High-activity transaminase mutant taking L-alanine as amino donor and application of high-activity transaminase mutant in synthesis of L-glufosinate-ammonium
By mutating the amino acid near the amino acid substrate channel, the high-viability amino acid mutant SeTA was constructed, which solved the problem of the low efficiency of catalyzed L-glufosinate in the prior art transaminase, and achieved efficient and economical L-glufosinate synthesis.
Patent Information
- Application Number
- CN202510283897.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-06-27
AI Technical Summary
When the prior art uses transaminase to catalyze the synthesis of L-glufosinate, the efficiency is low, the reaction conditions are harsh, and the product is difficult to separate and purify, resulting in limited industrial application.
Through semi-rational design, the amino acids near the amino acid substrate channel are mutated to construct the high-viability amino acid mutant SeTA, which improves its catalytic vitality on L-alanine, and optimizes the reaction conditions to improve the temporal conversion rate.
High-efficiency asymmetric synthesis of L-glufosinate using L-alanine as the amino donor is achieved, which shortens the reaction time, improves the time-time conversion rate, and reduces industrial production costs.
Smart Images

Figure HDA0005306570460000011 
Figure HDA0005306570460000012 
Figure HDA0005306570460000021
Abstract
Description
(1) Technical Field
[0001] The present invention relates to a highly active transaminase mutant using L-alanine as an amino donor and its application in the asymmetric synthesis of L-glufosinate from the biocatalytic substrate 2-oxo-4-[hydroxy(methyl)phosphoryl]butyric acid. (2) Background Art
[0002] Phosphinothricin (PPT; chemically named ammonium 2-amino-4-[hydroxy(methyl)phosphoryl]butyrate) is a low-toxicity, highly efficient, and broad-spectrum organophosphorus herbicide developed by Hoechst AG (now part of Bayer AG) in the 1980s. It is one of the world's three major herbicides along with glyphosate and paraquat. Phosphinothricin inhibits the glutamine synthetase in plants, disrupting plant metabolism and preventing the synthesis of chlorophyll, thereby causing plant death.
[0003] Phosphinothricin has two optical isomers, namely L-phosphinothricin and D-phosphinothricin, but only the L-configuration has herbicidal activity. It is easily decomposed in the soil, has low toxicity to humans and animals, a broad herbicidal spectrum, and is environmentally friendly. Currently, the phosphinothricin sold on the market is generally a racemic mixture. If phosphinothricin products can be used in the form of pure optical isomers of the L-configuration, the dosage of phosphinothricin can be halved, gradually eliminating the emission of D-phosphinothricin (the inactive form). This is of great significance for improving atom economy, reducing usage costs, and alleviating environmental pressure. Therefore, the efficient synthesis of L-phosphinothricin is an important task.
[0004] There are mainly two existing methods for preparing chiral pure L-phosphinothricin: chemical methods and biological methods. Chemical methods include chemical resolution and chemical synthesis. However, these processes have disadvantages such as the need to use chiral resolution reagents, multiple resolutions, expensive catalysts, and complex reaction routes, making it difficult to achieve large-scale applications. In contrast, biocatalysis has advantages such as mild reaction conditions, high stereoselectivity, and high yields, and is an important trend for the industrial preparation of L-phosphinothricin.
[0005] Biocatalytic methods mainly include kinetic resolution and asymmetric synthesis. The theoretical yield of kinetic resolution does not exceed 50%, while the theoretical yield of asymmetric synthesis can reach 100%. The methods for preparing L-phosphinothricin by biocatalysis include amidase, protease, nitrilase, and transaminase. Among them, amidase is a chiral resolution method that must recover the D-configured by-products. Currently, the activities of nitrilase and protease are not very high, while transaminase is the most efficient and economical method in the preparation of chiral amines. Its asymmetric synthesis of L-phosphinothricin does not require the provision of expensive cofactors such as NADPH and has higher atom economy.
[0006] Transaminases (TAs) are a class of PLP-dependent enzymes that can catalyze the transfer of amino groups between amino donors and amino acceptors. According to the position of the transferred amino group, transaminases can be roughly divided into α-transaminases and ω-transaminases. The drawback of their reaction is that its equilibrium constant is small, and usually an excessive amount of amino donor or a by-product removal system is used to promote product formation. Patent CN1349561A reported an aspartate transaminase (Asp-TA) that uses aspartic acid as an amino donor to synthesize L-glufosinate, which not only has low efficiency, but also requires a reaction temperature of 80 °C. International Patent WO2017151573A1 uses L-glutamic acid as an amino donor, and there is still a large amount of it remaining after the reaction. Moreover, its by-product α-ketoglutaric acid is structurally similar to the product L-glufosinate, resulting in difficult separation and purification of the product.
