Rice herbicide-resistant gene and application thereof
By overexpressing the OsCYP704A5 gene in rice, the rice's resistance to triazole sulfadiazine was enhanced, solving the problem of herbicide-induced weed resistance and realizing an effective method for weed control in rice paddies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2026-03-03
AI Technical Summary
The long-term use of existing herbicides has led to increased herbicide resistance in weeds, which has affected rice growth. There is a lack of effective methods to enhance rice's herbicide resistance.
This invention provides an OsCYP704A5 gene derived from Nipponbare rice, which enhances rice resistance to triazolesulfuron by overexpressing this gene. A kit for detecting the expression level of the OsCYP704A5 gene is also developed for screening and detecting rice resistance to herbicides.
Overexpression of the OsCYP704A5 gene in yeast and rice significantly improves resistance to triazole sulfadiazine, providing the possibility of breeding herbicide-resistant rice varieties and solving the problem of weed control in rice fields.
Smart Images

Figure CN120210237B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of herbicide resistance gene technology, and relates to a rice herbicide resistance gene and its application. Background Technology
[0002] Rice, as a major food crop in my country, is undergoing a shift in its production model from traditional transplanting to direct seeding. This shift is accompanied by a significant increase in agricultural mechanization and a continuous expansion of planting area. However, weeds, as one of the key biological factors affecting rice yield, pose a significant challenge to agricultural production. Currently, chemical herbicides, due to their high efficiency, speed, and ease of use, have become the primary means of weed control. Nevertheless, the long-term and large-scale use of herbicides has led to increased herbicide resistance in weeds, a problem that is becoming increasingly serious globally.
[0003] In recent years, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitory herbicides have attracted widespread attention due to their lower risk of resistance. Triazolesulfuron (QYR301), a novel HPPD inhibitory herbicide belonging to the pyrazolinone class, is mainly used for weed control in the mid-to-late stages of rice cultivation. This herbicide is rapidly converted into its active metabolite HDT within the plant, demonstrating good weed control efficacy. However, these herbicides also have varying degrees of impact on rice growth during application, and currently, no ideal methods for enhancing rice herbicide resistance have been reported. Summary of the Invention
[0004] This invention proposes a novel rice herbicide-resistant gene and its application, addressing the problems existing in the use of traditional herbicides.
[0005] To achieve the above objectives, the present invention is implemented using the following technical solution:
[0006] The target gene proposed in this invention is derived from Nipponbare rice. Specifically, it provides a herbicide tolerance gene, which serves as a candidate gene for the research and breeding of herbicide-tolerant rice varieties, contributing to the effective control of barnyard grass, sustainable agricultural development, and food security.
[0007] The herbicide-resistant gene proposed in this invention is OsCYP704A5 Its sequence is shown in SEQ ID NO.1.
[0008] This invention proposes overexpression OsCYP704A5 Application of genetic material in the breeding of rice varieties with enhanced triazole sulfadiazine resistance.
[0009] Furthermore, this invention proposes a method for detecting [something] in rice. OsCYP704A5 Application of reagents or kits for measuring gene expression levels in detecting the resistance of rice to triazolesulfuron. OsCYP704A5Increased gene expression levels indicate enhanced resistance of rice to triazolesulfuron.
[0010] Furthermore, this invention proposes a method for detecting [something] in rice. OsCYP704A5 Reagents or kits for measuring gene expression levels are used in screening herbicides for rice weed control and evaluating dosage. For example, they can be used to determine whether triazole sulfadiazine is suitable for rice paddies and the effective dosage of triazole sulfadiazine.
[0011] Furthermore, this invention proposes overexpression OsCYP704A5 Application of genetic material in the breeding of rice varieties with enhanced resistance to HPPD herbicides.
[0012] Furthermore, this invention proposes a method for detecting [something] in rice. OsCYP704A5 Application of reagents or kits for measuring gene expression levels in detecting the resistance of rice to HPPD herbicides.
