TrpRS).

[0046] Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, or BsTrpRS.

[0047] Further preferably, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS.

[0048] Further preferably, the sequence of the aminoacyl-tRNA synthetase is SEQ ID NO: 60.

[0049] Further preferably, the aminoacyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 60 or its active fragment, or is a polypeptide having a homology of ≥ 85% (preferably, ≥ 90% homology; equally preferably ≥ 95% homology; most preferably, ≥ 97% homology, such as above 98%, above 99%) with the amino acid sequence shown in SEQ ID NO: 60 and having the same activity as the SEQ ID NO: 60 sequence.

[0050] Further preferably, the structure of the histidine tag is n×His, where 1 ≤ n ≤ 50; preferably 2 ≤ n ≤ 30; further preferably, 5 ≤ n ≤ 20; more preferably 6 ≤ n ≤ 10.

[0051] Further preferably, the tag protein is selected from T7 tag, CBP tag, CMyc tag, FLAG tag, Spot tag, C tag, Avi tag, Streg tag, SUMO tag, GST tag, MBP tag, or a combination thereof; preferably T7 tag.

[0052] Further preferably, the N-terminus or C-terminus of A4 is connected to A1 - A2 - A3:

[0053] Further preferably, a his tag is connected to the N-terminus or C-terminus of the aminoacyl-tRNA synthetase.

[0054] Further preferably, a thrombin cleavage site and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus.

[0055] Further preferably, a his tag, a thrombin cleavage site, and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus.

[0056] Further preferably, the amino acid sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO:1 to SEQ ID NO:3 or SEQ ID NO:64.

[0057] Further preferably, the recombinant aminoacyl-tRNA synthetase comprises any one of the sequences of SEQ ID NO:1 to 3, SEQ ID NO:64 or an active fragment thereof, or is a polypeptide having ≥85% homology (preferably, ≥90% homology; equally preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) with any one of the amino acid sequences shown in SEQ ID NO:1 to 3, SEQ ID NO:64 and having the same activity as any one of the sequences of SEQ ID NO:1 to 3, SEQ ID NO:64.

[0058] Further preferably, the coding sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62 or SEQ ID NO:63.

[0059] Further preferably, the coding sequence of the recombinant aminoacyl-tRNA synthetase comprises any one of the sequences of SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 or an active fragment thereof, or is a nucleotide having ≥85% homology (preferably, ≥90% homology; equally preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) with the above nucleotide sequences shown respectively and having the same activity as any one of the sequences of SEQ ID NO:4, SEQ ID NO:61, SEQ ID NO:62 or SEQ ID NO:63.

[0060] The second aspect of the present invention provides a nucleic acid construct encoding the recombinant aminoacyl-tRNA synthetase described in the first aspect of the present invention.

[0061] Further preferably, the nucleic acid construct contains at least a nucleic acid sequence having a structure as described in Formula II: Z1-Z2-Z3-Z4, wherein Z1 to Z4 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is absent or is a coding sequence of a histidine tag, Z2 is absent or is a coding sequence of a thrombin cleavage site, Z3 is absent or is a coding sequence of a tag protein, and Z4 is a coding sequence of an aminoacyl-tRNA synthetase; at least one of Z1 to Z3 is present.

[0062] The structure of Formula II can be from 5' to 3' or from 3' to 5':

[0063] That is, the encoded product of Z1-Z2-Z3 is linked to the N-terminus or C-terminus of the encoded product of Z4.

[0064] More preferably, the encoded product of Z1-Z2-Z3 is linked to the N-terminus of the encoded product of Z4.

[0065] Further preferably, the amino acid sequence encoded by Z1 is HHHHHH; more preferably, the Z1 encoding contains a sequence of HHHHHH or an active fragment thereof, or is a nucleotide having a homology of ≥85% (preferably, ≥90%; equally preferably ≥95%; most preferably, ≥97%, such as above 98%, above 99%) with the above nucleotide sequence shown and having the same activity as the above sequence.

[0066] Further preferably, the amino acid sequence encoded by Z2 is LVPRGS; more preferably, the Z2 encoding contains a sequence of LVPRGS or an active fragment thereof, or is a nucleotide having a homology of ≥85% (preferably, ≥90%; equally preferably ≥95%; most preferably, ≥97%, such as above 98%, above 99%) with the above nucleotide sequence shown and having the same activity as the above sequence.

[0067] Further preferably, the amino acid sequence encoded by Z3 is SEQ ID NO:59; more preferably, the Z encoding contains the sequence shown in SEQ ID NO:59 or an active fragment thereof, or is a nucleotide having a homology of ≥85% (preferably, ≥90%; equally preferably ≥95%; most preferably, ≥97%, such as above 98%, above 99%) with the above nucleotide sequence shown and having the same activity as the above sequence.

[0068] Further preferably, the nucleic acid construct further includes a promoter.

[0069] Further preferably, the nucleic acid structure contains the structure described in Formula III:

[0070] Z5-Z1-Z2-Z3-Z4。

[0071] Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1 or TIF11.

[0072] The third aspect of the present invention provides a vector, which contains the nucleic acid construct provided by the second aspect of the present invention.

[0073] The fourth aspect of the present invention provides a genetically engineered strain, in which one or more sites of the genome of the genetically engineered strain are integrated with the nucleic acid construct provided by the second aspect of the present invention.

[0074] Further preferably, the site is selected from Lys1-5, glpA or UPF1.

[0075] Further preferably, the nucleic acid construct further comprises a promoter and a terminator.

[0076] Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1, TIF11, GAL1, GAL7 or GAL10.

[0077] Further preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1.

[0078] Further preferably, the genetically engineered strain contains the recombinant aminoacyl-tRNA synthetase provided by the first aspect of the present invention.

[0079] Further preferably, the genetically engineered strain contains the vector provided by the third aspect of the present invention.

[0080] Further preferably, the strain is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

[0081] The fifth aspect of the present invention provides a method for synthesizing a protein incorporating a non-natural amino acid, using the recombinant aminoacyl-tRNA synthetase described in the first aspect of the present invention or using the genetically engineered strain described in the fourth aspect of the present invention to provide the recombinant aminoacyl-tRNA synthetase.

[0082] The sixth aspect of the present invention provides a cell-free system for synthesizing a protein containing a non-natural amino acid, characterized in that the cell-free system at least comprises: (a) a cell extract, and (b) one or more of the recombinant aminoacyl-tRNA synthetase provided in the first aspect of the present invention, the nucleic acid construct provided in the second aspect of the present invention, or the vector provided in the third aspect of the present invention; the cell extract is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

[0083] The seventh aspect of the present invention provides a cell-free system for synthesizing a protein containing a non-natural amino acid, characterized in that the cell-free system at least comprises a cell extract, and the cell extract is from the genetically engineered strain provided in the fourth aspect of the present invention.

[0084] Further preferably, the cell extract is selected from any one of the following sources or combinations: Escherichia coli, Kluyveromyces lactis, wheat germ cells, insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof.

[0085] More preferably, the cell extract is derived from yeast cells.

[0086] Furthermore, the yeast cells are selected from one or a combination of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataea minuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stipitis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, brewer's yeast, molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces.

[0087] Further, more preferably, the Kluyveromyces further includes: Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0088] More preferably, the cell-free system further includes: unnatural amino acids, orthogonal tRNAs, and a template containing the target protein gene sequence, wherein the codons encoding amino acids in the target protein gene sequence are mutated.

[0089] More preferably, the structural formula of the unnatural amino acid is a compound of formula (2) or its salt form.

[0090] Wherein n is selected from natural numbers from 1 to 20, R1 is selected from substituted or unsubstituted C5-C60 aryl or heteroaryl, substituted or unsubstituted C1-C20 alkyl, substituted or unsubstituted C2-C20 alkenyl, or substituted or unsubstituted C2-C20 alkynyl, and A is selected from O or -CH2-.

[0091] In another preferred example, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0092] In another preferred example, n is selected from natural numbers from 1 to 10.

[0093] In another preferred example, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0094] In another preferred example, n is selected from natural numbers from 1 to 6.

[0095] In another preferred example, n is selected from 1, 2, 3, 4, 5 or 6.

[0096] In another preferred example, the said R1 is selected from substituted or unsubstituted aryl or heteroaryl having 5 to 30 carbon atoms.

[0097] In another preferred example, the said R1 is selected from substituted or unsubstituted phenyl.

[0098] In another preferred example, the said R1 is selected from substituted or unsubstituted alkenyl having 2 to 20 carbon atoms.

[0099] In another preferred example, the said R1 is selected from substituted or unsubstituted alkenyl having 2 to 10 carbon atoms.

[0100] In another preferred example, the said R1 is selected from substituted or unsubstituted alkenyl having 2 to 6 carbon atoms.

[0101] In another preferred example, the said R1 is selected from substituted or unsubstituted alkynyl having 2 to 20 carbon atoms.

[0102] In another preferred example, the said R1 is selected from substituted or unsubstituted alkynyl having 2 to 10 carbon atoms.

[0103] In another preferred example, the said R1 is selected from substituted or unsubstituted alkynyl having 2 to 6 carbon atoms.

[0104] In another preferred example, the said A is selected from O.

[0105] In another preferred example, the said A is selected from -CH2-.