[0007] L-alanine and isopropylamine are commonly used amino donors for transaminases. They not only have lower costs, but also are easy to separate and purify from the products. Isopropylamine is the cheapest and has the smallest molecular weight, but only a few transaminases can utilize it. Therefore, L-alanine is the best choice for most transamination reactions, and the method for removing its by-product pyruvic acid is mature, making it of great industrial application value.
[0008] In Patent CN105603015B, due to the complete conversion of 100 mM PPO into L-glufosinate by adding an excessive amount of L-alanine, 300 mM of L-alanine still remained in the system at the end. This not only increased the cost of the donor, but also increased the difficulty of product separation and purification, which was not conducive to production. Patent CN 113621592 A obtained a mutant ABAT2-Y138F by modifying the active center of the transaminase. When it catalyzed 20 mM of the substrate PPO, 70 mM of L-alanine needed to be provided, and 20 g / L of wet cells were added and reacted at 40 °C for 10 h, and the conversion rate reached 99%, but the conversion efficiency was extremely low.
[0009] Therefore, it is very important to develop a highly active mutant strain using L-alanine as an amino donor for the asymmetric synthesis of L-glufosinate. (III) Summary of the Invention
[0010] The object of the present invention is to provide a highly active transaminase mutant using L-alanine as an amino donor and its application in the synthesis of L-glufosinate. Through semi-rational design, amino acids near the substrate channel of the transaminase are mutated to construct different mutants to improve the catalytic activity of the transaminase SeTA towards L-alanine, increase the space-time conversion rate, and reduce the industrial production cost.
[0011] The technical solution adopted by the present invention is:
[0012] The present invention provides a highly active transaminase mutant using L-alanine as an amino donor. The transaminase mutant is obtained by single-point mutation or combined mutation of the amino acids at positions 13, 17, 19, and 22 of the amino acid sequence shown in SEQ ID NO.1. The nucleotide sequence of the coding gene corresponding to the amino acid sequence of SEQ ID NO.1 is shown in SEQ ID NO.2.
[0013] Preferably, the transaminase mutant has the amino acid sequence shown in SEQ ID NO.1 mutated into one of the following: (1) asparagine at position 13 is replaced with alanine (N13A), the amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4; (2) arginine at position 17 is replaced with alanine (R17A); (3) valine at position 19 is replaced with alanine (V19A); (4) isoleucine at position 22 is replaced with alanine (I22A); (5) asparagine at position 13 is replaced with alanine and isoleucine at position 22 is replaced with alanine (N13A / I22A); (6) arginine at position 17 is replaced with alanine and isoleucine at position 22 is replaced with alanine (R17A / I22A); (7) valine at position 19 is replaced with alanine and isoleucine at position 22 is replaced with alanine (V19A / / I22A); (8) asparagine at position 13 is replaced with alanine, arginine at position 17 is replaced with alanine, and isoleucine at position 22 is replaced with alanine (N13A / R17A / I22A).
[0014] Due to the particularity of the amino acid sequence, any polypeptide fragment or its variant of the amino acid sequence shown in SEQ ID NO.3 or the mutant, such as its conservative variant, bioactive fragment or derivative, as long as the polypeptide fragment or polypeptide variant has a homology of more than 95% with the aforementioned amino acid sequence, belongs to the scope of protection of the present invention. The variant may include deletions, insertions or substitutions of amino acids in the amino acid sequence; for conservative changes of the variant, the substituted amino acid has a structure or chemical property similar to the original amino acid, such as replacing isoleucine with leucine, and the variant may also have non-conservative changes, such as replacing glycine with tryptophan.
[0015] The present invention also relates to the coding gene of the transaminase mutant.
[0016] Due to the particularity of the nucleotide sequence, any variant of the polynucleotide shown by the coding gene of SEQ ID NO.4 or the mutant, as long as it has a homology of more than 90% with the polynucleotide, falls within the scope of protection of the present invention. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. Such a variant of the polynucleotide can be a naturally occurring allelic variant or a non-naturally occurring variant, including substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of encoding an amino acid.
[0017] The present invention also relates to a recombinant vector containing the coding gene of the transaminase mutant and a recombinant genetically engineered bacterium containing the recombinant vector. The recombinant vector is based on pET28b(+), and the insertion site is between Nco I and Not I. The host bacterium of the recombinant genetically engineered bacterium is preferably Escherichia coli BL21(DE3).
