Method for modifying specificity of plant non-coding RNA molecules for silencing gene expression
By introducing DNA editing agents to modify genes that are non-coding RNA molecules in plant cells, conferring silencing specificity to target RNA, the problem of difficulty in effectively silencing target RNA in plant cells is solved, and the effect of improving plant tolerance and yield is achieved.
Patent Information
- Application Number
- CN202510041499.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2017-11-23
- Filing Date
- 2018-09-18
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to effectively modify genes for encoding or processing into a non-coding RNA molecule that does not have RNA silencing activity in plant cells, especially when silencing a specific target RNA.
By introducing a DNA editing agent into plant cells, the non-coding RNA molecule is conferred silent specificity against the target RNA of interest, thereby modifying its genes.
The specific modification of genes of non-coding RNA molecules in plant cells is achieved, effectively silencing or redirecting the expression of target RNA, and improving the tolerance of plants to stress, pathogens and pests.
Smart Images

Figure CN120210261A_ABST
Abstract
Description
[0001] This application is a divisional application. The filing date of its original application is September 18, 2018, the application number is 201880073961.1 (International Application Number PCT / IB2018 / 057160), and the title is "Method for Modifying the Specificity of Plant Non-Coding RNA Molecules for Silencing Gene Expression".
[0002] Technical Field and Background Art
[0003] Some embodiments of the present invention relate to modifying genes encoding or being processed into non-coding RNA molecules (including RNA silencing molecules), and particularly but not exclusively to using the same genes to silence the expression of endogenous or exogenous target genes of interest in plants.
[0004] RNA silencing or RNA interference (RNAi) is an endogenous co-transcriptional or post-transcriptional genetic regulatory mechanism by which RNA molecules inhibit gene expression or translation, usually mediated by non-coding RNA molecules, including microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (