Gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide
By designing a gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptides, the problems of inefficient expression efficiency and insufficient stability of the polypeptide biological activity in the prior art are solved, and the efficient and stable expression of amphiphilic elastin-like polypeptides is achieved, and a wide range of biomedical application prospects are achieved.
Patent Information
- Application Number
- CN202510016983.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-06
- Publication Date
- 2025-06-27
AI Technical Summary
The methods used in the prior art for expressing RGD-targeted elastin-like polypeptides have problems such as inefficiency, yield and quality that cannot meet actual needs, and the plasmids are cumbersome in the construction, transformation and expression process and are inefficient, and the expressed polypeptides also need to be improved in terms of biological activity and stability.
A gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptides was designed. The vector was an RGD-targeted amphiphilic elastin-like polypeptide. Its amino acid sequence is G(VPGYG)n(VPGXG)n(RGD)m. By constructing a recombinant plasmid and transforming it into BL21 (DE3) competent cells, it was resuscitation culture, screening and inducing expression, and finally obtained RGD-targeted amphiphilic elastin-like polypeptides through purification.
The efficient and stable expression of RGD-targeted amphiphilic elastin polypeptides has been achieved, with a wider biomedical application prospect, and the structural and functional integrity of the plasmid during long-term culture and multiple passages is ensured through stable genetic characteristics.
Smart Images

Figure CN120210249A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology, and specifically relates to a gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide. Background Art
[0002] In the field of biomedical technology, elastin-like polypeptides have shown broad application prospects in drug delivery, tissue engineering, and biomaterials due to their unique physical and chemical properties, as well as good biocompatibility and biodegradability. In particular, elastin-like polypeptides with RGD targeting function can specifically bind to integrin receptors on the cell surface, thereby realizing functions such as targeted drug delivery and cell adhesion;
[0003] However, there are many disadvantages in the existing methods for expressing RGD-targeted elastin-like polypeptides. For example, some methods use complex and inefficient expression systems, resulting in the yield and quality of polypeptides unable to meet the requirements of practical applications. In addition, there are also deficiencies in the purification, modification, and stability of existing polypeptides, which limit their application scope in the biomedical field;
[0004] In addition, some plasmids often have problems such as cumbersome operation and low efficiency in the construction, transformation, and expression processes. At the same time, the RGD-targeted elastin-like polypeptides expressed by these plasmids also need to be further improved in terms of biological activity and stability.
[0005] Therefore, those skilled in the art have proposed a gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide, aiming to develop a highly efficient, stable, and easy-to-operate gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide to meet the needs of the biomedical field for high-performance polypeptide materials. Summary of the Invention
[0006] In order to solve the above technical problems, the present invention provides a gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide to solve the problems mentioned in the background art.
[0007] A gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide, comprising a vector, wherein the vector is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is G(VPGYG) n (VPGXG) n (RGD) m , where X is a hydrophilic amino acid, and n = 20 - 50, m = 1 - 3.
[0008] Preferably, the preparation steps of the RGD-targeted amphiphilic elastin-like polypeptide include:
[0009] S1. Construct a recombinant plasmid with the gene sequence of the target gene expressing RGD-targeted amphiphilic elastin-like polypeptide;
[0010] S2. Transfer the above recombinant plasmid into BL21(DE3) competent cells to obtain a transformed strain, and resuscitate and culture the transformed strain in a medium;
[0011] S3. After the culture is completed, transfer the transformed strain to a medium containing ampicillin for culture, screen the transformed strain that has successfully transformed the plasmid and continue to culture it;
[0012] S4. After inducing the transformed strain that has successfully transformed the plasmid with isopropyl-β-D-thiogalactoside, collect the cell precipitate, and after breaking and purifying the cell precipitate, obtain RGD-targeted amphiphilic elastin-like polypeptide.
[0013] Preferably, the amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.1, and the gene sequence of its recombinant plasmid target gene is the sequence shown in SEQ ID NO.2.