[0018] The key of the present invention lies in the selection of the novel highly active transaminase and its mutation sites. On the premise of knowing the sequence of the novel highly active transaminase and its mutation sites, those of ordinary skill in the art can design mutant primers for site-directed mutagenesis according to the transaminase (Se_WT) shown by SEQ ID NO.1, perform site-directed mutagenesis to construct mutants using the cloning vector carrying the transaminase as a template, use plasmid pET28b(+) or a vector capable of expressing the enzyme as an expression vector, transform the recombinant plasmid into E. coli BL21(DE3) cells or host cells capable of expressing the enzyme, culture the positive monoclonal after high-throughput screening and verification, and obtain the wet cells of the recombinant bacterium containing the mutant of the present invention.
[0019] The present invention also provides an application of the transaminase mutant in the asymmetric synthesis of L-glufosinate from 2-oxo-4-[hydroxy(methyl)phosphoryl]-butyric acid (PPO). The application is as follows: using the wet cells obtained by fermentation culture of the recombinant genetically engineered bacterium containing the coding gene of the transaminase mutant or the pure enzyme solution obtained by nickel column purification after ultrasonic disruption of the wet cells as a catalyst, using 2-oxo-4-[hydroxy(methyl)phosphoryl]-butyric acid as a substrate, using pyridoxal phosphate (PLP) as a coenzyme, using the natural amino acid L-alanine as an amino donor, forming a conversion system in a buffer solution at pH 7.0 - 9.0 (preferably pH 8.5), reacting under the conditions of 30 - 50 °C (preferably 35 °C) and 600 - 800 r / min (preferably 600 r / min). After the reaction is completed, the reaction solution is separated and purified to obtain L-glufosinate.
[0020] Preferably, in the conversion system, the initial addition concentration of the substrate is 20 - 100 mM (preferably 50 mM), the addition amount of wet bacterial cells is 5 - 15 g / L (preferably 10 g / L), the addition amount of coenzyme is 0.1 - 0.5 mM (preferably 0.1 mM), and the addition amount of L-alanine is 50 mM - 150 mM (preferably 75 mM).
[0021] The wet bacterial cells obtained by fermenting and culturing the recombinant genetic engineering bacteria containing the encoding gene of the transaminase mutant of the present invention can be prepared by the following method: constructing a recombinant vector containing the encoding gene of the transaminase mutant with excellent catalytic activity, transforming the recombinant vector into E. coli BL21(DE3), inducing the expression of the obtained recombinant genetic engineering bacteria, and separating wet bacterial cells from the culture solution. Specifically: inoculating the recombinant genetic engineering bacteria containing the encoding gene of the transaminase mutant into an LB liquid medium containing kanamycin resistance with a final concentration of 50 μg / mL, culturing at 37°C and 200 rpm for 10 - 12 h, then inoculating into a fresh TB liquid medium containing kanamycin resistance with a final concentration of 50 μg / mL at an inoculation amount of 1% (v / v), culturing at 37°C and 180 rpm until the OD 600 of the bacterial cells reaches 0.4 - 0.6, adding IPTG with a final concentration of 0.1 mM, inducing and culturing at 28°C for 12 h, then centrifuging at 4°C and 8000 rpm for 10 min, discarding the supernatant, and collecting the wet bacterial cells. The composition of the TB medium: 12 g / L of tryptone, 24 g / L of yeast extract, 12.54 g / L of disodium hydrogen phosphate, 2.31 g / L of sodium dihydrogen phosphate, 5 g / L of glycerol, and the solvent is water.
[0022] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: the present invention provides a new highly active transaminase mutant derived from Salmonella, which asymmetrically synthesizes L-phosphinothricin using L-alanine as the amino donor, not only reducing the amount of L-alanine used, but also improving the space-time conversion rate and reducing the industrial production cost.