[0106] In another preferred example, the substituents are common substitution groups in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxyl, mercapto, ester group, carboxyl group, cyano group, halogen, nitro group, sulfonic acid group, azide group, alkenyl, alkynyl, phosphate group, etc.

[0107] In another preferred example, the structural formula of the said unnatural amino acid is selected from one or a combination of the following, or its salt form:

[0108]

[0109] Further preferably, the target protein is selected from: luciferin protein, luciferase (such as firefly luciferase), fluorescent protein (such as green fluorescent protein, yellow fluorescent protein), aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, luciferase mutant, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase or a combination thereof.

[0110] Further preferably, the target protein includes wild-type protein, mutant protein or recombinant protein.

[0111] The eighth aspect of the present invention provides a method for preparing the genetically engineered strain described in the fourth aspect of the present invention, which is characterized in that the nucleic acid construct described in the second aspect of the present invention is transferred into or integrated into cells by transformation, transfection or gene editing technology.

[0112] Further preferably, the nucleic acid construct described in the second aspect of the present invention is integrated into the genome of the cell by gene editing technology.

[0113] Further preferably, the nucleic acid construct is integrated into the genome of the cell through the active site.

[0114] Further preferably, the nucleic acid construct further comprises a promoter and a terminator.

[0115] Further preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1 or TIF11.

[0116] Further preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1.

[0117] Further preferably, the site is selected from Lys1-5, glpA or UPF1.

[0118] The ninth aspect of the present invention provides a kit, which is characterized in that the kit contains the reaction system described in the sixth aspect or the seventh aspect of the present invention.

[0119] The tenth aspect of the present invention provides a method for in vitro synthesizing a protein containing unnatural amino acids, which is characterized in that it is prepared by using the cell-free system described in the sixth aspect or the seventh aspect of the present invention or the kit described in the ninth aspect of the present invention.

[0120] The advantages of the present invention are as follows:

[0121] (1) Structures containing His tags were designed at the N-terminus and C-terminus of the natural or modified MaPylRS synthetase, which further promoted the stability of the enzyme, made it easier to purify, and increased the catalytic activity of the enzyme, facilitating the improvement of the incorporation efficiency of unnatural amino acids.

[0122] (2) Connecting His tag, T7 tag, and thrombin cleavage site at the N-terminus of the natural or modified MaPylRS synthetase further promoted the stability of the enzyme, made it easier to purify, and increased the catalytic activity of the enzyme, facilitating the improvement of the incorporation efficiency of unnatural amino acids.

[0123] (3) T7 tag and thrombin cleavage site at the N-terminus of the natural or modified MaPylRS synthetase further promoted the stability of the enzyme, made it easier to purify, and increased the catalytic activity of the enzyme, facilitating the improvement of the incorporation efficiency of unnatural amino acids.

[0124] (4) Through CRISPR / Cas9 and combined with an efficient transformation technique, the present invention integrated the recombinant expression structure of the aforementioned designed MaPylRS into the cell genome, achieving the stable presence of MaPylRS in the cell genome and the continuous expression of MaPylRS protein.

[0125] (5) Preparing Kluyveromyces yeast strains inserted with recombinant MaPylRS into an in vitro expression system achieved site-directed incorporation of unnatural amino acids into exogenous target proteins, greatly simplified the preparation steps, saved costs, and increased the stability of proteins synthesized with inserted unnatural amino acids. Description of the Drawings

[0126] Figure 1 Shows the construction diagram of long N-terminal mapylrs

[0127] Figure 2 Shows the construction diagram of N-his mapylrs

[0128] Figure 3 Shows the construction diagram of C-his mapylrs

[0129] Figure 4 Shows the electrophoresis diagrams of the lysed supernatants of three proteins after induction. Among them, 1 represents long N-terminal mapylrs, 2 represents N-his mapylrs, and 3 represents C-his mapylrs. The mapylrs protein with a longer N-terminal has a higher expression level and higher protein solubility. The highest protein concentration can reach 120 mg / mL (3.4 mM).

[0130] Figure 5 It shows the activity comparison of proteins expressed by three forms of constructs at the same concentration when importing unnatural amino acids. All three forms of mapylrs can catalyze the expression of proteins containing unnatural amino acids. In the figure, the inverted triangles represent the case without adding unnatural amino acids, and the dots represent the case with added unnatural amino acids. nhis represents N-his mapylrs, chis represents C-his mapylrs; N-terminal represents long N-terminal mapylrs.

[0131] Figure 6 It shows the activity comparison of the original mapylrs (referring to non-recombinant mapylrs) and recombinant mapylrs (long N-terminal mapylrs and N-his mapylrs) when importing unnatural amino acids. In the figure, nhis represents N-his mapylrs, long terminal represents long N-terminal mapylrs. In each comparison bar graph, the left part represents the case with added unnatural amino acids, and the right part represents the case without added unnatural amino acids.

[0132] Figure 7 It shows the RFP / GFP comparison of the original mapylrs and recombinant mapylrs (long N-terminal mapylrs and N-his mapylrs) when importing unnatural amino acids. In the figure, nhis represents N-his mapylrs, long terminal represents long N-terminal mapylrs, and no tag represents the original mapylrs.

[0133] Figure 8 It shows the schematic diagram of the pKM-CAS1.0-KlLys1-5 plasmid structure.

[0134] Figure 9 It shows the schematic diagram of the pKM-MaPylRS plasmid structure.

[0135] Figure 10 It shows the schematic diagram of the pKM-CAS1.0-KlglpA plasmid structure.

[0136] Figure 11 It shows the schematic diagram of the pKM-CAS1.0-KlUPF1 plasmid structure.

[0137] Figure 12 It shows the RFP activity graph measured in Example 9.

[0138] Figure 13 It shows the GFP activity graph measured in Example 9.

[0139] Figure 14 It represents the RFP / GFP activity diagram measured in Example 9.

[0140] Figure 15 It represents the GFP activity diagram measured in Example 10.

[0141] Figure 16 It represents the RFP activity diagram measured in Example 10.

[0142] Figure 17 It represents the RFP / GFP activity diagram measured in Example 10.

[0143] In the drawings of this article, wherever "non" or "control" appears, it means that non-natural amino acids were not added in the reaction. Detailed implementation manners

[0144] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other.

[0145] The present invention will be further described below in combination with the detailed implementation manners and embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions in the following embodiments, preferably follow and refer to the conditions guided by the detailed implementation manners described above, and then follow the conventional conditions, or the conditions recommended by the manufacturer.

[0146] Unless otherwise specified, the percentages and parts mentioned in the present invention are weight percentages and weight parts.

[0147] Unless otherwise specified, the materials and reagents used in the embodiments of the present invention are all commercially available products.

[0148] Unless otherwise specified, the temperature unit in this application is degrees Celsius (°C).

[0149] Nouns and terms

[0150] The following are the explanations or descriptions of the meanings of some relevant "nouns" and "terms" adopted in the present invention, so as to better understand the present invention. The corresponding explanations or descriptions apply to the whole text of the present invention, both to the following text and to the above text. When the present invention involves citing documents, the definitions of relevant terms, nouns, and phrases in the cited documents are also cited. However, when there is a conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When there is a conflict between the definitions in the cited documents and the definitions in the present invention, it does not affect the components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc. determined in the cited documents to prevail.

[0151] In the present invention, preferred embodiments such as "preferred", "more preferred", "even more preferred", "most preferred", "further preferred", etc. do not impose any limitation on the scope of coverage and protection of the invention, and are not used to define the scope and implementation of the present invention. They are only used to provide some embodiments as examples.

[0152] In the description of the present invention, for preferred embodiments such as "one of the preferred", "one of the preferred embodiments", "one of the preferred implementation manners", "one of the preferred examples", "preferred examples", "in a preferred implementation manner", "in some preferred examples", "in some preferred manners", "preferably", "preferred", "preferably", "more preferably", "even more preferably", "further preferably", "most preferably", etc., as well as illustrative listing manners such as "one of the implementation manners", "one of the manners", "examples", "specific examples", "for example", "as an example", "for instance", "such as", etc., they also do not impose any limitation on the scope of coverage and protection of the invention. And the specific features described by each manner are included in at least one specific implementation manner of the present invention. In the present invention, the specific features described by each manner can be combined in a suitable manner in any one or more specific implementation manners. In the present invention, the technical features or technical solutions corresponding to each preferred manner can also be combined by any suitable means.

[0153] In the present invention, "any combination thereof" means "greater than 1" in terms of quantity, and in terms of the scope of coverage, it means a group composed of the following situations: "optionally any one, or a group composed of at least any two of them".

[0154] In the present invention, descriptions such as "one or more", "one or more kinds", etc. of "one or more" have the same meaning as "at least one", "at least one kind", "its combination", "or its combination", "and its combination", "or any combination thereof", "and any combination thereof", etc., and can be used interchangeably, indicating a quantity equal to "1" or "greater than 1".

[0155] In the present invention, the use of "or / and", "and / or" means "optionally one or optionally its combination", and also means at least one.

[0156] The term "about" may refer to a value or composition within an acceptable error range of a specific value or composition determined by those of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0157] Sequence identity (or homology) is determined by comparing two aligned sequences along a predefined comparison window, which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein, and determining the number of positions at which identical residues occur. Usually, this is expressed as a percentage. Methods for measuring sequence identity of nucleotide sequences are well known to those skilled in the art.