[0014] Preferably, the amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.3, and the gene sequence of its recombinant plasmid target gene is the sequence shown in SEQ ID NO.4.
[0015] Preferably, the amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.5, and the gene sequence of its recombinant plasmid target gene is the sequence shown in SEQ ID NO.6.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] In the present invention, a gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide is constructed. This plasmid can express elastin-like polypeptide with RGD-targeting function, and the expressed elastin-like polypeptide is amphiphilic, which means they have both hydrophilic and hydrophobic properties. This characteristic makes these polypeptides have a wider range of uses in biomedical applications; the tyrosine in the hydrophobic repeat unit of the polypeptide can be conjugated with radioactive iodine nuclide, which provides the possibility for its application in radiotherapy and diagnosis; and the pET-25b(+) plasmid as a vector has relatively stable genetic characteristics and can stably replicate and inherit in host cells, which ensures that the recombinant plasmid can still maintain the integrity of its structure and function during long-term culture and multiple passages. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1Schematic diagram of the gene synthesis plasmid of ELP-RGD provided by the embodiments of the present invention, where InsertSequence is the gene synthesis sequence of ELP-RGD. Detailed implementation manners
[0019] The following further describes in detail the implementation manners of the present invention in conjunction with the drawings and embodiments. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.
[0020] As shown in the attached Figure 1 figure:
[0021] Embodiment 1: A gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide, including a vector, the vector is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is G(VPGYG) n (VPGXG) n (RGD) m , where X is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., tyrosine in the hydrophobic repeat unit thereof can be coupled with a radioiodine nuclide, and n = 20 - 50, m = 1 - 3.
[0022] The vector is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is the sequence shown in SEQ ID NO.1, and tyrosine in the hydrophobic repeat unit thereof is coupled with iodine-125 radioiodine nuclide.
[0023] The steps for preparing the RGD-targeted amphiphilic elastin-like polypeptide ELP-RGD are as follows:
[0024] A1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.2:
[0025] First, synthesize the target gene fragment, and then use the pET-25b(+) plasmid as a vector, and obtain a recombinant plasmid after digestion and ligation;
[0026] The pET-25b(+) plasmid contains a resistance selection marker, usually a resistance gene to an antibiotic (such as ampicillin resistance), so that only the host cells carrying the plasmid can grow in the medium containing the corresponding antibiotic. This resistance marker facilitates the plasmid transformation and screening processes. The pET-25b(+) plasmid can be widely used in a variety of Escherichia coli host cells, such as the BL21(DE3) series.
[0027] The pET-25b(+) plasmid, as a vector, has relatively stable genetic characteristics and can stably replicate and be inherited in host cells. This stability ensures that the recombinant plasmid can maintain the integrity of its structure and function during long-term culture and multiple passages. The DNA molecule of the plasmid is relatively small, making it easy to perform various molecular biology operations such as extraction, purification, restriction digestion, ligation, etc. These operations are relatively simple and fast, making the construction and identification process of the recombinant plasmid more efficient. In summary, the recombinant plasmid has the advantages of stability and reliability, simplicity of operation, flexibility, high efficiency, economy, and safety.
[0028] A2. Thaw the BL21(DE3) competent cells in an ice-water bath. Take 3 μL of the above-mentioned recombinant plasmid at 200 ng / μL and mix it evenly with 50 μL of BL21(DE3) competent cells. Let it stand in the ice-water bath for 30 min. After standing, perform heat shock at 42 °C for 60 s. Immediately after heat shock, quickly place it in the ice-water bath and let it stand for 2 min. Then add 250 μL of LB liquid medium without antibiotics, mix well, and place it in a shaker at 37 °C and shake at 200 rpm for 60 min for recovery culture.
[0029] A3. After the recovery culture, dilute the bacteria obtained in A2 5-fold with LB liquid medium containing 50 μg / mL ampicillin (Amp), spread it evenly on the LB solid medium containing Amp, invert the plate, and culture it overnight.