[0023] The relative enzyme activities of different mutants in whole cells reached 158.6%-274.3%, and among them, Se_N13A was the optimal mutant. When reacting with 50 mM substrate, the time for Se_WT to reach the reaction equilibrium was 18 h, and the times for Se_N13A, Se_R17A, Se_V19A, and Se_I22A to reach the reaction equilibrium were 8 h respectively. The times for Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, and Se_N13A / R17A / I22A to reach the reaction equilibrium were 12 h; the yield of L-glufosinate at equilibrium was 41.5%, and the e.e. of the product was ≥99.9%. Compared with the wild-type transaminase Se_WT, the reaction time of mutants Se_N13A, Se_R17A, Se_V19A, and Se_I22A was shortened by 10 h, and the space-time conversion rate was increased by 1.8 times. The reaction time of Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, and Se_N13A / R17A / I22A was shortened by 6 h, and the space-time conversion rate was 1.5 times that of the original enzyme. These mutants have created good application prospects for the asymmetric synthesis of L-glufosinate using L-alanine as the amino donor by transaminase. (IV) Description of the Drawings
[0024] Figure 1 It is the nucleic acid gel electrophoresis pattern of the transaminase Se_WT mutants; a represents single-site mutations; b represents iterative combinatorial mutations.
[0025] Figure 2 It is the SDS-PAGE electrophoresis pattern of the transaminase Se_WT and its mutants; a represents the crude enzyme solution and pure enzyme solution of single-site mutants; b represents the pure enzyme solution of iterative combinatorial mutants.
[0026] Figure 3 It is the relative activity of the transaminase Se_WT and its single-site alanine mutants.
[0027] Figure 4 It is the relative activity of the transaminase Se_WT and its iterative alanine mutants.
[0028] Figure 5 It is the reaction progress diagram of the transaminase Se_WT and its mutants for synthesizing L-glufosinate. (V) Specific Embodiments
[0029] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:
[0030] Sequence Description
[0031] SEQ ID NO.1 is the amino acid sequence of the transaminase Se_WT.
[0032] SEQ ID NO.2 is the nucleotide sequence of the transaminase Se_WT.
[0033] SEQ ID NO.3 is the amino acid sequence of the transaminase Se_N13A.
[0034] SEQ ID NO.4 is the nucleotide sequence of the transaminase Se_N13A mutated from Se_WT.
[0035] The composition of the LB liquid medium used in the examples of the present invention: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, and the solvent is water. The composition of the LB plate is to add 20 g / L of agar to the LB liquid medium. The composition of the TB liquid medium: tryptone 12 g / L, yeast extract 24 g / L, disodium hydrogen phosphate 12.54 g / L, sodium dihydrogen phosphate 2.31 g / L, glycerol 5 g / L, and the solvent is water.
[0036] Example 1: Construction of transaminase mutants
[0037] 1. Screening of mutation sites
[0038] Synthesize the fragment (WP_001095559.1) annotated as "4-aminobutyrate--2-oxoglutarate transaminase" from Salmonella in NCBI artificially, and use the online server AlphaFold2 (AlphaFold2.ipynb-Colab) for homology modeling. After obtaining the three-dimensional structure, it provides guidance for the selection of the mutation region. Since the cracks and channels in the protein structure are the key to affecting the transport efficiency of substrates / products, after docking the three-dimensional structure of the protein with the substrate, 15 amino acids located around the substrate were selected as mutation sites, namely N13, R17, V19, I22, P24, T26, L146, T149, H153, S156, P163, Y167, V285, I289, P291.
[0039] 2. Construction and screening of single-site mutants
[0040] Extract the recombinant transaminase plasmid pET28b-Se_WT (CN 114921432 A) containing the transaminase from Salmonella enterica (WP_001095559.1) as the starting template, and use the primers in Table 1 to mutate asparagine at the 13th position, arginine at the 17th position, valine at the 19th position, isoleucine at the 22nd position, etc. of the wild-type Se_WT (the amino acid sequence is as shown in SEQ ID NO.1, and the nucleotide sequence is as shown in SEQ ID NO.2) to alanine (GCA) at the above 15 sites respectively.