[0158] The prior art means described in the present invention in a "usual", "conventional", "general", "frequent", "often" and other ways are also cited as references for the content of the present invention. Without special instructions, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention.

[0159] All documents mentioned in the present invention and the documents directly or indirectly cited by these documents are cited as references in this application, just as each document is cited separately as a reference.

[0160] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form new or preferred technical solutions, as long as they can be used to implement the present invention. Due to space limitations, they will not be repeated one by one.

[0161] An in vitro protein synthesis reaction refers to a reaction for synthesizing proteins in an in vitro cell-free synthesis system, which at least includes a translation process. It includes but is not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription-translation reaction), IVDTT reaction (in vitro replication-transcription-translation reaction). In the present invention, the IVTT reaction is preferred. The IVTT reaction, corresponding to the IVTT system, is a process of transcribing and translating DNA into protein in vitro. Therefore, we also refer to such an in vitro protein synthesis system as a D2P system, a D-to-P system, a D_to_P system, a DNA-to-Protein system; the corresponding in vitro protein synthesis method is also referred to as a D2P method, a D-to-P method, a D_to_P method, a DNA-to-Protein method.

[0162] "Cell-free system" refers to a method of in vitro protein synthesis that does not rely on the secretion and expression of intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to facilitate the reaction, but the added cells do not mainly aim to secrete and express exogenous target proteins. In addition, in the D2P system without intact cells constructed under the guidance of the present invention, a small amount of intact cells are deliberately added (for example, the protein content provided by them does not exceed 30 wt% compared to the protein content provided by the cell extract). Such an "evasion" method is also included within the scope of protection of the present invention.

[0163] Objective protein: The objective expression product of the in vitro protein synthesis system of the present invention is not synthesized by the secretion of host cells, but is synthesized in vitro based on an exogenous nucleic acid template, and can also be referred to as an exogenous protein. The exogenous protein can be a protein, a fusion protein, a mixture containing protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after the in vitro protein synthesis reaction based on the nucleic acid template encoding the target protein can be a single substance or a combination of two or more substances. "Exogenous protein", "objective protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0164] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0165] "The expression system of the present invention", "the in vitro expression system of the present invention", "cell-free in vitro expression system", and "cell-free in vitro expression system" can be used interchangeably, all referring to the in vitro protein expression system of the present invention. Other descriptions can also be used, such as: in vitro protein synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it can include in vitro translation system (which can be abbreviated as IVT system, a type of mR2P system), in vitro transcription and translation system (which can be abbreviated as IVTT system, a type of D2P system), in vitro replication, transcription and translation system (which can be abbreviated as IVDTT system, a type of D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as "Protein Factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). For the components of the in vitro protein synthesis system provided by the present invention, an open description method is adopted. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as the nucleic acid template for protein synthesis, and realizes the in vitro synthesis of the target protein by artificially controlling the addition of substrates required for protein synthesis and substances such as transcription and translation related protein factors.

[0166] In the present invention, "protein" and "protein" have the same meaning and are both translated as protein and can be used interchangeably.

[0167] In the present invention, both "system" and "system" are translated as system and can be used interchangeably.

[0168] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0169] In the present invention, cell extract, cell extract, cell lysate, cell lysate, and cell lysate have the same meaning and can be used interchangeably. The English can be described as cell extract, cell lysate, etc.

[0170] In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0171] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0172] More preferably, the cell-free protein synthesis system further includes one or more components selected from the following groups: substrates for synthesizing RNA, substrates for synthesizing proteins, polyethylene glycol or its analogs, magnesium ions, potassium ions, buffers, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0173] More preferably, the substrates for synthesizing RNA include: one of nucleoside monophosphates, nucleoside triphosphates or a combination thereof.

[0174] More preferably, the substrates for synthesizing proteins include: 20 natural amino acids and unnatural amino acids.

[0175] More preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following groups: magnesium acetate, magnesium glutamate or a combination thereof.

[0176] More preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following groups: potassium acetate, potassium glutamate or a combination thereof.

[0177] More preferably, the energy regeneration system is selected from the following groups: a creatine phosphate / creatine phosphokinase system, a glycolytic pathway and an intermediate product energy system of the glycolytic pathway or a combination thereof.

[0178] More preferably, the energy regeneration system includes a glucose / phosphate system, and the phosphate is selected from the following groups: tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate or a combination thereof.

[0179] More preferably, the buffer is selected from the following groups: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane or a combination thereof.

[0180] More preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the following groups: PEG3000, PEG3350, PEG6000, PEG8000 or a combination thereof.

[0181] Further preferably, the polyethylene glycol includes polyethylene glycols with molecular weights (Da) of 200 - 10,000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc. Preferably, the polyethylene glycol has a molecular weight of 3000 - 10,000.

[0182] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase.

[0183] An alternative embodiment is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4 - (2 - hydroxyethyl) - 1 - piperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphokinase, and RNA polymerase.

[0184] In the present invention, the cell extract does not contain intact cells. Typical cell extracts include ribosomes for protein translation, aminoacyl - tRNA synthetases, initiation factors, elongation factors, and termination release factors required for protein synthesis. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cells, especially soluble proteins.

[0185] In the present invention, the proportion of the cell extract in the cell - free in vitro protein synthesis system is not particularly limited. Generally, the cell extract accounts for 20 - 70% of the system in the cell - free in vitro protein synthesis system, preferably 30 - 60%, more preferably 40 - 50%.

[0186] In the present invention, the protein content of the cell extract is 20 - 100 mg / mL, preferably 50 - 100 mg / mL. The method for measuring the protein content is the Coomassie brilliant blue assay method.

[0187] The present invention also provides a vector or a combination of vectors, and the vector contains the nucleic acid construct of the present invention. Preferably, the vector is selected from: bacterial plasmids, phages, yeast plasmids, animal cell vectors, shuttle vectors; the vector is a transposon vector. The methods for preparing recombinant vectors are well - known to those of ordinary skill in the art. Any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0188] Those of ordinary skill in the art can use well - known methods to construct expression vectors containing the promoter and / or the target gene sequence of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombinant technology, etc.

[0189] Template DNA

[0190] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which can be an original sequence, an artificially synthesized sequence or an artificially modified sequence. Using this template DNA, the corresponding RNA and / or protein can be synthesized.

[0191] In the present invention, the method for preparing the cell extract is not limited. A preferred preparation method

[0192] comprises the following steps:

[0193] (i) Providing cells;

[0194] (ii) Washing the cells to obtain washed cells;

[0195] (iii) Breaking the washed cells to obtain a crude cell extract;

[0196] (iv) Separating the solid and liquid of the crude cell extract to obtain the liquid part, which is the cell extract.

[0197] In the present invention, the solid-liquid separation method is not particularly limited. A preferred method is centrifugation.

[0198] In a preferred embodiment, the centrifugation is carried out in a liquid state.

[0199] In the present invention, the centrifugation conditions are not particularly limited. A preferred centrifugation condition is 5000 - 100000 g, preferably 8000 - 30000 g.

[0200] In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is 0.5 min - 2 h, preferably 20 min - 50 min.

[0201] In the present invention, the temperature of the centrifugation is not particularly limited. Preferably, the centrifugation is carried out at 1 - 10 °C, preferably at 2 - 6 °C.

[0202] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to treat with a washing solution at a pH of 7 - 8 (preferably 7.4). The washing solution is not particularly limited. Typically, the washing solution is selected from the group consisting of potassium 4 - (2 - hydroxyethyl)piperazine - 1 - ethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0203] In the present invention, the method for cell disruption is not particularly limited. A preferred method for cell disruption includes high - pressure disruption, freeze - thaw (such as liquid nitrogen low - temperature) disruption.

[0204] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate. In the present invention, the concentrations of the various nucleotides are not particularly limited. Generally, the concentration of each nucleotide is 0.5 - 5 mM, preferably 1.0 - 2.0 mM.

[0205] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or unnatural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is generally 0.01 - 0.5 mM, preferably 0.02 - 0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0206] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains polyethylene glycol or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1 - 8%, preferably 0.5 - 4%, more preferably 1 - 2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000, and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0207] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited. Generally, the concentration of sucrose is 0.03 - 40 wt%, preferably 0.08 - 10 wt%, more preferably 0.1 - 5 wt%, based on the total weight of the protein synthesis system.

[0208] A particularly preferred in vitro cell-free protein synthesis system, in addition to yeast cell extract, further contains the following components: 22 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid at pH 7.4, 30 - 150 mM potassium acetate, 1.0 - 5.0 mM magnesium acetate, 1.5 - 4 mM nucleoside triphosphate mixture, 0.08 - 0.24 mM amino acid mixture, 25 mM phosphocreatine, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphokinase, 1% - 4% polyethylene glycol, 0.5% - 2% sucrose, 0.027 - 0.054 mg / mL T7 RNA polymerase.

[0209] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention.

[0210] They are not used to limit the scope of the present invention. For the experimental methods without specific conditions noted in the following embodiments, they are generally carried out under conventional conditions, such as the conditions described in Sam brook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and weight parts. The present invention takes Kluyveromyces lactis (abbreviated as K. lactis or kl) as an example, but the same design, analysis, and experimental methods are also applicable to other eukaryotic cells such as other yeasts and animal cells, as well as prokaryotic cells.