[0030] The next day, pick multiple single colonies into 4 mL of LB liquid medium containing Amp, shake at 230 rpm in a shaker at 37 °C until the OD is 0.6 - 0.8. Take 2 μL for colony PCR. Select the bacteria that have successfully transformed the plasmid (colony PCR shows the corresponding gene bands), expand the volume to 100 mL, shake at 230 rpm in a shaker at 37 °C until the OD is 0.6 - 0.8.
[0031] A4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacteria finally obtained in A3, and induce at 16 °C and 230 rpm for 24 h. After induction, centrifuge at 4 °C and 7000 rpm for 10 min, discard the supernatant, and collect the bacterial cell pellet I.
[0032] Resuspend the collected bacterial cell pellet I with water, centrifuge at 4 °C and 7000 rpm for 10 min, discard the supernatant, and collect the bacterial cell pellet II again.
[0033] After resuspending the bacterial cell pellet II with the equilibration buffer, the bacterial cells were disrupted using an ultrasonic disruptor under ice-water bath conditions, and then centrifuged at 4 °C and 12,000 rpm for 10 min. After collecting the supernatant, it was filtered through a 0.45 μM filter membrane. After filtration, nickel column purification was performed. The purified polypeptide was dialyzed overnight in 1×PBS at 4 °C to obtain ELP-RGD. After aliquoting ELP-RGD, it was stored at -20 °C.
[0034] SEQ ID NO.1 is as follows:
[0035] GVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGRGD.
[0036] SEQ ID NO.2 is as follows:
[0037] GGGGTACCCGGATATGGTGTTCCAGGATACGGCGTGCCGGGTTACGGCGTACCGGGTTATGGCGTGCCTGGCTACGGCGTGCCGGGCTACGGCGTACCGGGTTATGGTGTGCCGGGCTACGGTGTGCCAGGCTACGGCGTTCCGGGTTACGGTGTGCCGGGTTACGGCGTCCCGGGTTACGGCGTGCCGGGCTACGGCGTTCCGGGTTACGGCGTTCCGGGTTATGGCGTTCCGGGTTATGGTGTTCCTGGTTATGGTGTGCCGGGTTATGGCGTCCCGGGCTATGGCGTCCCAGGTTATGGCGTCCCGGGTTATGGTGTGCCGGGCTACGGCGTTCCGGGTTACGGCGTCCCAGGTTATGGTGTCCCGGGCTCCGGCGTGCCAGGCTCTGGCGTGCCAGGTTCTGGCGTGCCGGGTAGCGGTGTTCCGGGTTCTGGCGTGCCCGGGTCCGGCGTGCCGGGTTCCGGTGTTCCGGGCAGCGGTGTGCCGGGTTCGGGCGTCCCGGGTAGCGGTGTTCCGGGTTCCGGCGTGCCGGGTAGCGGTGTACCGGGTAGCGGTGTGCCGGGTAGCGGCGTTCCGGGTTCGGGCGTTCCGGGTAGCGGTGTTCCGGGTTCCGGCGTTCCGGGTAGCGGCGTTCCGGGTTCAGGCGTGCCGGGTAGCGGCGTGCCGGGTAGCGGCGTTCCGGGTAGCGGTGTTCCGGGTTCTGGCGTTCCGGGTAGCGGGCGTGGTGAC。
[0038] Example 2: A gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide, comprising a vector, wherein the vector is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is G(VPGYG) n (VPGXG) n (RGD) m , where X is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., tyrosine in the hydrophobic terminal repeating unit can be coupled with a radioisotope of iodine, and n = 20 - 50, m = 1 - 3.
[0039] The carrier is an RGD-targeted amphiphilic elastin-like polypeptide, whose amino acid sequence is the sequence shown in SEQ ID NO.3, and tyrosine in the hydrophobic repeating unit thereof is coupled with iodine-131 radioactive iodine nuclide.