[0041] Table 1. Single-point alanine mutation primer sequence list (5' to 3')
[0042] Primer Name Primer Sequence (5’ to 3’) N13A-F CGTCACGCAGCTGTTCCGCGTGGTGTTGG N13A-R AACAGCTGCGTGACGACGCTGCATCAG R17A-F CAACGCTGTTCCGGCAGGTGTTGGTCAG R17A-R CCAACACCTGCCGGAACAGCGTTGTGACG V19A-F CGTGGTGCAGGTCAGATCCACCCGATCTTCGC V19A-R ACCACGCGGAACAGCGTTGTGACGACGCTGCA I22A-F TGTTGGTCAGGCACACCCGATCTTCGCTGAACG I22A-R GGTGTGCCTGACCAACACCACGCGGAACAGCG P24A-F GATCCACGCAATCTTCGCTGAACGTGCTGAAA P24A-R CGAAGATTGCGTGGATCTGACCAACACCACGC T26A-F ACCCGATCGCAGCTGAACGTGCTGAAAACTGC T26A-R TTCAGCTGCGATCGGGTGGATCTGACCAACAC L146A-F CTACACCGCATCTCTGACCGGTAAAGTTCACCC L146A-R TCAGAGATGCGGTGTAGTGGGTACGACCGTGG T149A-F GTCTCTGGCAGGTAAAGTTCACCCGTACTCTGC T149A-R CTTTACCTGCCAGAGACAGGGTGTAGTGGGTACG H153A-F AGTTGCACCGTACTCTGCTGGTATG H153A-R ACGGTGCAACTTTACCGGTCAGAGAC S156A-F TACGCAGCTGGTATGGGTCTGATGC S156A-R AGCTGCGTACGGGTGAACTTTACCGGT P163A-F TGATGGCAGGTCACGTTTACCGTGCTCTGTAC P163A-R AACGTGACCTGCCATCAGACCCATACCAGCAGAGT Y167A-F GTTGCACGTGCTCTGTACCCGTGCCCGCTGCA Y167A-R TACAGAGCACGTGCAACGTGACCCGGCATCAGA V285A-F TGCTGACGCAATGGACGCTATCGCTC V285A-R CATTGCGTCAGCACGACCGGTAACGC I289A-F ACGCTGCAGCTCCGGGTGGTCTGGGTG I289A-R GGAGCTGCAGCGTCCATAACGTCAGCAC P291A-F TCGCTGCAGGTGGTCTGGGTGGTAC P291A-R ACCACCTGCAGCGATAGCGTCCATAACG
[0043] The PCR amplification system is (total volume 25 μL): template DNA 0.5 μL, 2×Phanta Max Buffer 12.5 μL, dNTPs (dATP, dCTP, dGTP, and dTTP each 10 mM) 1 μL, upstream and downstream mutant primers each 0.5 μL, Phanta Max Super-Fidelity DNA Polymerase 0.5 μL, ddH2O 9.5 μL.
[0044] PCR reaction conditions: (1) Pre-denaturation at 95°C for 5 min; (2) Denaturation at 95°C for 30 s; (3) Annealing at 60°C for 30 s; (4) Extension at 72°C for 4 min. Steps (2)-(4) are repeated for 30 cycles. (5) Final extension at 72°C for 10 min. (6) Storage at 16°C.
[0045] 5 μL of each PCR product was analyzed by 1% agarose gel electrophoresis. The size of the target band is 6154 bp. The PCR product gels of some mutants are as Figure 1 shown. After the amplified band size was correct, 1 μL of DpnI enzyme was added to the remaining PCR reaction solution, and the template plasmid DNA was digested at 37°C for 2 h and inactivated at 65°C for 10 min. Then, 4-6 μL of the template-free PCR product was transformed into 100 μL of E. coli BL21(DE3) competent cells by chemical method. After heat shock, LB liquid medium was added to resuscitate for 1 h. After centrifugation and discarding part of the supernatant, the cells were pipetted and mixed evenly, and then spread on an LB plate containing 50 μg / mL kanamycin for overnight culture to obtain transformants.
[0046] Three transformants were picked from each plate into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C for 12 h. Then, the bacterial liquid was taken for sequencing. Some recombinant E. coli containing transaminase mutants are E. coli BL21(DE3) / pET28b-Se_N13A, E. coli BL21(DE3) / pET28b-Se_R17A, E. coli BL21(DE3) / pET28b-Se_V19A, E. coli BL21(DE3) / pET28b-Se_I22A. The amino acid sequence of Se_N13A is as shown in SEQ ID NO.3, and the nucleotide sequence is as shown in SEQ ID NO.4.
[0047] 3. Screening of combinatorial mutants
[0048] On the basis of the single-site mutation in Step 2, using the primers in Table 2, combinatorial mutations were carried out in the same method to obtain the transaminase mutants Se_N13A / I22A, Se_N13A / R17A, Se_N13A / V19A, Se_R17A / V19A, Se_R17A / I22A, Se_V19A / I22A, Se_N13A / R17A / I22A, Se_N13A / R17A / V19A, Se_N13A / V19A / I22A, Se_R17A / V19A / I22A, Se_N13A / R17A / V19A / I22A respectively. The transaminase Se_WT and its mutants are 6154 bp in total. The nucleic acid gel electrophoresis patterns of some mutants are as Figure 1 shown, where a represents single mutants and b represents combinatorial mutants.