[0211] The present invention takes Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are also applicable to other lower eukaryotic cells such as other yeasts and higher animal cells. The gene modification method in the present invention is the CRISPR-Cas9 technology, but it is not limited thereto and can be any known and existing gene modification method.

[0212] An in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, reaction mixture system, or reaction mixture, refers to a mixture system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it can be homogeneous or heterogeneous and is allowed to be a liquid system such as a solution, emulsion, suspension, etc.

[0213] The final concentrations of the components in the Protein Factory of the present invention are as follows: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (molar concentration measured as glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate, with the final concentration of each nucleoside triphosphate being 1.8 mM), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine, with the final concentration of each amino acid being 0.7 mM), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM Tris·HCl buffer at pH 8.0, 6% (w / v) trehalose. The preparation process of Kluyveromyces lactis cell extract adopts conventional technical means and is prepared with reference to the method described in CN109593656A. Generally speaking, the preparation steps include: providing an appropriate amount of raw materials of Kluyveromyces lactis cells after fermentation culture, quickly freezing the cells with liquid nitrogen, breaking the cells, and centrifuging to collect the supernatant, thus obtaining the cell extract. The protein concentration in the obtained Kluyveromyces lactis cell extract is 20 - 40 mg / mL. In the following examples, (i.e., prock, N-Ε-propargyloxycarbonyl-L-lysine hydrochloride) is selected as a representative of non-natural amino acids (abbreviated as ncaa), but it is not limited that the ncaa of this application only refers to prock.

[0214] Example 1: Three construction methods of Mapylrs protein:

[0215] First, Long N-terminal mapylrs:

[0216] The N-terminus of Mapylrs protein contains a leader peptide composed of 31 amino acids, which contains a 6*His affinity purification tag, a T7 tag, and a thrombin cleavage site ( Figure 1 ):

[0217] Long N-terminal mapylrs amino acid sequence:

[0218] MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSMTVKYTDAQIQRLREYGNGTYEQKVFEDLASRDAAFSKEMSVASTDNEKKIKGMIANPSRHGLTQLMNDIADALVAEGFIEVRTPIFISKDALARMTITEDKPLFKQVFWIDEKRALRPMLAPNLYSVMRDLRDHTDGPVKIFEMGSCFRKESHSGMHLEEFTMLNLVDMGPRGDATEVLKNYISVVMKAAGLPDYDLVQEESDVYKETIDVEINGQEVCSAAVGPHYLDAAHDVHEPWSGAGFGLERLLTIREKYSTVKKGGASISYLNGAKIN*(SEQ ID NO: 1)

[0219] Theoretical molecular weight: 34349.98 Da

[0220] Second, N-his mapylrs:

[0221] The N-terminus of the Mapylrs protein has only a 6*His affinity purification tag and a flexible linker ( Figure 2 ):

[0222] MGSSHHHHHHSSG TVKYTDAQIQRLREYGNGTYEQKVFEDLASRDAAFSKEMSVASTDNEKKIKGMIANPSRHGLTQLMNDIADALVAEGFIEVRTPIFISKDALARMTITEDKPLFKQVFWIDEKRALRPMLAPNLYSVMRDLRDHTDGPVKIFEMGSCFRKESHSGMHLEEFTMLNLVDMGPRGDATEVLKNYISVVMKAAGLPDYDLVQEESDVYKETIDVEINGQEVCSAAVGPHYLDAAHDVHEPWSGAGFGLERLLTIREKYSTVKKGGASISYLNGAKIN*(SEQ ID NO: 2)

[0223] Theoretical molecular weight of N-his mapylrs: 32091.35 Da

[0224] Third, C-his mapylrs:

[0225] The N-terminus of the Mapylrs protein has one more Gly than the reported sequence, and the C-terminus has an affinity purification tag 6*His( Figure 3 ):

[0226] MGTVKYTDAQIQRLREYGNGTYEQKVFEDLASRDAAFSKEMSVASTDNEKKIKGMIANPSRHGLTQLMNDIADALVAEGFIEVRTPIFISKDALARMTITEDKPLFKQVFWIDEKRALRPMLAPNLYSVMRDLRDHTDGPVKIFEMGSCFRKESHSGMHLEEFTMLNLVDMGPRGDATEVLKNYISVVMKAAGLPDYDLVQEESDVYKETIDVEINGQEVCSAAVGPHYLDAAHDVHEPWSGAGFGLERLLTIREKYSTVKKGGASISYLNGAKINHHHHHH*(SEQ ID NO:3)

[0227] Theoretical molecular weight of C-his mapylrs: 31685.98

[0228] The fourth type, compared with Long N-terminal mapylrs, the his tag is removed:

[0229] MGSSSSGLVPRGSHMASMTGGQQMGRGSMTVKYTDAQIQRLREYGNGTYEQKVFEDLASRDAAFSKEMSVASTDNEKKIKGMIANPSRHGLTQLMNDIADALVAEGFIEVRTPIFISKDALARMTITEDKPLFKQVFWIDEKRALRPMLAPNLYSVMRDLRDHTDGPVKIFEMGSCFRKESHSGMHLEEFTMLNLVDMGPRGDATEVLKNYISVVMKAAGLPDYDLVQEESDVYKETIDVEINGQEVCSAAVGPHYLDAAHDVHEPWSGAGFGLERLLTIREKYSTVKKGGASISYLNGAKIN(SEQ ID NO:63)

[0230] Example 2: Construction of expression plasmid

[0231] Long-N-terminal mapylrs expression plasmid:

[0232] Entrust Sangon Biotech Co., Ltd. to synthesize the full-length mapylrs gene (WP_015505008), and the codons were optimized for E. coli expression. The synthesized gene sequence is:

[0233] Nde I

[0234] CATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCATGACCGTTAAATACACCGATGCGCAGATCCAGCGTCTGCGTGAATACGGTAACGGTACCTACGAACAGAAAGTTTTCGAAGATCTGGCGAGCCGTGATGCGGCGTTCTCTAAAGAAATGAGCGTTGCTTCTACCGATAACGAAAAGAAAATCAAAGGTATGATCGCGAACCCGAGCCGTCACGGCCTGACCCAGCTGATGAACGATATCGCGGATGCTCTGGTTGCTGAAGGTTTCATCGAAGTTCGTACCCCGATCTTCATCTCTAAAGATGCGCTGGCGCGTATGACCATCACCGAAGATAAACCGCTGTTCAAACAGGTTTTCTGGATCGATGAAAAACGTGCGCTGCGTCCGATGCTGGCGCCGAACCTGTATAGCGTTATGCGTGATCTGCGTGATCACACCGATGGTCCGGTGAAAATCTTCGAAATGGGCAGCTGCTTCCGTAAAGAAAGCCACTCTGGTATGCACCTGGAAGAATTCACCATGCTGAACCTGGTTGATATGGGTCCGCGTGGTGATGCGACCGAAGTTCTGAAAAACTACATCAGCGTGGTTATGAAAGCTGCGGGTCTGCCGGATTACGATCTGGTTCAGGAAGAAAGCGATGTTTACAAAGAAACCATCGATGTTGAAATCAACGGCCAGGAAGTTTGCAGCGCGGCGGTTGGTCCGCATTATCTGGATGCGGCGCACGATGTTCACGAACCGTGGTCTGGCGCTGGCTTCGGTCTGGAACGTCTGCTGACCATCCGTGAAAAATACTCTACCGTTAAAAAAGGTGGTGCGAGCATCAGCTACCTGAACGGCGCGAAAATCAACTAA CTCGAG (SEQ ID NO: 4)

[0235] Xho I

[0236] Inserted into the pET28a vector through the NdeI / Xho I restriction sites.

[0237] The N-his maplys and C-his maplys expression vectors were modified on the basis of pET28a-long-terminal mapylrs by PCR. The primers used were as follows:

[0238] N-his mapylrs

[0239] N-his F: CATCACAGCAGCGGCACCGTTAAATACACCGATGCGCAG (SEQ ID NO: 5)

[0240] N-his R: GGTGTATTTAACGGTGCCGCTGCTGTGATGATGATGATG (SEQ ID NO: 6)

[0241] C-his mapylrs:

[0242] C-his vector R:

[0243] GGTGTATTTAACGGTGCCCATGGTATATCTCCTTCTTAAAGttaaac (SEQ ID NO: 7)

[0244] C-his vector F: GCGCGAAAATCAACCACCACCACCACCACCACTGag (SEQ ID NO: 8)

[0245] C-his F: GAGATATACCATGGGCACCGTTAAATACACCGATGCGCAG (SEQ ID NO: 9)

[0246] C-his R: TGGTGGTGGTGGTGGTGGTTGATTTTCGCGCCGTTCAGG (SEQ ID NO: 10)

[0247] The amplified products were digested with DnpI, ligated and transformed into DH5α competent cells. The plasmids were extracted and sequenced.

[0248] Example 3

[0249] 1) Pick a single bacterial colony and inoculate it into 100 ml of LB (containing 100 mg / L kanamycin) and incubate overnight at 37°C.

[0250] 2) Inoculate it into fresh LB medium (containing 100 mg / L kanamycin) at a ratio of 1:100 on the second day, culture it at 37 °C until OD600 ≈ 0.6, add IPTG with a final concentration of 0.1 mM, and induce expression at 16 °C for 20 hr.

