A promoter mutant of bacillus subtilis and application thereof

Abstract

The application discloses a Bacillus subtilis promoter mutant and application, and belongs to the field of biotechnology and genetic engineering technology. The application aims to improve the activity of the Bacillus subtilis promoter. The application provides a Bacillus subtilis promoter mutant, wherein the mutant is obtained by performing single-base or multi-base mutation on a promoter gene shown in SEQ ID NO. 1. The high-activity promoter Psrf mutant greatly improves enzyme activity when mediating alpha-amylase expression, and has superior performance in a heterologous expression system, has certain universality, and has a wide application prospect in the industrial production field.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and genetic engineering, specifically relating to a promoter mutant of Bacillus subtilis and its application. Background Technology

[0002] Bacillus subtilis, a Gram-positive bacterium, has become a preferred strain for microbial cell factories due to its excellent extracellular protein secretion capacity and widely recognized safety profile. It plays a vital role in various fields, including agriculture, industrial food, and medicine. Particularly in prokaryotic expression systems, Bacillus subtilis is an ideal host for expressing and secreting exogenous proteins and is considered an important model strain.

[0003] Promoters are specific DNA sequences recognized, bound, and used by RNA polymerases to initiate transcription, playing a decisive role in the intensity and timing of gene expression. In Bacillus subtilis, promoters are key regulatory elements of gene expression, and their activity directly affects the expression efficiency of exogenous proteins. Current research mainly focuses on the rational modification of the -35 and -10 regions of promoters to obtain highly active promoters; however, this modification method has limited effectiveness in other regions. The self-inducible promoter Psrf in Bacillus subtilis is activated under quorum sensing (QS) mechanisms and is widely used in gene expression regulation; research on obtaining highly active mutants through irrational screening is relatively limited. Furthermore, compared to Gram-negative Escherichia coli, establishing systems for screening promoters and other expression elements in Gram-positive Bacillus subtilis is more difficult. Summary of the Invention

[0004] The purpose of this invention is to improve the activity of the promoter of Bacillus subtilis.

[0005] This invention provides a promoter mutant of Bacillus subtilis, which is obtained by mutating the promoter gene shown in SEQ ID NO.1 at positions 20, 25, 37, 40, 57, 116, 216, 217, 250, 281, 282, 286, 295, 296, 304, 323, 385, 424 or 546 or by adding a base at position 385.

[0006] Further specifying, the sequence of the mutant is as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7.

[0007] The present invention provides a recombinant vector containing the above-mentioned promoter mutant.

[0008] The present invention provides a recombinant host cell containing the above-mentioned promoter mutant.

[0009] This invention provides an application of the above-described promoter mutant, the above-described recombinant vector, or the above-described recombinant host cell in any of the following ways:

[0010] (a) Enhance the transcriptional level of a gene, or prepare reagents or kits for enhancing the transcriptional level of a gene;

[0011] (b) To prepare proteins, or to prepare reagents or kits for preparing proteins;

[0012] (c) Produce the target compound, or prepare reagents or kits for producing the target compound.

[0013] Further specifying, the protein is selected from at least one of gene expression regulatory proteins, proteins related to the synthesis of the target compound, and proteins related to membrane transport.

[0014] The present invention provides a nucleic acid molecule comprising the promoter mutant described above.

[0015] Further specifying, it also includes genes encoding α-amylase or genes encoding arginine transiminoase.

[0016] The present invention provides a recombinant vector or recombinant host cell containing the above-mentioned nucleic acid molecules.

[0017] This invention provides the application of the above-mentioned nucleic acid molecule, or the above-mentioned recombinant vector, or recombinant host cell in enhancing the enzyme activity of expressed proteins.

[0018] Beneficial effects: A highly active promoter Psrf mutant was obtained through screening, and the corresponding expression vector and recombinant expression strain were constructed. The nucleic acid molecule with enhanced promoter activity provided by this invention exhibits higher promoter activity than the wild type and can be used for target gene expression. For example, it can be operably linked to the α-amylase gene to enhance the expression intensity of α-amylase, or operably linked to the ADI gene to enhance the expression intensity of ADI, thereby improving the amino acid production efficiency of the recombinant strain and the expression efficiency of exogenous proteins. Attached Figure Description

[0019] Figure 1 Electrophoresis image of nucleic acid fragments obtained by PCR from the promoter Psrf;

[0020] Figure 2 : Particle image of plasmid pBE-Psrf-SPapre-amyE;

[0021] Figure 3α-Starch Plate Screening Diagram. Detailed Implementation

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used to practice or test this invention, the methods and materials described herein are preferred.