[0013] Compared with the prior art, the advantages and positive effects of the present invention are as follows:
[0014] This invention validates the expression in WAT11 yeast OsCYP704A5 Genes can be used to confer resistance to triazolesulfuron in transgenic yeast. Further, by... OsCYP704A5 Molecular docking analysis of the gene with triazole sulfadiazine showed that... OsCYP704A5 The gene exhibits a high binding affinity to triazolesulfuron, promoting detoxification and metabolism. Further overexpression in Nipponbare rice... OsCYP704A5 Genes can enable transgenic rice to acquire resistance to triazolesulfuron. This invention provides... OsCYP704A5 Genes can be used to breed rice varieties resistant to HPPD inhibitor herbicides, providing new possibilities for studying the mechanism of HPPD inhibitor herbicide resistance in paddy field weeds (barnyard grass), detecting weed resistance, and determining the timing and dosage of herbicide application. Attached Figure Description
[0015] Figure 1 for OsCYP704A5 Gel electrophoresis image of gene PCR products.
[0016] Figure 2 This is a single-enzyme digestion gel electrophoresis image of the PESC-TRP Expression Vector.
[0017] Figure 3 For the transfer OsCYP704A5 Sensitivity of genetically modified yeast to triazole sulfadiazine / HDT.
[0018] Figure 4 A is a WB imaging diagram of the thermal displacement of OsCYP704A5 protein; Figure 4B is the thermal displacement melting temperature curve of OsCYP704A5 protein.
[0019] Figure 5 A represents the three-dimensional structure of the OsCYP704A5 protein; Figure 5 B and C represent the OsCYP704A5 protein's 3D binding model with HDT and the characteristics of its substrate binding pocket. Figure 5 D is the RMSD value in molecular dynamics simulations.
[0020] Figure 6 For the transfer OsCYP704A5 Sensitivity of genetically modified rice to triazolesulfuron. Detailed Implementation
[0021] To better understand the above-mentioned objectives, features, and advantages of the present invention, the present invention will be further described below with reference to specific embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in these embodiments can be combined with each other.
[0022] Many specific details are set forth in the following description to provide a full understanding of the invention. However, the invention may be practiced in other ways than those described herein, and therefore, the invention is not limited to the specific embodiments disclosed below. Unless otherwise specified, all aspects in the following embodiments follow conventional practices in the field of bioengineering, and percentages of substances refer to mass fractions.
[0023] Example 1
[0024] 1. Construction of cloning vectors
[0025] 1.1 Select uniform and plump seeds of the herbicide-resistant rice variety Nipponbare. Soak the seeds in warm water at 30-40℃ for 12 hours, then transfer them to 9cm petri dishes lined with double-layered filter paper. Add appropriate amounts of deionized water to the petri dishes to keep the filter paper moist, and then transfer the petri dishes to a light incubator for germination. The incubator was set to 25 / 20℃ (day / night), with 12-hour light-dark cycles. When the seeds germinated to approximately 0.5cm, select germinating seeds of uniform growth and place them in 12cm diameter plastic seedling pots. The soil used for plant cultivation was soil from the Shandong Agricultural University teaching and experimental base farm that had no history of herbicide application. The sowing rate was 10 plants per pot. When the seedlings reached the 3-4 leaf stage, retain 5 uniformly growing plants per pot.
[0026] 1.2 Using FastPure ®The Plant Total RNA Isolation Mini Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) was used to extract total RNA from Nipponbare rice leaves according to the manufacturer's instructions. A 1 μL sample of the Nipponbare rice total RNA extract was then measured using a micro spectrophotometer to determine its OD value. 260 and OD 280 The ratio of total RNA extracted from Nipponbare rice was measured. 2 μL of total RNA extracted from Nipponbare rice was mixed with 2 μL of 10x DNA loading buffer (Novazia), and ddH2O (Beyotime) was added to bring the total volume to 20 μL. The integrity of the RNA extracted from Nipponbare rice was then detected by agarose gel electrophoresis.