[0040] The steps for preparing the RGD-targeted amphiphilic elastin-like polypeptide ELP-RGD are as follows:
[0041] A1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.4;
[0042] A2. Transform the recombinant plasmid into BL21(DE3) competent cells, and culture with shaking for resuscitation;
[0043] A3. Dilute the bacterial cells obtained in A2 by 5 times in LB liquid medium containing 50 μL / mL ampicillin (Amp), evenly spread it on the LB solid medium containing Amp, invert the plate, and culture overnight; Select the bacterial cells with successfully transformed plasmid, and expand the culture to OD0.6 - 0.8;
[0044] A4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacterial cells finally obtained in A3 to induce the expression of elastin-like polypeptide; Wash and lyse the bacterial cells, collect the supernatant after centrifugation, and purify the supernatant using a nickel column; Dialyze the purified polypeptide overnight in 1×PBS at 4°C to obtain amphiphilic ELP, aliquot the amphiphilic ELP and store it at -20°C.
[0045] SEQ ID NO.3 is as follows:
[0046] GVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGVPGAGRGDRGD.
[0047] SEQ ID NO.4 is as follows:
[0048] GGGGTACCCGGATATGGTGTTCCAGGATACGGCGTGCCGGGTTACGGCGTACCGGGTTATGGCGTGCCTGGCTACGGCGTGCCGGGCTACGGCGTACCGGGTTATGGTGTGCCGGGCTACGGTGTGCCAGGCTACGGCGTTCCGGGTTACGGTGTGCCGGGTTACGGCGTCCCGGGTTACGGCGTGCCGGGCTACGGCGTTCCGGGTTACGGCGTTCCGGGTTATGGCGTTCCGGGTTATGGTGTTCCTGGTTATGGTGTGCCGGGTTATGGCGTCCCGGGCTATGGCGTCCCAGGTTATGGCGTCCCGGGTTATGGTGTGCCGGGCTACGGCGTTCCGGGTTACGGCGTCCCAGGTTATGGTGTCCCAGGCGCAGGTGTTCCAGGCGCAGGTGTCCCAGGCGCAGGTGTGCCTGGTGCTGGTGTCCCGGGTGCAGGCGTGCCAGGCGCAGGCGTGCCGGGTGCAGGCGTGCCGGGTGCAGGTGTTCCAGGCGCTGGCGTGCCGGGTGCTGGTGTGCCGGGTGCAGGCGTTCCGGGTGCAGGTGTACCAGGTGCAGGTGTTCCGGGCGCAGGCGTGCCGGGTGCTGGTGTTCCGGGCGCAGGTGTTCCGGGCGCAGGTGTTCCGGGTGCTGGCGTGCCGGGTGCAGGCGTTCCGGGTGCTGGTGTGCCGGGTGCAGGTGTCCCGGGCGCAGGTGTTCCGGGCGCTGGTGTGCCAGGTGCAGGCCGTGGTGACCGTGGTGAC。
[0049] Example 3: A gene synthesis plasmid for expressing RGD-targeted elastin-like polypeptide, comprising a vector, wherein the vector is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is G(VPGYG) n (VPGXG) n (RGD) m , wherein X is a hydrophilic amino acid such as serine, alanine, glutamic acid, etc., tyrosine in the hydrophobic terminal repeating unit can be coupled with a radioisotope of iodine, and n = 20 - 50, m = 1 - 3.
[0050] The carrier is an RGD-targeted amphiphilic elastin-like polypeptide, whose amino acid sequence is the sequence shown in SEQ ID NO.5, and tyrosine in the hydrophobic repeat unit is coupled with iodine-123 radioactive iodine nuclide.
[0051] The steps for preparing the RGD-targeted amphiphilic elastin-like polypeptide ELP-RGD are as follows:
[0052] A1. Construct a recombinant plasmid, and the target gene sequence is the sequence shown in SEQ ID NO.6;
[0053] A2. Transform the recombinant plasmid into BL21(DE3) competent cells and culture with shaking for resuscitation;
[0054] A3. Dilute the bacterial cells obtained in A2 by 5 times in LB liquid medium containing 50 μL / mL ampicillin (Amp), evenly spread it on the LB solid medium containing Amp, invert the plate and culture overnight;
[0055] Select the bacterial cells with successfully transformed plasmids and expand the culture to OD 0.6 - 0.8;
[0056] A4. Add isopropyl-β-D-thiogalactoside with a final concentration of 1 mM to the bacterial cells finally obtained in A3 to induce the expression of elastin-like polypeptide; wash and lyse the bacterial cells, collect the supernatant after centrifugation, and purify the supernatant using a nickel column; dialyze the purified polypeptide overnight in 1×PBS at 4°C to obtain amphiphilic ELP, aliquot the amphiphilic ELP and store it at -20°C.