[0023] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental techniques and methods used in these embodiments are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0024] The culture medium used in the examples is as follows:

[0025] LB medium: yeast extract 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0026] LB solid starch plate: yeast powder 5g / L, peptone 10g / L, NaCl 10g / L, agar powder 20g / L, soluble starch 20g / L.

[0027] TB medium: glycerol 5 g / L, peptone 12 g / L, yeast extract 24 g / L, dipotassium hydrogen phosphate 12.54 g / L, potassium dihydrogen phosphate 2.31 g / L.

[0028] RM medium: mannitol 90g / L, sorbitol 90g / L, NaCl 10g / L, peptone 10g / L.

[0029] All culture media were sterilized in an autoclave at 121°C for 20 minutes, and the corresponding antibiotics were added during the use of the culture media.

[0030] Example 1. Construction of recombinant plasmids

[0031] (1) Using the genome of Bacillus subtilis 168 as a template, the target promoter Psrf fragment was obtained by PCR technology. The specific nucleotide sequence is shown in SEQ ID NO: 1. The specific PCR reaction system is as follows: 2 μL of Bacillus subtilis 168 genome template (110 ng / μL), 2 μL of upstream primer Psrf-kpnI-F: CGG GGTACC ATCGACAAAAATGTCATGA (SEQ ID NO.8) (underlined bases are kpnI restriction sites), 2 μL downstream primer Psrf-xhoI-RCCG CTCGAG ATTGTCATACCTCCCCTAATC (SEQ ID NO.9) (underlined bases are xhoI restriction sites), DNA polymerase 2×Prime STAR Max, DNA 25μL, sterile water to a final volume of 50μL. The PCR reaction program is as follows: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 5 sec, 72℃ extension for 60 s, 30 cycles, and a final extension at 72℃ for 5 min. 3μL of the Psrf promoter fragment PCR product was used for nucleic acid verification. The target band was 606 bp in size. Figure 1 The size shown is correct.

[0032] (2) With pBE-kpnI-xhoI-SPapre-amyE

[0033] The commercially available original plasmid pBE-S was purchased from B. subtilis Secretory Protein Expression; CAT#3380. The amyE gene was synthesized at Sangon Biotech Co., Ltd. between the HindIII and SaLI restriction endonucleases of plasmid pBE-S, thus obtaining the initial plasmid pBE-kpnI-xhoI-SPapre-amyE. SPapre represents a signal peptide that assists in the secretion of the mediated protein extracellularly, and amyE represents an amylase gene, which hydrolyzes starch. The initial plasmid was linearized by cutting with restriction endonucleases KpnI and xhoI. The specific double digestion system was as follows: 1 μL KpnI, 1 μL XhoI, 3 μL 10×M buffer, 5 μL initial plasmid, and sterile water was added to bring the total volume to 30 μL. The mixture was incubated at 37°C for 1 hour. The plasmid was double-digested and verified by agarose gel electrophoresis. The fragment pBE-KpnI-XhoI-SPapre-amyE was recovered using an Omega agarose gel recovery kit.

[0034] (3) The Psrf promoter fragment obtained by PCR was digested using the same restriction endonucleases KpnI and XhoI, following the same linearization process as the pBE-KpnI-XhoI-SPapre-amyE linearization digestion. The plasmid fragment and the promoter Psrf fragment were then ligated. The ligation system was as follows: 3 μL of plasmid pBE-kpnI-xhoI-SPapre-amyE fragment, 3 μL of promoter Psrf fragment, 1 μL of T4 ligase, 1 μL of T4 ligase buffer, and 2 μL of sterile water. Ligation was carried out at 16℃ for 2 h. Subsequently, the ligation product of promoter Psrf fragment and plasmid pBE-kpnI-xhoI-SPapre-amyE fragment was transformed into DH5α competent cells. After heat shock at 42℃ for 60 s, 1 mL of LB liquid medium was added, and the cells were cultured at 37℃ and 200 rpm for 45 min. Spread evenly on LB agar containing 50 μg / mL ampicillin and incubate overnight at 37°C inverted position. Single colonies were picked, colony PCR was performed for verification, and the colonies were sent to a sequencing company. Strains with correct sequencing were cultured, plasmids were extracted, and the recombinant plasmid pBE-kpnI-Psrf-xhoI-SPapre-amyE was obtained. (See diagram below.) Figure 2 As shown.