[0251] 3) Centrifuge the cells at 4 °C and 5000 rpm for 20 min to collect the cell pellets, and resuspend the cell pellets by adding 100 ml of lysis buffer (25 mM Tris-HCl, 500 mM NaCl, 25 mM imidazole, 5 mM β-mercaptoethanol, 1 mM PMSF, 0.1% Triton X-100) per 20 g of wet cell pellets. Lyse the cells using a high-pressure homogenizer.

[0252] 4) Centrifuge at 4 °C and 20000 rpm for 20 min twice to repeatedly remove bacterial debris. The supernatant is separated and purified for the target protein using a HisTrap affinity chromatography column. Buffer A: 25 mM TrisHCl pH 7.8, 500 mM NaCl, 25 mM imidazole; Buffer B: 25 mM TrisHCl pH 7.8, 150 mM NaCl, 500 mM imidazole;

[0253] 5) After the cell lysate supernatant passes through the affinity chromatography column, rinse the affinity column repeatedly with 10 column volumes (cv) of Buffer A, and then elute the target protein from 0% to 100% gradient with 10 cv of Buffer B.

[0254] 6) Collect and combine the fractions containing the target protein, and concentrate the sample using an ultrafiltration centrifugal tube;

[0255] 7) Dialyze the concentrated sample against dialysis buffer: 50% glycerol, 25 mM Hepes pH 7.5, then measure the protein concentration, aliquot, and it can be stored at -80 °C for at least 1 year. As Figure 4 It can be seen that the cell lysate supernatants of the first three forms of recombinant mapylrs after induced expression. The mapylrs protein with a longer N-terminal has a higher expression level and higher protein solubility. The highest protein concentration can reach 120 mg / mL (3.4 mM).

[0256] Example 4 Compare the activities of the proteins purified by three construction methods

[0257] Measure the concentrations of the three proteins using nanodrop, and adjust the concentrations of the three proteins to be the same using ddH2O without DNAase and Rnase.

[0258] Establishment of a non-natural amino acid expression system:

[0259] Protein Factory 100ul

[0260] Prock (unnatural amino acid) 500 mM 1 ul

[0261] matRNA CUA pyl In vitro transcription product (unpurified) 10 ul

[0262] GFP-TAG-RFP dual fluorescence reporter gene PCR product 3 ul

[0263] Final concentration of purified proteins of different forms of Mapylrs 5 uM

[0264] Detect the GFP fluorescence intensity at Ex485 nm / Em535 nm, and detect the RFP fluorescence intensity at Ex535 nm / Em595 nm. According to the fluorescence intensity of RFP and the ratio of RFP / GFP, judge the import efficiency of unnatural amino acids (see specifically Figure 5 )

[0265] It can be seen from Figure 5 that according to RFP / GFP, all three forms of Mapylrs can achieve efficient import of unnatural amino acids and all have high activities. Among them, the N-terminal tag makes it have better activity by stabilizing the protein structure (Long-N-terminal mapylrs).

[0266] Example 5 detects the influence of the activity of the original Mapylrs (i.e., un-recombinant Mapylrs) and the purified products of N-terminal tag mapylrs on the import of unnatural amino acids.

[0267] Compare the activities of the original Mapylrs with Long-N-terminal mapylrs and N-his maplys. The method for measuring activity is the same as that in Example 4, and the dual fluorescence protein expression method is adopted.

[0268] It can be seen from Figure 6 and Figure 7 that compared with the original Mapylrs (no tag in the figure), the activities of Long-N-terminal mapylrs and N-his maplys in importing unnatural amino acids are both improved, indicating that the recombinant Mapylrs obtained after the transformation of the present invention have obvious progress in the import of unnatural amino acids compared with the original Mapylrs.

[0269] To overcome the deficiencies in existing non-natural amino acid insertion systems, where exogenous manual addition of MaPylRS protein is required, or plasmids containing its expression constructs need to be introduced through transformation / transfection, etc., the present invention further discloses integrating the MaPylRS protein into the cell genome through gene editing technology, creating a strain capable of stably and moderately expressing the MaPylRS protein, and thus forming a simple and efficient non-natural amino acid insertion system that does not require exogenous addition of MaPylRS.

[0270] Below, only taking the removal of the his tag from Long-N-terminal maplyrs (i.e., using the fourth construct) as an example, the integration of the MaPylRS protein into the cell genome was verified, which does not limit other MaPylRSs of the present invention.

[0271] Example 6 inserted the MaPylRS expression cassette (i.e., the expression cassette of the fourth construct, the same below) near KlLys1-5 through CRISPR-Cas9 technology

[0272] (1) Retrieval of the KlLys1-5 sequence and determination of the CRISPR gRNA sequence

[0273] To not affect the normal expression of other genes in Kluyveromyces lactis, the present invention inserted the MaPylRS expression construct near the tDNA KlLys1-5 of Kluyveromyces lactis, and after expression, it binds to the non-natural amino acid to perform site-directed insertion.

[0274] i. The tRNA-Lys-CTT-1-5 was retrieved from http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / eukaryota / Kluy_lact_NRRL_Y_1140 / Kluy_lact_NRRL_Y_1140-gene-list.html to obtain the Lys1-5 gene sequence in K. lactis yeast. In the present invention, this sequence was named KlLys1-5 (located at 856274-856346 on chromosome E).

[0275] ii. The PAM sequence (NGG) was searched within 500 bp upstream and downstream of KlLys1-5. Finally, the PAM located downstream of the gene (at positions 856876...856878 on chromosome E) was selected, and the KlLys1-5 gRNA sequence (GTTCCCATTGATCCCATATC (SEQ ID NO: 11), located at positions 856856...856875 on chromosome E) was determined.

[0276] (2) Construction of the KlLys1-5 CRISPR-Cas9 plasmid

[0277] According to the designed gRNA sequence, design two 24-nt primers required for vector construction. gRNA-F1: AATCGTTCCCATTGATCCCATATC (SEQ ID NO: 12); gRNA-R1: AAACGATATGGGATCAATGGGAAC (SEQ ID NO: 13). Dilute the obtained primers to 10 μM. Add 10 μL of each of gRNA-F1 and gRNA-R2 to a PCR tube, mix and centrifuge to the bottom of the tube, and perform annealing according to the following procedure:

[0278] 95°C, 3 min; 72°C, 30 s; 65°C, 2 min; 60°C, 2 min; 55°C, 2 min; 50°C, 2 min; 16°C, 2 min. Then perform the ligation reaction

[0279] A. Reaction system: 1 μL of 10× Buffer, 20 - 50 ng of plasmid, 1 μL of annealed product, 0.2 μL of enzyme, add water to 10 μL.

[0280] B. Reaction procedure: 16°C, 60 min.

[0281] Take 50 μL of commercial E. coli DH5α competent cells, add all the ligation products and mix well, and complete the transformation process according to the instructions. Screen on an LB plate containing 50 mg / L kanamycin and culture overnight. Pick 5 monoclonal colonies and culture them by shaking in LB liquid medium. After sending for sequencing and confirming positive, extract the plasmid and store it, named pKM-CAS1.0-KlLys1-5( Figure 8 ).

[0282] (3) Construction and amplification of donor DNA

[0283] First, construct the donor Donor, that is, the homologous recombination sequence at the KlLys1-5 locus and the MaPylRS expression structure. The promoter of MaPylRS is selected as the KlPGK1 promoter, and the terminator is the ScCYC1 terminator. The methods for constructing and transforming the donor DNA are as follows:

[0284] iii. Gene synthesis of a plasmid containing the MaPylRS expression cassette (named pKM-MaPylRS, see Figure 9) and using it as a template, PCR amplification was carried out with primer PF1: AATGTTCCCATTGATCCCATATCCTTCGAGCGTCCCAAAACC (SEQ ID NO: 14) and primer PR1: TTCAGTTCAAAAACGCCCCGTTCCTCATCACTAGAAG (SEQ ID NO: 15) to obtain the MaPylRS expression cassette fragment.

[0285] iv. Using the Kluyveromyces lactis free plasmid as a template, PCR amplification was carried out with primer PF2: GTTATTAATGTCGTGTGCCATAGGT (SEQ ID NO: 16) and primer PR2: AGGTTTTGGGACGCTCGAAGGATATGGGATCAATGGGAA (SEQ ID NO: 17) to obtain the homologous arm 1 fragment of the KlLys1-5 locus; using the Kluyveromyces lactis free plasmid as a template, PCR amplification was carried out with primer PF3: TTCTAGTGATGAGGAACGGGGCGTTTTTGAACTGAATTTCG (SEQ ID NO: 18) and primer PR3: CAGCATAGCATTTGAGTATTGTG (SEQ ID NO: 19) to obtain the homologous arm 2 fragment of the KlLys1-5 locus.

[0286] v. Mix the above 3 PCR product fragments, dilute them 100 times as a template, and carry out PCR amplification again with primer PF4: ATAGGTCAATTAATAATATGCCAGCAAT (SEQ ID NO: 20) and primer PR4: GGGAGCATAGCATTCAAAAACTTC (SEQ ID NO: 21); then the above 3 fragments can be ligated together by overlap extension PCR to form the linear donor DNA Donor. After sequencing confirmation, it was stored in a -20 °C refrigerator.