[0049] Table 2. Primer sequence list for iterative alanine mutation (5' to 3')
[0050] Primer Name Primer Sequence (5’ to 3’) N13A / R17A-F TGTTCCGGCAGGTGTTGGTCAGATCCA N13A / R17A-R AACACCTGCCGGAACAGCTGCGTGA N13A / V19A-F CGTGGTGCAGGTCAGATCCACCCGAT N13A / V19A-R CTGACCTGCACCACGCGGAACAGCT R17A / V19A-F GTTCCGGCAGGTGCAGGTCAGATCCACC R17A / V19A-R CTGACCTGCACCTGCCGGAACAGCGTT N13A / I22A-F GTCAGGCACACCCGATCTTCGCTGA N13A / I22A-R GGTGTGCCTGACCAACACCACGCGGAA R17A / I22A-F GTTCCGGCAGGTGTTGGTCAGGCACA R17A / I22A-R AACACCTGCCGGAACAGCGTTGTGA V19A / I22A-F GTGGTGCAGGTCAGGCACACCCGATCT V19A / I22A-R TGACCTGCACCACGCGGAACAGCGTT N13A / R17A / V19A-F GTTCCGGCAGGTGCAGGTCAGATCCACCCGATCT N13A / R17A / V19A-R TCTGACCTGCACCTGCCGGAACAGCTGCGTGA N13A / R17A / I22A-F GTTCCGGCAGGTGTTGGTCAGGCACACCCGATCTTCG N13A / R17A / I22A-R GGGTGTGCCTGACCAACACCTGCCGGAACAGCTGCGTGA N13A / V19A / I22A-F CGTGGTGCAGGTCAGGCACACCCGATCTTCG N13A / V19A / I22A-R GGGTGTGCCTGACCTGCACCACGCGGAACAG R17A / V19A / I22A-F GTTCCGGCAGGTGCAGGTCAGGCACACCCGAT R17A / V19A / I22A-R CTGACCTGCACCTGCCGGAACAGCGTTGT N13A / R17A / V19A / I22A-F TCCGGCAGGTGCAGGTCAGGCACACCCGATCTTCGCTGA N13A / R17A / V19A / I22AR GGTGTGCCTGACCTGCACCTGCCGGAACAGCTGCGTGA
[0051] Example 2. Inductive expression of recombinant Escherichia coli containing transaminase mutants
[0052] E. coli BL21(DE3) / pET28b-Se_WT and the recombinant Escherichia coli of each mutant obtained in Example 1 were respectively inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37 °C and 200 rpm for 12 h, and then inoculated into fresh TB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 1% (v / v), and cultured at 37 °C and 180 rpm until the cell OD 600 reached 0.4 - 0.6. IPTG with a final concentration of 0.1 mM was added, and the culture was induced at 28 °C for 12 h. After centrifugation at 4 °C and 8000 rpm for 10 min, the supernatant was discarded, and the precipitate was collected to obtain the wet cells of recombinant Escherichia coli containing the target gene, which were stored at -20 °C for standby.
[0053] Example 3. SDS-PAGE electrophoresis of transaminase
[0054] The wet cells collected in Example 2 were washed once with 0.85% (w / v) normal saline (NaCl), centrifuged at 4 °C and 8000 rpm for 10 min, and the wet cells were collected again. They were resuspended with 20 mM phosphate buffer (pH 8.0) and ultrasonically disrupted in a low-temperature ice bath (40 W, continuous for 2 s, intermittent for 4 s, continuously disrupted for 40 min). After centrifugation of the disrupted cell lysate at 12000 rpm for 10 min, the supernatant was the crude enzyme solution.
[0055] The obtained crude enzyme solution was purified using an affinity nickel column (40×12.6 mm, Bio-Rad, USA) on an AKTA start low-temperature chromatography system. The binding buffer used for purification was 20 mM phosphate buffer (pH 8.0) containing 300 mM NaCl, and the elution buffer was 20 mM phosphate buffer (pH 8.0) containing 300 mM NaCl and 500 mM imidazole. The parameters for eluting the impurity proteins were 88% binding buffer and 12% elution buffer. After purification, it was loaded into a dialysis bag with a cut-off molecular weight of 8 - 14 kDa and dialyzed in 20 mM phosphate buffer (pH 8.0) at 4°C for 12 h, and the dialysis solution was changed every 6 h. After desalting, the target protein was obtained, which was the pure enzyme solution; after appropriate dilution, SDS-PAGE electrophoresis was carried out.