[0035] Example 2. Establishment of a promoter Psrf mutant library

[0036] Introducing manganese ions into the PCR system can increase the mutation rate of the PCR product. Therefore, manganese ions were added to the reaction system for obtaining the Psrf promoter fragment by PCR to obtain the Psrf promoter mutant. The specific process is as follows: 2 μL of Bacillus subtilis 168 genome template (110 ng / μL), 2 μL of upstream primer Psrf-kpnI-F CGG GGTACC ATCGACAAAAAT GTCATGA, 2μL downstream primer Psrf-xhoI-R CCG CTCGAG The following reagents were used: ATTGTCATACCTCCCCTAATC, DNA polymerase 2×Prime STARMax, 25 μL of DNA, 2 μL of manganese ion solution (the final manganese ion concentration in the reaction system was 0.1 mM), and sterile water to a final volume of 50 μL. The PCR reaction program was as follows: PCR amplification program: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 5 sec, 72℃ extension for 60 s, 30 cycles, and a final extension at 72℃ for 5 min to obtain the Psrf nucleotide sequence fragment of the promoter with random mutation.

[0037] The plasmid pBE-kpnI-xhoI-SPapre-amyE and a randomly mutated promoter Psrf nucleotide sequence fragment were double-digested with KpnI and XhoI. Subsequently, the two fragments were ligated using a T4 enzyme. The ligation product was then transformed into DH5α competent cells, heat-shocked, and plated on LB agar plates containing 50 μg / mL kanamycin to obtain different single-clone strains. These procedures are based on the process described in Case 1 for constructing the recombinant plasmid pBE-kpnI-Psrf-xhoI-SPapre-amyE. Finally, the single-clone bacterial cells on the solid plate were eluted using liquid LB and cultured in a shaker at 37°C and 200 rpm for 2 hours. The plasmid was then extracted to obtain the mixed recombinant plasmid pBE-kpnI-Psrf*-xhoI-SPapre-amyE (Psrf* represents the mutant of Psrf) containing the mutated promoter Psrf nucleotide sequence. This plasmid served as a promoter Psrf mutant library to prepare for the subsequent screening of highly active promoter Psrf.

[0038] Example 3. Screening for highly active promoter Psrf mutants

[0039] (1) Screening for highly active dominant promoter Psrf mutants using starch plates. The mixed recombinant plasmid pBE-kpnI-Psrf*-xhoI-SPapre-amyE obtained in Case 2 was transformed into Bacillus subtilis WB600 competent cells. The procedure was as follows: Bacillus subtilis WB600 competent cells were taken from a -80℃ freezer and placed on ice for 10 min to allow them to thaw. At the same time, the electrotransformed mixed plasmid was placed on ice for pre-cooling.

[0040] (2) Take an appropriate amount of plasmid (about 1 μg, the volume of which does not exceed 10% of the competent cell volume), mix it thoroughly with Bacillus subtilis WB600 competent cells, and place it on ice for 20 min.

[0041] (3) Transfer the mixture to a pre-cooled 2mm diameter electrode cup, set the electroporator to 25μF, 200Ω, 2400V, and use high voltage to break down the cell membrane, allowing the plasmid to enter the competent cells. Immediately add 1mL of RM medium, mix with a pipette, transfer to a 1.5mL EP tube, and incubate at 37℃ and 200rpm for 3h. (4) Centrifuge the revived bacterial solution at 3000-4000rpm for 3-5min, discard part of the supernatant, resuspend, and spread on LB solid medium plates containing kanamycin antibiotic. Incubate at 37℃ for 10-12h until single colonies grow, which will be used as the experimental group. The control group experiment involved transforming the recombinant plasmid pBE-KpnI-Psrf-XhoI-SPapre-amyE containing the wild-type promoter Psrf into Bacillus subtilis WB600, following the same steps as the experimental group.

[0042] (4) Because Bacillus subtilis WB600 / pBE-KpnI-Psrf-XhoI-SPapre-amyE contains the amylase gene amyE (amyE serves as a reporter gene), it secretes amylase AmyE during culture. Amylase can hydrolyze starch. Therefore, the activity of the promoter Psrf mutant can be judged based on the size of the clear zone around the single clone WB600 / pBE-KpnI-Psrf*-XhoI-SPapre-amyE on a starch plate (LB solids + 10% starch). Single clones with a clear zone larger than that of the control group on the starch plate were selected, such as... Figure 3 As shown. Ten mutant strains with larger transparent zones than the control group were selected from approximately 2000 single clones and numbered M1, M2, M3, M4, M5 and M6.

[0043] (5) Shake-flask fermentation verification. First, the dominant mutant strains M1-M6 obtained from the initial screening on starch plates were transferred to 50mL Erlenmeyer flasks containing 5mL LB for activation and cultured at 37℃ and 200rpm for 10h. Next, 1mL of the bacterial culture was transferred to a 250mL Erlenmeyer flask containing 50mL TB and cultured at 37℃ and 200rpm for 36h. OD was then measured. 600 The fermentation broth was centrifuged, and the fermentation supernatant was obtained. The activity of amylase AmyE in the fermentation supernatant was detected. The enzyme activity of the control strain D0 (WB600 / pBE-KpnI-Psrf-XhoI-SPapre-amyE) was defined as 100%. The relative enzyme activities of the other mutant strains are shown in Table 1. The relative enzyme activities of mutant strains M1, M2, M3, M4, M5, and M6 were increased by 50.3%, 11.2%, 33.5%, 21.2%, 61.6%, and 13.6% respectively compared with the control strain D0. In addition, the OD units of these mutant strains were... 600 The enzyme activities of the control group increased by 55.9%, 14.0%, 36.8%, 21.2%, 57.9%, and 11.0%, respectively.

[0044] Table 1. Shake-flask verification of α-amylase activity in different mutants

[0045]

[0046] Recombinant plasmids were extracted from strains M1-M6 and sent to Sangon Biotech for sequencing. The results are shown below. The nucleotide sequences corresponding to M1, M3, M4, and M5 are SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively.

[0047] Method for Detecting Amylase Activity. A 1% soluble starch solution was used as the substrate for α-amylase activity assay; 20 mmol / L, pH 6.0 phosphate buffer was used as the enzyme activity buffer. 1 mL of substrate and 900 μL of buffer were added to separate 15 mL stoppered test tubes, mixed, and incubated in a 70°C water bath for 10 min. The enzyme solution was appropriately diluted with buffer, and 100 μL of the diluted enzyme solution was added to the stoppered test tube containing the substrate and buffer, and immediately vortexed to mix. After reacting at 70°C for 5 min, 3 mL of DNS (3,5-dinitrosalicylic acid reagent) was immediately added and vortexed to mix. The stoppered test tube was placed in a boiling water bath for 7 min, and then immediately placed in ice water to cool. After incubating in an ice water bath for 3-5 min, 10 mL of deionized water was added to the stoppered test tube and mixed. The absorbance of the reaction solution at 540 nm was measured using a spectrophotometer. Under the above conditions, the amount of enzyme required to release the equivalent of 1 μL of glucose and reducing sugar per minute is 1 enzyme activity unit (U).

[0048] Example 4. Verification of the universality of the dominant mutant promoter Psrf and its application in the production of citrulline.

[0049] To verify the universality of the promoters corresponding to the mutants M1, M2, M3, M4, M5, and M6 and their application in citrulline production, the ADI gene from Muribauculaceae bacterium Z82 (accession number: A0A7C9JRK1) was constructed by double digestion with HindIII and SalI followed by ligation with T4 enzyme, resulting in recombinant plasmids pBE-kpnI-m1Psrf-xhoI-SPapre-HindIII-ADI-SalI, pBE-kpnI-m3Psrf-xhoI-SPapre-HindIII-ADI-SalI, and pBE-kpnI-m4Psrf-xhoI-SPapre-HindIII-ADI-SalI.

[0050] pBE-kpnI-m5Psrf-xhoI-SPapre-HindⅢ-ADI-SalI, where m1Psrf, m2Psrf, m3Psrf, m4Psrf, m5Psrf, and m6Psrf represent the promoter Psrf mutation sequences corresponding to strains M1, M2, M3, M4, M5, and M6, respectively. The plasmid was transformed into Bacillus subtilis WB600. [Bacillus subtilis WB600 is a defective strain obtained by genetic engineering of wild-type Bacillus subtilis. It is a commercially available strain of Bacillus subtilis 168 with six protease genes (aprE, nprE, epr, mpr, bpr, vpr) precisely knocked out in the genome of Bacillus subtilis 168, which significantly reduces the activity of extracellular proteases.] The literature describes "Engineering a Bacillus subtilis Expression-Secretion System with a Strain Deficient in Six Extracellular Proteases," which refers to recombinant strains from experimental groups 1, 2, 3, 4, 5, and 6. The plasmid pBE-kpnI-Psrf-xhoI-SPapre-HindⅢ-ADI-SalI was transformed into Bacillus subtilis WB600 as a control strain. The results were verified by shake-flask fermentation, as shown in Table 2. The relative enzyme activity / OD ratio in experimental groups 1-6 is... 600 Compared with the control group, the results were improved by 36.4%, 11.1%, 25.6% and 18.4%, 28.6% and 8.9%, respectively, indicating that the Psrf promoter mutant is beneficial for ADI enzyme gene recombination expression. It also shows that the Psrf promoter mutant has a certain degree of versatility and can be used for efficient citrulline production. The host cells of the mutated promoter were verified in Bacillus licheniformis, and the results were also achieved.