[0287] (4) Preparation and transformation of highly efficient Kluyveromyces lactis competent cells

[0288] Preparation of yeast competent cells

[0289] Streak the Kluyveromyces lactis yeast solution on YPD solid medium and pick monoclonal colonies. Incubate them overnight with shaking in 25 mL of 2×YPD liquid medium. Take 2 mL of the yeast solution and continue to incubate it with shaking in 50 mL of liquid 2×YPD medium for 2 - 8 h. Centrifuge at 3000 g for 5 min at 20 °C to collect the yeast cells, add 500 μL of sterile water to resuspend them, and centrifuge to collect the cells under the same conditions. Prepare the competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80 °C.

[0290] Yeast DNA transformation

[0291] Melt the competent cells on ice for 30 s, add 200 ng of the pKM-CAS1.0-KlLys1-5 plasmid, and add 2000 ng of the donor DNA. Perform electroporation at 1.5 kV for 5 mS, and immediately add 1 mL of YPD liquid medium after that. Incubate for 2 - 3 h, pipette 200 μL and spread it on solid YPD (200 μg / mL G418) medium, and culture for 2 - 3 days until single colonies appear.

[0292] (5) Positive identification of gene editing

[0293] Pick 50 - 60 monoclonal colonies on the plate after the transformation of Kluyveromyces lactis. Place each monoclonal colony in 5 μL of yeast lysis solution (Takara Mighty Prep Reagent for DNA). Using the cell lysate as a template, perform PCR amplification with the primers MaR1 (internal primer within the MaPylRS sequence): ATCTCTTACTTGAACGGTGCTA (SEQ ID NO: 22); 1-5F1 (5' outer primer of the KlLys1-5 donor DNA): GGTTATCCATTCAGGC AATGAAG (SEQ ID NO: 23) and the primers Ma F1 (internal primer within the MaPylRS sequence): CCATGTG AGAACCTCTTGG (SEQ ID NO: 24); 1-5R1 (5' outer primer of the KlLys1-5 donor DNA): CAGCATAGCATTTGAGTATTGTG (SEQ ID NO: 25) respectively to detect the CRISPR insertion at the KlLys1-5 locus. The presence of positive bands indicates the successful insertion of the MaPylRS sequence into the target site.

[0294] Example 7 Insertion of the MaPylRS expression cassette near KlglpA by CRISPR-Cas9 technology

[0295] (1) Retrieval of the KlglpA sequence and determination of the CRISPR gRNA sequence

[0296] In order not to affect the normal expression of other genes in Kluyveromyces lactis, in the present invention, the MaPylRS expression construct is inserted near the tDNA KlglpA of Kluyveromyces lactis, and after expression, it binds to unnatural amino acids to perform site-directed insertion.

[0297] i. Retrieve the glpA gene sequence in K. lactis yeast by searching for glycerol-3-phosphate dehydrogenase in https: / / www.genome.jp / kegg / kegg2.html. In the present invention, this sequence is named KlglpA (located at 33084-35012 on chromosome A).

[0298] ii. Search for the PAM sequence (NGG) within the range of 1000-2000 bp upstream of KlglpA. Finally, select the PAM located downstream of the gene (at positions 31956...31958 on chromosome A), and determine the KlglpA gRNA sequence (GAAGTAACTCTAGCCATCGG (SEQ ID NO: 26), located at positions 31936...31955 on chromosome A).

[0299] (2) Construction of the KlglpA CRISPR-Cas9 plasmid

[0300] According to the designed gRNA sequence, design two 24-nt primers required for vector construction. gRNA-F2: AATCGAAGTAACTCTAGCCATCGG (SEQ ID NO: 27); gRNA-R2: AAACCCGATG GCTAGAGTTACTTC (SEQ ID NO: 28). Dilute the obtained primers to 10 μM, add 10 μL of gRNA-F2 and 10 μL of gRNA-R2 to the PCR tube respectively, mix and centrifuge to the bottom of the tube, and perform annealing according to the following program:

[0301] 95°C, 3 min; 72°C, 30 s; 65°C, 2 min; 60°C, 2 min; 55°C, 2 min; 50°C, 2 min; 16°C, 2 min

[0302] Then carry out the ligation reaction

[0303] A. Reaction system: 1 μL of 10× Buffer, 20-50 ng of plasmid, 1 μL of annealed product, 0.2 μL of enzyme, add water to 10 μL.

[0304] B. Reaction program: 16°C, 60 min.

[0305] Take 50 μL of commercially available E. coli DH5α competent cells, add all the ligation products, mix well, and complete the transformation process according to the instructions. Screen on an LB plate containing 50 mg / L kanamycin and culture overnight. Pick 5 monoclonal colonies and culture them by shaking in LB liquid medium. After sending for sequencing to confirm positive, extract the plasmid and store it, named pKM-CAS1.0-KlglpA( Figure 10 ).

[0306] (3) Construction and amplification of donor DNA

[0307] First, construct the donor Donor, that is, the homologous recombination sequence at the KlglpA locus and the MaPylRS expression construct. The promoter of MaPylRS is the KlPGK1 promoter, and the terminator is the ScCYC1 terminator. The methods for constructing and transforming the donor DNA are as follows

[0308] iii. Synthesize a plasmid containing the MaPylRS expression cassette, and use it as a template. Perform PCR amplification with primer PF5: CCATCAGTTACGGTAGATTCTCCAGTGCCTACGTTCCTCATCACTAGAAG (SEQ ID NO: 29) and primer PR5: TGTTTTGCGCTTGGTTTTCTTTGTGGAGAAATTTCTTCGAGCGTCCCA AA (SEQ ID NO: 30) to obtain the MaPylRS expression cassette fragment.

[0309] iv. Use the Kluyveromyces lactis episomal plasmid as a template. Perform PCR amplification with primer PF6: AAATTAAGGCAAACATAC AGG (SEQ ID NO: 31) and primer PR6: CAACAGTTCGGCTTCTAGTGATGAGGAAC GTAGGCACTGGAGAATCTACC (SEQ ID NO: 32) to obtain the homologous arm 1 fragment of the KlglpA locus; use the Kluyveromyces lactis episomal plasmid as a template. Perform PCR amplification with primer PF7: GCTTGAGAAGG TTTTGGGACGCTCGAAGAAATTTCTCCACAAAGAAAACC(SEQ IDNO: 33) and primer PR7: GACCTTTTATTTTGTCACCG (SEQ ID NO: 34) to obtain the homologous arm 2 fragment of the Klgl pA locus.

[0310] v. Mix the above-obtained 3 PCR product fragments, dilute 100 times as the template, and perform PCR amplification again with primer PF8: ATATCGGATGACATGCAGCAA (SEQ ID NO: 35) and primer PR8: TTGTGTACCAAAACTTT CACGG (SEQ ID NO: 36); then, the above 3 fragments can be ligated by overlap extension PCR to form a linear donor DNA Donor. After sequencing confirmation, it is stored in a -20 °C refrigerator.

[0311] (4) Preparation and transformation of competent Kluyveromyces lactis

[0312] Preparation of yeast competent cells

[0313] Streak the Kluyveromyces lactis liquid culture on YPD solid medium and pick a single colony. Incubate it overnight with shaking in 25 mL of 2×YPD liquid medium. Take 2 mL of the bacterial solution and continue to incubate it with shaking in 50 mL of liquid 2×YPD medium for 2 - 8 h. Centrifuge at 3000 g for 5 min at 20 °C to collect yeast cells, add 500 μL of sterile water to resuspend, and centrifuge to collect cells under the same conditions. Prepare a competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80 °C.

[0314] Yeast DNA transformation

[0315] Place the competent cells on ice to thaw for 30 s, add 200 ng of pKM-CAS1.0-KlglpA plasmid, and add 2000 ng of donor DNA. Electroporate at 1.5 kV for 5 mS, then immediately add 1 mL of YPD liquid medium and culture for 2 - 3 h. Pipette 200 μL and spread it on solid YPD (200 μg / mL G418) medium, and culture for 2 - 3 days until single colonies appear.

[0316] (5) Positive identification of gene editing

[0317] Pick 50 - 60 monoclonal colonies on the plate after transformation of Kluyveromyces lactis. Place each monoclonal colony into 5 μL of yeast lysis solution (Takara Mighty Prep Reagent for DNA). Using the cell lysate as a template, perform PCR amplification with primers MaR2 (internal primer within the MaPylRS sequence): CCATGTGAGAACCTCTTGG (SEQ ID NO: 37); glpA F1 (outer primer at the 5' end of the KlglpA donor DNA): AAATTAAGGCAAACATACAGG (SEQ ID NO: 38) and primers Ma F2 (internal primer within the MaPylRS sequence): ATCTCTTACTTGAACGGTGCTA (SEQ ID NO: 39); glpA R1 (outer primer at the 5' end of the KlglpA donor DNA): GACCTTTTATTTTGTCACCG (SEQ ID NO: 40) respectively to detect the CRISPR insertion at the KlglpA locus. The presence of a positive band indicates successful insertion of the MaPylRS sequence into the target site.

[0318] Example 8 Knockout of KlUPF1 and replacement with the MaPylRS expression cassette by CRISPR - Cas9 technology

[0319] (1) Retrieval of the KlUPF1 sequence and determination of the CRISPR gRNA sequence

[0320] According to the literature, the yeast UPF1 protein has been shown to be involved in mRNA degradation. Deleting this gene can slow down the degradation rate of immature mRNA transcripts. Therefore, in the present invention, the KlUPF1 gene is completely knocked out and replaced with the MaPylRS sequence to accumulate non - natural amino acid transcripts, thereby improving the efficiency of non - natural amino acid insertion.

[0321] i. Retrieve "UPF1" in http: / / www.yeastgenome.org / to obtain the ScUPF1 gene sequence in Saccharomyces cerevisiae. Perform BLAST alignment analysis with the UPF1 gene in the NCBI database to determine the UPF1 homologous gene sequence KlUPF1 (located at 567908...570817 on chromosome B) in Kluyveromyces lactis.

[0322] ii. Search for PAM sequences (NGG) at both ends of the KlUPF1 gene and determine the gRNA sequences. The principles for gRNA selection are as follows: moderate GC content, with the standard in this invention being 40%-60% GC content; avoid the presence of poly T structures. Finally, the determined KlUPF1 gRNA1 sequence is TTGGCAAACGCATCGTCATA (SEQ ID NO: 41) and the gRNA1 sequence is CTTAAGGAAGTACAATGGAG (SEQ ID NO: 42).

[0323] (2) Construction of KlUPF1 CRISPR-Cas9 plasmid

[0324] According to the designed gRNA1 and gRNA2 sequences, design two 24nt primers required for vector construction. gRNA-F3: AATCTTGGCAAACGCATCGTCATA (SEQ ID NO: 43); gRNA-R3: AAACTATGACGATGCGTTTGCCAA (SEQ ID NO: 44); gRNA-F4: AATCCTTAAGGAAGTACAATGGAG (SEQ ID NO: 45); gRNA-R4: AAACCTCCATTGTACTTCCTTAAG (SEQ ID NO: 46). Dilute the obtained primers to 10 μM. Add 10 μL of each of gRNA-F and gRNA-R to a PCR tube, mix and centrifuge to the bottom of the tube, and perform annealing according to the following procedure:

[0325] 95°C, 3 min; 72°C, 30 s; 65°C, 2 min; 60°C, 2 min; 55°C, 2 min; 50°C, 2 min; 16°C, 2 min

[0326] After that, perform a ligation reaction.

[0327] A. Reaction system: 1 μL of 10×Buffer, 20-50 ng of plasmid, 1 μL of annealed product, 0.2 μL of enzyme, add water to 10 μL.

[0328] B. Reaction procedure: 16°C, 60 min.

[0329] Take 50 μL of commercially available E. coli DH5α competent cells, add all the ligation products and mix well, and complete the transformation process according to the instructions. Screen on an LB plate containing 50 mg / L kanamycin and culture overnight. Pick 5 monoclonal colonies and culture them by shaking in LB liquid medium. After sending for sequencing to confirm positive, extract the plasmid and store it, named pKM-CAS1.0-KlUPF1( Figure 11 ).

[0330] (3) Donor DNA construction and amplification

[0331] In the present invention, the donor Donor is first constructed, and the coding sequence of UPF1 is replaced with the coding sequence of MaPylRS. That is, the inserted MaPylRS uses the promoter and terminator of UPF1. The methods for constructing and transforming the donor DNA are as follows

[0332] iii. Synthesize a plasmid containing the MaPylRS expression cassette by gene synthesis, and use it as a template. Perform PCR amplification with primer PF9: AGTACAATTAGAATCAAGTTTCCTTATGGGTTCTTCTTCTTCTGG (SEQ ID NO: 47) and primer PR9: TAATATTATTTAATTAATGGATTGATACGCGTTCATGTTTAGTTGATCTTAGCACCGTTC (SEQ ID NO: 48) to obtain the coding sequence of MaPylRS.

[0333] iv. Use the Kluyveromyces lactis episomal plasmid as a template. Perform PCR amplification with primer PF10: CAATGGATACAGTTTCTCGCTA (SEQ ID NO: 49) and primer PR10: ACCAGAAGAAGAAGAACCCATAAGGAAACTTGATTCTAATTGT (SEQ ID NO: 50) to obtain the homologous arm 1 fragment of the KlUPF1 locus; use the Kluyveromyces lactis episomal plasmid as a template. Perform PCR amplification with primer PF11: TTGAACGGTGCTAAGATCAACTAAACATGAACGCGTATCAATC (SEQ ID NO: 51) and primer PR11: CTTCGAGACTTCCAATGATCTC (SEQ ID NO: 52) to obtain the homologous arm 2 fragment of the KlUPF1 locus.

[0334] v. Mix the above-obtained 3 PCR product fragments, dilute them 100 times as a template, and perform PCR amplification again with primer PF12: GATCGTCCATTAGCTTATCTACAAATGCC (SEQ ID NO: 53) and primer PR12: GTGAGAATGCCAGACGAT (SEQ ID NO: 54); then, the above 3 fragments can be ligated together by overlap extension PCR to form the linear donor DNA Donor. After sequencing and confirmation, it is stored in a -20 °C refrigerator.

[0335] (4) Transformation of Kluyveromyces lactis and positive identification

[0336] Preparation of yeast competent cells

[0337] Streak the Kluyveromyces lactis yeast solution on YPD solid medium and pick monoclonal colonies. Incubate them overnight with shaking in 25 mL of 2×YPD liquid medium. Take 2 mL of the yeast solution and continue incubating with shaking in 50 mL of liquid 2×YPD medium for 2 - 8 h. Centrifuge at 3000 g for 5 min at 20 °C to collect the yeast cells, add 500 μL of sterile water to resuspend, and centrifuge to collect the cells under the same conditions. Prepare the competent cell solution (5% v / v glycerol, 10% v / v DMSO) and dissolve the yeast cells in 500 μL of this solution. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -80 °C.

[0338] Yeast DNA transformation

[0339] Place the competent cells on ice to thaw for 30 s, add 200 ng of the pKM-CAS1.0-KlUPF1 plasmid, and add 2000 ng of the donor DNA. Perform electroporation at 1.5 kV for 5 mS, and immediately add 1 mL of YPD liquid medium afterwards. Incubate for 2 - 3 h, pipette 200 μL and spread it on solid YPD (200 μg / mL G418) medium, and incubate for 2 - 3 days until single colonies appear.

[0340] (5) Positive identification of gene editing

[0341] Pick 50 - 60 monoclonal colonies on the plate after the transformation of Kluyveromyces lactis. Place each monoclonal colony in 5 μL of yeast lysis solution (Takara Mighty Prep Reagent for DNA). Using the cell lysis solution as a template, perform PCR amplification with the primers MaR3 (internal primer within the MaPylRS sequence): GTCTCTAGAAGCCAAGTCTTC (SEQ ID NO: 55); UPF1 F1 (outer primer at the 5' end of the KlUPF1 donor DNA): GAACTGCCACGGGCT (SEQ ID NO: 56) and the primers Ma F3 (internal primer within the MaPylRS sequence): GCTGCTCACGACGTTCA (SEQ ID NO: 57); UPF1 R1 (outer primer at the 5' end of the KlUPF1 donor DNA): GCACTGTAATCAGGCAACT (SEQ ID NO: 58) to detect the CRISPR insertion at the KlUPF1 locus. The presence of positive bands indicates successful insertion of the MaPylRS sequence into the target site.

[0342] Example 9 Activity assay

[0343] The genetically modified Kluyveromyces lactis strain was prepared into an in vitro protein synthesis system (IVTT), and a plasmid containing the dual reporter genes of green fluorescent protein GFP and red fluorescent protein RFP (green fluorescent protein, GFP; red fluorescent protein, RFP) was added to determine the ability of the modified strain to insert unnatural amino acids at specific protein sites. GFP is used to detect the overall expression of the protein, while RFP is used to detect whether an unnatural amino acid has been successfully inserted at a specific position, namely the stop codon TAG of GFP. If a red fluorescence signal appears, it indicates that the translation-related protein has read through the stop codon TAG, meaning that the unnatural amino acid has been successfully inserted, while the absence of a red fluorescence signal indicates that the translation-related protein has stopped at the stop codon TAG and the insertion of the unnatural amino acid has failed.

[0344] Taking the Kluyveromyces lactis strain obtained in Example 6 as an example, the promoter in the MaPylRS expression cassette was adjusted to obtain different Kluyveromyces lactis strains, which were prepared into Protein Factory.

[0345] Establishment of an unnatural amino acid expression system:

[0346] Protein Factory 100ul

[0347] Prock (unnatural amino acid) 500mM 1ul

[0348] matRNA CUA pyl In vitro transcription product (unpurified) 10ul

[0349] GFP-TAG-RFP dual fluorescence reporter gene PCR product 3ul

[0350] By detecting the RFP fluorescence intensity, according to the fluorescence intensity of RFP and the ratio of RFP / GFP, the import efficiency of the unnatural amino acid was judged (see specifically Figures 12 - 14 )

[0351] Figures 12 - 14 In, DW14-1 and DW14-2 are two sets of parallel experiments, and the promoter is TIF11; the promoter of DW14-3 is TEF1; DW14-4 and DW14-5 are two sets of parallel experiments, and the promoter is ADH1; DW14-6 and DW14-7 are two sets of parallel experiments, and the promoter is GAP1; DW14-8 and DW14-9 are two sets of parallel experiments, and the promoter is HXK4; the promoter of DW14-10 is PGK1.