[0027] 1.3 Following the instructions of the All-in-One First-Strand Synthesis MasterMix kit (purchased from Jiangsu Yugong Biotechnology Co., Ltd.), the obtained high-quality RNA was reverse transcribed into cDNA: using 1µg of total RNA as a template, Oligo(dT)... 20 VN (Yugong Biotechnology) was used as a primer to prepare the reaction system. The reaction was incubated at 37°C for 2 minutes and then at 55°C for 5 minutes. After the reaction, the obtained cDNA was immediately placed on ice and stored at -20°C for later use.
[0028] 1.4 Using the obtained cDNA as a template, and the following sequence as primers (synthesized by Shanghai Bioengineering Co., Ltd.):
[0029] Upstream: ATGGGAGAAGATGGCGGC;
[0030] Downstream: TCATCTCGCCATAGCCGTCAG.
[0031] Using Phanta ® Max Super-Fidelity DNA Polymerase (purchased from Nanjing Novizan Biotechnology Co., Ltd.) was used to amplify the full-length gene. The total volume of the amplification reaction system was 50 μL, including: 25 μL 2×PhantaMaxMaster Mix (Novizan), 2 μL upstream primer dissolved in ddH2O (10 μmol·L⁻¹). -1 ), 2 μL of downstream primer dissolved in ddH2O (10 μmol·L⁻¹) -1 4 μL template DNA, 17 μL ddH2O. PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 60 s, for a total of 34 cycles; final extension at 72℃ for 5 min.
[0032] 1.5 After the PCR reaction, the amplification products were detected by 1% agarose gel electrophoresis and observed using a UV gel imaging system. The results are as follows: Figure 1 As shown, the 1548bp band was extracted and purified using the FastPure GelDNAExtraction Mini Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The purified target fragment was quantified using a micro-volume spectrophotometer (Thermo Fisher Scientific, NanoDrop One) for the construction of the cloning vector.
[0033] 2. Construct a system containing Nipponbare rice. OsCYP704A5 Recombinant cloning vectors of genes
[0034] 2.1 The recovered and purified product obtained in step 1.5 was ligated to the cloning vector TA / Blunt-Zero using a 5-min TA / Blunt-Zero Cloning Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The ligation reaction system consisted of 1 μL 5 × TA / Blunt-Zero Cloning Mix (Novizan) and 2 μL... OsCYP704A5 Gene purification product, 2 μL ddH2O. Ligation reaction conditions: 25℃ for 5 min. After the reaction, place the centrifuge tubes on ice for later use.
[0035] 2.2 Thaw DH5α competent cells (Novizan) on ice. When the competent cells are in an ice-water mixture, add 10 μL of the ligation product obtained in step 2.1, and gently tap the bottom of the centrifuge tube to mix. Incubate on ice for 25 min. Heat shock at 42°C for 45 s, then quickly place on ice and incubate for 2 min. Add 700 μL of antibiotic-free LB sterile liquid medium (MDBio, Inc.), mix well, and shake at 37°C and 200 rpm for 1 h. Centrifuge the incubated culture at 5000 rpm for 1 min, discard 900 μL of supernatant, gently pipette the remaining culture to resuspend it, and spread it onto a plate containing 50 mg·L⁻¹ of iodine. -1 Place ampicillin on LB sterile solid medium (MDBio, Inc) plates, invert the plates and incubate overnight at 37°C.
[0036] 2.3 After bacterial colonies have grown on the plate, pick a single colony for PCR verification. The PCR primers, reaction system, and amplification conditions are the same as in step 1.4. Inoculate the verified positive clones onto a plate containing 50 mg·L⁻¹ of [a specific solution / concentration]. -1The bacteria were cultured in sterile LB broth containing ampicillin; 1 mL of the overnight culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared and analyzed using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). Verification showed that the cloned gene was similar to that of Nipponbare rice. OsCYP704A5 With a similarity of 100%, the positive bacterial cultures identified by sequencing were preserved for the construction of expression vectors.