[0057] SEQ ID NO.5 is as follows:
[0058] GVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGYGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGVPGSGRGDRGDRGD。
[0059] SEQ ID NO. 6 is as follows:
[0060]
[0061] Importantly, it should be noted that the construction and arrangement of the present application shown in multiple different exemplary embodiments are merely illustrative. Although only a few embodiments are described in detail in this disclosure, those who refer to this disclosure should easily understand that many modifications are possible without substantially departing from the novel teachings and advantages of the subject matter described in this application. Other substitutions, modifications, changes, and omissions may be made in the design, operating conditions, and arrangement of the exemplary embodiments without departing from the scope of the present invention. Therefore, the present invention is not limited to a specific embodiment, but extends to various modifications that still fall within the scope of the appended claims.
[0062] In addition, in order to provide a concise description of the exemplary embodiments, all features of the actual embodiments may not be described (i.e., those features that are not relevant to the best mode currently considered for implementing the present invention or those features that are not relevant to implementing the present invention).
[0063] It should be understood that in the development of any actual implementation, such as in any engineering or design project, a large number of specific implementation decisions may be made. Such development efforts may be complex and time-consuming, but for those of ordinary skill in the art who benefit from this disclosure, the development efforts will be a routine task of design, manufacture, and production without excessive experimentation.
[0064] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.
Claims
1. A gene synthesis plasmid for expressing an RGD-targeted elastin-like polypeptide, characterized in that: The carrier is an RGD-targeted amphiphilic elastin-like polypeptide, and its amino acid sequence is G(VPGYG) n (VPGXG) n (RGD) m , wherein X is a water amino acid, and n=20-50, m=1-3.
2. A gene synthesis plasmid for expressing an RGD-targeted elastin-like polypeptide as claimed in claim 1, characterized in that: The RGD-targeted amphiphilic elastin-like polypeptide comprises the following preparation steps: S1. constructing a recombinant plasmid, wherein the target gene sequence expresses the gene sequence of the RGD-targeted amphiphilic elastin-like polypeptide; S2, transferring the above recombinant plasmid into BL21 (DE3) competent cells to obtain a transformed strain, and resuscitating the transformed strain in a culture medium; S3. After the culture is completed, the transformed strain is transferred to a medium containing ampicillin for culture, and the transformed strain with successful transformation of the plasmid is selected and continued to be cultured; S4. After inducing the transformed strain with the successfully transformed plasmid with isopropyl-β-D-thiogalactoside, the bacterial precipitate is collected, and the bacterial precipitate is crushed and purified to obtain the RGD-targeted amphiphilic elastin-like polypeptide.
3. A gene synthesis plasmid for expressing an RGD-targeted elastin-like polypeptide as claimed in claim 1, characterized in that: The amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.1, and the target gene sequence of the recombinant plasmid is the sequence shown in SEQ ID NO.
2.
4. A gene synthesis plasmid for expressing an RGD-targeted elastin-like polypeptide as claimed in claim 1, characterized in that: The amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.3, and the target gene sequence of the recombinant plasmid is the sequence shown in SEQ ID NO.
4.
5. A gene synthesis plasmid for expressing an RGD-targeted elastin-like polypeptide as claimed in claim 1, characterized in that: The amino acid sequence of the RGD-targeted amphiphilic elastin-like polypeptide is the sequence shown in SEQ ID NO.5, and the target gene sequence of the recombinant plasmid is the sequence shown in SEQ ID NO.6.