[0352] From Figure 12It can be seen that the modified strains have all achieved the readthrough of the stop codon TAG, which proves that the modified strains of the present invention can all achieve the introduction of unnatural amino acids. From Figure 14 It can be seen that the modified strains of the present invention all have a high efficiency of introducing unnatural amino acids. In particular, DW14-4 to DW14-7 and DW14-10 have a very high RFP / GFP value, indicating that they all have a very high efficiency of introducing unnatural amino acids.

[0353] Example 10

[0354] After integrating the modified MaPylRS in Example 6 and the original MaPylRS (Example 5) into yeast, the influence of the resulting reaction system on the activity of ncaa introduction was compared. The specific measurement conditions are shown in Example 9, and the specific results are shown in Figures 15 - 17 , where sl-3 represents the reaction system of yeast integrated with the original MaPylRS, and sl-9 represents the reaction system of yeast integrated with the modified MaPylRS of the present application. Orthogonal tRNA and Prock were added to both systems, and the system without adding ncaa (i.e., non) was used as a control for each. From Figures 15 - 17 It can be seen that the reaction systems obtained by integrating wild-type and modified MaPylRS into yeast cells can both achieve the introduction of ncaa. However, the reaction system obtained after integrating the modified MaPylRS of the present invention into yeast cells can significantly improve the efficiency of ncaa introduction.

[0355] The sequences used in the present invention are shown in Table 1 below

[0356] Table 1

[0357]

[0358]

[0359]

[0360]

[0361]

[0362] Inspired by the above ideal embodiments based on the present application, through the above description, relevant staff can make various changes and modifications completely within the scope of not deviating from the technical idea of this application. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A recombinant aminoacyl-tRNA synthetase having the structure as described in Formula I: A1 - A2 - A3 - A4 (I): In Formula I, "-" is independently a bond or an amino acid linking sequence, A1 is absent or is a histidine tag, A2 is absent or is a thrombin cleavage site, A3 is absent or is a tag protein, A4 is an aminoacyl-tRNA synthetase, and at least one of A1 to A3 is present; the connection between A1 to A4 can be either from the N-terminus to the C-terminus or from the C-terminus to the N-terminus.

2. The recombinant aminoacyl-tRNA synthetase according to claim 1, characterized in that: The aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS), or TrP-tRNA synthetase (TrpRS).

3. The recombinant aminoacyl-tRNA synthetase according to claim 1 or 2, wherein: The aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, or BsTrpRS; preferably, the aminoacyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 60 or its active fragment, and further preferably, the sequence of the aminoacyl-tRNA synthetase is SEQ ID NO: 62; or is a polypeptide having a homology of ≥ 85%, ≥ 90%, ≥ 95%, ≥ 97%, ≥ 98%, or ≥ 99% or more with the amino acid sequence shown in SEQ ID NO: 60 and having the same activity as the SEQ ID NO: 60 sequence.

4. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-3, characterized in that: The structure of the histidine tag is n×His, where 1 ≦ n ≦ 50; preferably 2 ≦ n ≦ 30; further preferably, 5 ≦ n ≦ 20; more preferably 6 ≦ n ≦ 10.

5. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-4, characterized in that: A his tag is connected to the N-terminus or C-terminus of the aminoacyl-tRNA synthetase; or a thrombin cleavage site and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus; or a his tag, a thrombin cleavage site, and a tag protein are connected to the N-terminus of the aminoacyl-tRNA synthetase in the order from the N-terminus to the C-terminus.

6. The recombinant aminoacyl-tRNA synthetase according to any one of claims 1-5, characterized in that: The recombinant aminoacyl-tRNA synthetase described above comprises any one of the sequences of SEQ ID NO: 1 to 3, SEQ ID NO: 64 or an active fragment thereof. Further preferably, the amino acid sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO: 1 to SEQ ID NO: 3 and SEQ ID NO: 64; or is a polypeptide having a homology of ≥85%, ≥90%, ≥95%, ≥97%, ≥98% or ≥99% with any one of the amino acid sequences of SEQ ID NO: 1 to 3, SEQ ID NO: 64 and having the same activity as any one of the sequences corresponding to the homology of SEQ ID NO: 1 to 3, SEQ ID NO: 64; or the coding sequence of the recombinant aminoacyl-tRNA synthetase is selected from any one or more of the following: SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63; or comprises any one of the sequences of SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62 or SEQ ID NO: 63 or an active fragment thereof, or is a nucleotide having a homology of ≥85%, ≥90%, ≥95%, ≥97%, ≥98% or ≥99% with any one of the sequences of SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62 or SEQ ID NO: 63 and having the same activity as any one of the sequences corresponding to the homology of SEQ ID NO: 4, SEQ ID NO: 61, SEQ ID NO: 62 or SEQ ID NO:

63.

7. A nucleic acid construct encoding the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6.

8. The nucleic acid construct according to claim 7, wherein: The nucleic acid construct contains at least the structure as shown in Formula II: Z1-Z2-Z3-Z4, where Z1 to Z4 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is absent or is a coding sequence of a histidine tag, Z2 is absent or is a coding sequence of a thrombin cleavage site, Z3 is absent or is a coding sequence of a tag protein, Z4 is a coding sequence of an aminoacyl-tRNA synthetase; and at least one of Z1 to Z3 is present.

9. The nucleic acid construct according to claim 8, wherein: The amino acid sequence encoded by Z1 is HHHHHH; the amino acid sequence encoded by Z2 is LVPRGS; the amino acid sequence encoded by Z3 is SEQ ID NO:59; or Z1, Z2, and Z3 each encode a sequence containing the sequences of HHHHHH, LVPRGS, and SEQ ID NO:59 or an active fragment thereof, or each has a nucleotide sequence with ≥85%, ≥90%, ≥95%, ≥97%, ≥98%, or ≥99% homology to the nucleotide sequences corresponding to the encoding of HHHHHH, LVPRGS, and SEQ ID NO:59 and each has the same activity as the nucleotide sequences encoding HHHHHH, LVPRGS, and SEQ ID NO:

59.

10. The nucleic acid construct according to claim 8 or 9, characterized in that, It also includes a promoter element. Preferably, the nucleic acid construct contains the structure of formula III: Z5-Z1-Z2-Z3-Z4, wherein Z5 is a promoter element. More preferably, the promoter is selected from PGK1, GAP1, ADH1, HXK1, GAPDH1, TEF1, or TIF11.

11. A carrier, characterized in that, The vector contains the nucleic acid construct according to any one of claims 7-10.

12. A genetically engineered strain, characterized in that, One or more sites in the genome of the genetically engineered strain are integrated with the nucleic acid construct according to any one of claims 7-10, or the genetically engineered strain contains the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6, or the genetically engineered strain contains the vector according to claim 11.

13. The genetically engineered strain according to claim 12, wherein The strain is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

14. The genetically engineered strain according to claim 12 or 13, characterized in that: The site is selected from Lys1-5, glpA, or UPF1.

15. The genetically engineered strain according to any one of claims 12-14, characterized in that: The nucleic acid construct further includes a terminator; preferably, the terminator is selected from CYC1, GPM1, TDH2, or ACT1.

16. A method for synthesizing a protein incorporating unnatural amino acids, characterized in that: The recombinant aminoacyl-tRNA synthetase is provided by using the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6 or by using the genetically engineered strain according to any one of claims 12-15.

17. A cell-free system for synthesizing proteins containing non-natural amino acids, characterized in that, The cell-free system at least includes: (a) a cell extract, and (b) one or more of the recombinant aminoacyl-tRNA synthetase according to any one of claims 1-6, the nucleic acid construct according to any one of claims 7-10, or the vector according to claim 11; the cell extract is derived from one of mammalian cells, plant cells, yeast cells, insect cells, prokaryotic cells or any combination thereof.

18. A cell-free system for synthesizing proteins containing non-natural amino acids, characterized in that, The cell-free system at least includes a cell extract, and the cell extract is from the genetically engineered strain according to any one of claims 12-15.

19. A cell-free system for synthesizing a protein containing a non-natural amino acid according to claim 17 or 18, characterized in that, The cell-free system further includes: unnatural amino acids, orthogonal tRNA, and a template containing the gene sequence of the target protein, and the codons encoding amino acids in the gene sequence of the target protein are mutated.

20. A method for preparing a genetically engineered strain according to any one of claims 12-15, characterized in that, The nucleic acid construct according to any one of claims 7-10 is transferred or integrated into cells by transformation, transfection, or gene editing technology.

21. The preparation method of a genetically engineered strain according to claim 20, characterized in that, Integrate the nucleic acid construct according to any one of claims 7-10 into the genome of a cell through an active site.

22. The preparation method of a genetically engineered strain according to claim 20 or 21, characterized in that, The nucleic acid construct further comprises a terminator; preferably, the terminator is selected from CYC1, GPM1, TDH2 or ACT1.

23. The preparation method of a genetically engineered strain according to claim 21 or 22, characterized in that, The site is selected from Lys1-5, glpA or UPF1.

24. A kit, characterized in that The kit contains the reaction system according to any one of claims 17-19.

25. A method for in vitro synthesizing a protein containing a non-natural amino acid, characterized in that, It is prepared using the cell-free system according to any one of claims 17-19 or the kit according to claim 24.

Images