[0037] 3. Bacterial culture
[0038] 3.1 The recombinant expression vector chosen was pYeDP60, the restriction enzyme site was KpnI, and the primers with the following sequence were used (synthesized by Sangon Biotech (Shanghai) Co., Ltd.):
[0039] Upstream: TGACCGGATCCCCGGGTACCATGGGAGAAGATGGCGGC;
[0040] Downstream: CGGAATTCGAGCTCGGTACCTCATCTCGCCATAGCCGTCAGA.
[0041] Using the correctly sequenced bacterial culture obtained in step 2.3 as a template, Phanta... ® Max Super-Fidelity DNA Polymerase (Novazia) amplification OsCYP704A5 The full-length gene with homologous arms was obtained using the same reaction system and amplification conditions as in step 1.4. The PCR products were subjected to agarose gel electrophoresis, and the target fragment was recovered using a gel extraction kit and quantified using a NanoDrop One spectrophotometer.
[0042] 3.2 The pYeDP60 Expression Vector was digested with LightNing KpnI restriction enzyme (purchased from Jiangsu Yugong Biotechnology Co., Ltd.). The reaction system was prepared on ice according to the following loading order: 15 μL ddH2O, 2 μL 10×CutOne TM Buffer (Yugong Biotechnology), pYeDP60 plasmid 2μL (up to 1μg), LightNing TMAdd 1 μL of KpnI, gently pipette to mix, briefly centrifuge, incubate at 37°C for 15 min, then at 80°C for 20 min. Load the product onto an electrophoresis gel and recover it. The enzyme digestion gel electrophoresis image is shown below. Figure 2 .
[0043] 3.3 The recovered target gene product was used to construct the expression vector according to the instructions of the ClonExpress II One Step Cloning Kit C112 (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The reaction system was as follows: 60 ng of the PCR product obtained in step 3.1 (0.02 × the number of base pairs of the insert fragment), 130 ng of the pYeDP60 Expression Vector product digested in step 3.2 (0.04 × the number of base pairs of the cloning vector), 4 μL of 5×CE II buffer (Novizan), 2 μL of Exnase (Novizan), and 20 μL of ddH2O. The mixture was gently pipetted and collected at the bottom of the tube after a brief centrifugation. The reaction was incubated at 37°C for 30 min. After the reaction, the centrifuge tube was placed on ice.
[0044] 3.4 Thaw DH5α competent cells on ice. Once the cells are in an ice-water mixture, add 10 μL of the ligation product obtained in step 3.3. The transformation process is the same as in step 2.2. Take 1 mL of the overnight culture and send it to Shanghai Sangon Biotech Co., Ltd. for sequencing. Use the primers from step 3.1. Sequencing is performed using DNAMAN 9.0. OsCYP704A5 The gene sequencing results were compared with the gene sequences obtained from the transcriptome sequencing data of Nipponbare rice, and the results showed that the sequences were identical.
[0045] 4. Transformation
[0046] 4.1 Take 5 ml of the overnight cultured bacterial solution from step 3.4 and extract plasmids using the FastPure® Plasmid Mini Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). Centrifuge at 10,000 rpm for 1 min. Discard the culture medium. Add 250 μl of Buffer P1 (Novizan) to the centrifuge tube containing the bacterial pellet and mix well. Add 250 μl of Buffer P2 (Novizan) and mix by inversion. Add 350 μl of Buffer P3 (Novizan) and immediately and gently invert 8-10 times. Centrifuge at 12,000 rpm for 10 min. Place the FastPure DNA Mini Columns adsorption column into a 2 ml CollectionTube. Transfer the supernatant to the adsorption column and centrifuge at 12,000 rpm for 30 s. Discard the waste liquid. Add 600 μl of Buffer PW2 (Novizan) to the adsorption column. Centrifuge at 12,000 rpm for 30 s. Discard the waste liquid, return the adsorption column to the collection tube, and repeat once. Centrifuge at 12,000 rpm for 1 min to dry the adsorption column. Place the adsorption column in a new sterile 1.5 ml centrifuge tube. Add 100 μl of Elution Buffer (Novizan) to the center of the membrane on the adsorption column. Incubate at room temperature for 2 min, then centrifuge at 12,000 rpm for 1 min to elute the DNA.