[0056] Transaminase Se_WT and its mutants have a total of 435 amino acids (with a 6×His-tag), and their theoretical molecular weight is 46.7 kDa. The SDS-PAGE electrophoresis pattern is as Figure 2 shown, where a represents the single mutant and b represents the pure enzyme solution of the combined mutant.
[0057] Example 4: Determination of the relative enzyme activity of whole cells
[0058] Using the recombinant Escherichia coli wet cells containing transaminase Se_WT, Se_N13A, Se_R17A, Se_V19A, Se_I22A, Se_N13A / I22A, Se_N13A / R17A, Se_N13A / V19A, Se_V19A / I22A, Se_R17A / V19A, Se_R17A / I22A, Se_N13A / R17A / I22A, Se_N13A / R17A / V19A, Se_N13A / V19A / I22A, Se_R17A / V19A / I22A, Se_N13A / R17A / V19A / I22A prepared in Example 2 as a catalyst, with PPO as the acceptor substrate and L-alanine as the donor for the transamination reaction.
[0059] Definition of the enzyme activity unit (U) of transaminase: Under the conditions of 35°C and pH 8.5, the amount of bacteria required to catalyze the substrate PPO to generate 1 μmoL of the product L-PPT within 1 min is defined as 1 U.
[0060] Relative activity: Calculating the relative enzyme activity of the mutants with the enzyme activity of transaminase Se_WT as 100%, %.
[0061] Reaction system (1 mL): 50 mM PPO, 75 mM L-alanine, 0.1 mM PLP, 10 g / L (WCW) bacterial cells. The reaction medium was Tris-HCl buffer (50 mM, pH 8.5). The catalytic reaction was carried out at 35 °C and 600 rpm. Samples of 200 μL were taken at regular intervals, and the reaction was terminated by adding 5 μL of 6 M HCl. After centrifugation at 12000 rpm for 1 min, the supernatant was taken and appropriately diluted. After derivatization, liquid chromatography detection was carried out.
[0062] Detection of product L-phosphinothricin: A Thermo Fisher U3000 liquid chromatograph equipped with a fluorescence detector was used, and the chromatographic column was a C18 column (4.6×250 mm, Acchrom, China); the mobile phase was methanol: 50 mM ammonium acetate buffer (pH 5.7) with a volume ratio of 1:9; the flow rate was 1.0 mL / min; the detection wavelengths were Ex = 350 nm and Em = 460 nm; the injection volume was 10 μL; the column temperature was 35 °C. The retention times of L-phosphinothricin and D-phosphinothricin were 10.6 minutes and 12.6 minutes, respectively.
[0063] The measurement results are as Figure 3 and Figure 4 shown. Among them, the relative activities of the transaminase mutants Se_N13A, Se_R17A, Se_V19A, Se_I22A, Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, Se_N13A / R17A / I22A in catalyzing PPO to synthesize L-phosphinothricin were 274.3%, 205.8%, 216.2%, 206.6%, 192.0%, 186.1%, 158.6%, and 175.1% of the wild type, respectively, and e.e. ≥ 99.9%.
[0064] Example 5. Application of mutants in the production of L-PPT (L-PPT yield)
[0065] The wet recombinant Escherichia coli cells containing transaminases Se_WT, Se_N13A, Se_R17A, Se_V19A, Se_I22A, Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, Se_N13A / R17A / I22A were used to determine the L-phosphinothricin synthesis process.
[0066] Reaction system (10 mL): 50 mM PPO, 75 mM L-alanine, 0.1 mM PLP, 10 g / L (WCW) cells, and the reaction medium was Tris-HCl buffer (50 mM, pH 8.5). The catalytic reaction was carried out at 35 °C and 600 rpm. Samples of 200 μL were taken at 0 h, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 8 h, 10 h, 12 h, 18 h, and 24 h respectively. 5 μL of 6 M HCl was added to terminate the reaction. After centrifugation at 12000 rpm for 1 min, the supernatant was taken and appropriately diluted. After derivatization, liquid chromatography detection was carried out. The detection method was the same as that in Example 4. The measurement results are as Figure 5 .
[0067] The process of transaminase Se_WT and its mutants catalyzing the synthesis of L-glufosinate from PPO showed that the time for Se_WT to reach the reaction equilibrium was 18 h, and the times for Se_N13A, Se_R17A, Se_V19A, and Se_I22A to reach the reaction equilibrium were 8 h respectively. The times for Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, and Se_N13A / R17A / I22A to reach the reaction equilibrium were 12 h. The average yield of L-glufosinate at equilibrium was 41.5%, and the e.e. of the product was ≥99.9%. Compared with the wild-type transaminase Se_WT, the reaction time of mutants Se_N13A, Se_R17A, Se_V19A, and Se_I22A was shortened by 10 h, and the space-time conversion rate was increased by 1.8 times. The reaction time of Se_N13A / I22A, Se_R17A / I22A, Se_V19A / I22A, and Se_N13A / R17A / I22A was shortened by 6 h, and the space-time conversion rate was 1.5 times that of the original enzyme. These mutants created good application prospects for the asymmetric synthesis of L-glufosinate using L-alanine as the amino donor by transaminase.
Claims
1. A high-activity aminotransferase mutant using L-alanine as an amino donor, characterized in that: The transaminase mutant is obtained by subjecting the 13th, 17th, 19th and 22nd amino acids of the amino acid sequence shown in SEQ ID NO.1 to single point mutation or combined mutation.
2. The aminotransferase mutant according to claim 1, characterized in that: The amino acid transaminase mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.1 is mutated into one of the following: (1) asparagine at position 13 is substituted with alanine; (2) arginine at position 17 is substituted with alanine; (3) valine at position 19 is substituted with alanine; (4) isoleucine at position 22 is substituted with alanine; (5) asparagine at position 13 is substituted with alanine and isoleucine at position 22 is substituted with alanine; (6) arginine at position 17 is substituted with alanine and isoleucine at position 22 is substituted with alanine; (7) valine at position 19 is substituted with alanine and isoleucine at position 22 is substituted with alanine; (8) asparagine at position 13 is substituted with alanine, arginine at position 17 is substituted with alanine, and isoleucine at position 22 is substituted with alanine.
3. A recombinant vector containing the gene encoding the aminotransferase mutant according to claim 1.
4. A recombinant genetically engineered bacterium containing the recombinant vector according to claim 3.
5. Use of the aminotransferase mutant according to claim 1 in the biocatalytic asymmetric synthesis of L-phosphinothricin from 2-carbonyl-4-[hydroxy(methyl)phosphonyl]-butyric acid.
6. The use according to claim 5, characterized in that The application is: using wet bacteria obtained by fermentation culture of recombinant genetic engineering bacteria containing the transaminase mutant encoding gene or pure enzyme liquid obtained by ultrasonic crushing of wet bacteria and purification by nickel column as a catalyst, using 2-carbonyl-4-[hydroxy(methyl)phosphonyl]-butyric acid as a substrate, using pyridoxal phosphate as a coenzyme, and using natural amino acid L-alanine as an amino donor, a conversion system is formed in a pH 7.0-9.0 buffer, reacting at 30-50°C and 600-800r / min, and after the reaction is completed, separating and purifying the reaction liquid to obtain L-phosphinothricin ammonium.
7. The use according to claim 6, characterized in that In the transformation system, the initial concentration of the substrate added is 20-100 mM, the amount of wet bacteria added is 5-15 g / L, the amount of coenzyme added is 0.1-0.5 mM, and the amount of L-alanine added is 50 mM to 150 mM.
8. The use according to claim 6, characterized in that The wet bacterial cells were prepared as follows: the recombinant genetic engineering bacteria containing the transaminase mutant encoding gene were inoculated into a LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance, and cultured at 37°C and 200 rpm for 10-12 hours, and then inoculated into a fresh TB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance at a volume concentration of 1% inoculum, and cultured at 37°C and 180 rpm until the bacterial OD 600 When the pH value reaches 0.4 to 0.6, IPTG with a final concentration of 0.1 mM is added, and the culture is induced at 28°C for 12 hours, and then centrifuged at 4°C and 8000 rpm for 10 minutes, the supernatant is discarded, and the wet bacteria are collected; the TB culture medium comprises: 12 g / L tryptone, 24 g / L yeast powder, 12.54 g / L disodium hydrogen phosphate, 2.31 g / L sodium dihydrogen phosphate, 5 g / L glycerol, and the solvent is water.
Citation Information
Patent Citations
A method for producing L-glufosinate
CN105603015B
Transaminase mutant as well as coding gene and application thereof
CN113621592A
Transaminase mutant as well as engineering bacteria and application thereof
CN114921432A
Method for producing L-phosphinothricine by enzymatic transamination with aspartate
CN1349561A
Methods for making l-glufosinate
WO2017151573A1