[0051] ADI enzyme activity is defined as follows: One unit (U) is the conversion of 1.0 μmol / L arginine to 1.0 μmol / L citrulline within one minute using crude enzyme solution or purified protease at pH 6.0, 37℃, and an arginine concentration of 100 g / L. The enzyme activity assay is performed as follows: 1 mL of crude enzyme solution is added to a sodium phosphate buffer (0.2 mol / L, pH 6.0) at 37℃ and 200 rpm, and the reaction is allowed to proceed for 10 min. After the reaction, the mixture is boiled in a water bath for 5 min to terminate the reaction. The precipitate is removed by centrifugation, and the reaction solution is analyzed by liquid chromatography.

[0052] Enzyme activity calculation: Based on the liquid chromatography results, enzyme activity is calculated using the following formula:

[0053] X=(W1×S×(A1-A0)×n×1000×V) / (W2×A×M×175.19×10) Where: W1 represents the mass (mg) of citrulline reference standard; S represents the content of citrulline reference standard; A1 represents the area of ​​citrulline after 10 min of reaction; A0 represents the area of ​​citrulline after 5 min of reaction; n represents the dilution factor of the reaction solution; V represents the final volume of the reaction system; W2 represents the weight (g) of protein in the purified liquid enzyme; A represents the area of ​​citrulline reference standard; m represents the dilution factor of citrulline reference standard; 175.19 represents the molecular weight of citrulline; 10 represents the time interval between two samplings (min); 1000 represents the μM conversion factor.

[0054] Table 2: Effect of promoter Psrf mutant on ADI enzyme activity in recombinant strains

[0055]

[0056] SEQ ID NO: 1

[0057] ;

[0058] SEQ ID NO:2

[0059] ATCGACAAAAATGTCATGA G AGAA C CGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATT CA TTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0060] SEQ ID NO:3

[0061] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTG TATTCAGCAATAAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGC C TCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAG T TAAAAAATATTGAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTTATTCGCTGTTAGTTCATAAGAATTAAAGCTGATATGGATAAGAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0062] SEQ ID NO: 4

[0063] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGAC T CT A TTCGCAAGGGTGTCTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAAATTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGAT TAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATA GCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0064] SEQ ID NO: 5ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTT A TTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTC AC TGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTC CC GCGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0065] SEQ ID NO: 6

[0066] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATT A AAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTG G CTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0067] SEQ ID NO:7

[0068] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAA GCATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATA T GAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT。

Claims

1. A promoter mutant of Bacillus subtilis, characterized in that, The sequence of the mutant is shown in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 or SEQ ID NO.

7.

2. A recombinant vector comprising the promoter mutant of claim 1.

3. A recombinant host cell comprising the promoter mutant of claim 1.

4. The promoter mutant of claim 1, the recombinant vector of claim 2 or the recombinant host cell of claim 3 for use in any of the following: (a) enhancing the transcription level of a gene, or preparing a reagent or a kit for enhancing the transcription level of a gene; (b) preparing a protein, or preparing a reagent or a kit for preparing a protein. The protein is selected from at least one of a gene expression regulating protein, a protein related to synthesis of a target compound, and a protein related to membrane transport. The nucleotide sequence comprises the promoter mutant of claim 1.

5. Use according to claim 4, characterized in that, Also included are a gene encoding alpha-amylase or a gene encoding arginine transimminase.

6. A nucleotide sequence, comprising, 8. A recombinant vector or a recombinant host cell comprising the nucleotide sequence of claim 7.

7. The nucleotide sequence according to claim 6, wherein, 9. Use of the nucleotide sequence of claim 6 or the recombinant vector or the recombinant host cell of claim 8 for increasing the enzyme activity of an expressed protein. ​ ​

Images