[0047] 4.2 The obtained recombinant expression vector plasmid was transformed into WAT11 yeast (Weidi Biotechnology). The specific steps are as follows:
[0048] Carrier DNA (VideoBio) was immersed in a 95°C metal bath for 5 min, then quickly immersed in ice after heating. Two tubes of WAT11 competent cells (VideoBio) were placed on ice to thaw, and the pre-cooled carrier DNA extracted in step 4.1 was added sequentially. OsCYP704A5 5 µg of recombinant pYeDP60 plasmid, 10 µl of pretreated carrier DNA, and 500 µl of PEG / LiAc (Weidi Bio) were mixed by aspiration several times and incubated at 30°C for 30 min (twisting 8 times at 15 min). The tube was then placed in a 42°C water bath for 15 min (twisting 8 times at 7.5 min). After centrifugation at 5000 rpm for 40 s, the supernatant was discarded, and the tube was resuspended in 400 µl of ddH2O. After centrifugation for 30 s, the supernatant was discarded again. The tube was resuspended in 50 µl of ddH2O, plated (using SD / -Trp deficient plates), and incubated at 29°C for 48 h. Single colonies were picked and inoculated into SD / -Trp deficient liquid medium for further culture.
[0049] 4.3 Saccharomyces cerevisiae was lysed using rapid yeast lysis buffer. The lysate was used as a PCR template and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification. The sequencing results were analyzed by sequence alignment using DNAMAN 9.0 software, and the results showed that the transformation was successful.
[0050] 5. Examine 4.3 Transit Point OsCYP704A5 The WAT11 yeast gene's sensitivity to triazole sulfadiazine and HDT.
[0051] 5.1 Accurately weigh 55.9 mg of triazolesulfuron technical grade (Qingyuan Nongguan), dissolve it in 10 mL of dimethyl sulfoxide (DMSO) to prepare a 10 mM stock solution, and then add 1.25 mL of the stock solution to the sterilized SD / -Ura Deficit Solid Yeast Medium (Kulaibo) before solidification to prepare 25 mL of SD / -Trp Deficit Solid Yeast Medium with a final concentration of 500 μM triazolesulfuron and HDT. HDT (Qingyuan Nongguan) is the active ingredient of triazolesulfuron. Triazolesulfuron is rapidly absorbed and hydrolyzed into HDT in plants.
[0052] 5.2 will OsCYP704A5 Successfully transformed WAT11 single colonies and WAT11 single colonies transformed with empty vector were inoculated into 20 mL SD / -Ura deficient liquid yeast medium (Kulaibo) and incubated at 28°C until the bacterial culture OD... 600 When =1, dilute to OD 600 =10 -1 10 -2 10 -3 10 -4 10 -5 Five μL of bacterial culture was dropped into SD / -Trp-deficient yeast solid medium containing 2% galactose (Coollabo) and 500 μM triazolesulfuron and HDT, respectively. After incubation at 28℃ for 48 h, the growth of WAT11 yeast was analyzed and photographed. WAT11 transfected with an empty vector was used as a control. Results are as follows: Figure 3 , Figure 3 The first row in both petri dishes is rotated. OsCYP704A5 The first row shows different dilutions of single colonies of the gene-transformed yeast, while the second row shows different dilutions of single colonies transformed with the empty vector. As can be seen from the figure, under triazole sulfadiazine stress treatment, the yeast WAT11 transformed with the empty vector grew slowly. OsCYP704A5 The transformed WAT11, despite growth inhibition under 500 μM triazole sulfadiazine and HDT, still exhibited normal growth, indicating that the target gene... OsCYP704A5 The expression of this compound enhanced the resistance of WAT11 yeast to triazolesulfuron. These results indicate... OsCYP704A5 Overexpression can confer triazole sulfadiazine resistance in yeast.
[0053] 6. Investigation of the binding effect and metabolic capacity of OsCYP704A5 on HDT
[0054] 6.1 Expression and Purification of Protein. The successfully transformed WAT11 yeast strain from step 4.3 was inoculated into SD / -Ura-deficient liquid yeast medium and cultured at 30°C until the logarithmic growth phase. 2% galactose was added to induce OsCYP704A5 protein expression. Yeast cells were collected by centrifugation and washed with PBS buffer (Thermo Fisher Scientific). Yeast cells were disrupted using glass bead disruption or sonication. Cell debris was removed by centrifugation, and the supernatant was collected. The His-tagged OsCYP704A5 protein was purified using a Ni-NTA affinity chromatography column. The target protein was eluted with an imidazole gradient. The eluted protein was dialyzed against PBS buffer to remove imidazole.
[0055] 6.2 Thermal displacement treatment. The purified CYP704A5 protein was divided into two groups: one group was treated with 2 μL of dimethyl sulfoxide (DMSO), and the other group was treated with HDT (the active ingredient of triazolesulfonate) to a final concentration of 200 μM. Standardized internal control GAPDH was used as a control for CYP704A5; similarly, one group was treated with 2 μL of DMSO, and the other group with HDT. The four groups of samples were incubated at different temperatures (35°C, 39.6°C, 44.5°C, 50°C, 54.6°C, 57.9°C, and 60°C) for 10 minutes each. After incubation, the samples were immediately cooled in an ice bath and centrifuged at 8000 rpm for 1 min to remove the precipitate. The supernatant was subjected to SDS-PAGE electrophoresis to determine the protein content. Quantitative analysis of the SDS-PAGE gels was performed using software such as ImageJ, and a curve showing the change in protein content with temperature was plotted. By comparing the precipitation temperature curves of the DMSO group and the HDT group, the effect of HDT on the thermal stability of OsCYP704A5 protein was analyzed.
[0056] The results are as follows Figure 4 As shown in the figure, the content of OsCYP704A5 protein gradually decreases with increasing temperature. Compared with DMSO, the content of OsCYP704A5 protein after HDT treatment is higher at 54.6°C and 57.9°C. Figure 4 A), its precipitation temperature curve shifts ( Figure 4 (B) indicates that triazole sulfadiazine can effectively bind to the OsCYP704A5 protein, enhancing the protein's thermal stability.
[0057] 7. Molecular docking analysis
[0058] 7.1 The amino acid sequence of OsCYP704A5 is shown in SEQ ID NO.7. The protein structure of OsCYP704A5 was predicted using SWISS-MODEL and SVAESv6 (https: / / saves.mbi.ucla.edu / ) through homology modeling for verification. 3D models of triazolesulfuron and HDT were generated and their energies minimized using ChemOffice Pro version 18.0. Molecular docking experiments were performed on the herbicide molecule at the active site of OsCYP704A5 using AutoDock Vina.
[0059] 7.2 The three-dimensional structure of OsCYP704A5 was obtained through homology modeling and the AlphaFold protein database. Figure 5 A). AutoDock vina simulation results show that OsCYP704A5 has a high affinity for HDT, with a binding energy of -30.92 kcal / mol. -1 The key amino acid residues involved include MET-116, ALA-312, GLN-456, PRO-387, LEU-388, ASN-390, and THR-223. Figure 5 BC). Simultaneously, the key cofactor heme at the active site of OsCYP704A5 interacts with HDT via Pi-Alkyl, and the intermolecular distance is relatively short ( ). Figure 5 BC). Figure 5 D. Molecular dynamics results showed that the binding of OsCYP704A5 to HDT was stable, with an RMSD value less than 3.0 Å, and MMPBSA and MMGBSA values of -18.74 and -24.24 kcal / mol, respectively. -1 This indicates that the molecular docking results are reliable and that OsCYP704A5 has a protein structure that catalyzes the degradation of HDT.
[0060] 8. Examined expression OsCYP704A5 Sensitivity of genetically modified rice to triazolesulfuron
[0061] 8.1 The rice transformation vector was changed to pCAMBIA1390, with the SpeI restriction site. The upstream primer was GGTAGATCTGACTAGTATGGGAGAAGATGGCGGC; the downstream primer was TAGCGTTAACACTAGTTCATCTCGCCATAGCCGTCAG. The remaining steps were the same as in 3.1-3.4. The vector was introduced into *Agrobacterium tumefaciens* EHA105 (Weidi Biotechnology) using electroporation. Western blotting analysis with anti-6×His antibody was used to verify whether the target protein was effectively overexpressed. Green fluorescent protein (GFP) was used as a negative control. Successfully transformed plants were screened using a culture medium containing antibiotics. Hygromycin-resistant rice callus was selected and cultured in petri dishes containing nutrient solution and hygromycin to obtain proliferating rice callus.
[0062] 8.2 Effects of triazolesulfuron on overexpressing rice lines: [Effects on overexpression] OsCYP704A5 and GFP The rice callus tissue regenerates to obtain overexpression GFP and OsCYP704A5 -OE line. F1 generation is propagated through seed harvesting, and individuals containing the transgene are screened for isolation and analysis. The transgene lines are screened for multiple generations to ensure stable inheritance and sustained overexpression effects. At the three- to four-leaf stage, the transgene seedlings are treated with a herbicide, using 2160 g of triazolesulfuron-methyl. -1 The transgenic seedlings were foliar sprayed with triazole sulfadiazine at the specified dosage, and the treated plants were placed in outdoor pots. Visual evaluation was performed 14 days after treatment.
[0063] The results are as follows Figure 6 As shown, ① is the non-GMO control group without treatment 1, and ② is the non-GMO group treated with 2160 g aiha. -1 Control groups 2, 3, and 4 of triazole sulfadiazine were treated with 2160 g ai ha -1 Overexpression of triazolesulfuron OsCYP704A5 The transgenic rice lines CYP704A5OE-1 and CYP704A5OE-2 were used. After application of the pesticide, the growth of the transgenic lines was almost unaffected, while the growth of the non-transgenic control lines was significantly inhibited. Therefore, transgenic rice using the P450 gene... OsCYP704A5 The rice significantly improved its resistance to triazole sulfadiazine.
[0064] In summary, this invention validates the overexpression of WAT11 yeast in both yeast strains and rice. OsCYP704A5 Genes can enable transgenic yeast and rice to acquire resistance to triazolesulfuron. This invention provides a novel candidate gene from the P450 family of triazolesulfuron resistance derived from Nipponbare rice; the provided... OsCYP704A5 Genes can be used to cultivate rice varieties resistant to HPPD inhibitor herbicides, providing new possibilities for studying the mechanism of weed resistance to HPPD inhibitor herbicides, detecting weed resistance, and determining the timing and dosage of herbicide application.
[0065] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments for application in other fields. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. Overexpression OsCYP704A5 The application of substances of genes in the cultivation of rice varieties with enhanced resistance to triazolopyrimidine sulfonamide, said OsCYP704A5 The sequence of the gene is shown as SEQ ID NO.
1.
2. A reagent or kit for detecting the level of expression of a gene in rice. OsCYP704A5 Use of a reagent or kit for detecting the level of expression of a gene in rice for detecting the level of resistance of rice to triazolopyrimidine sulfonamide herbicides.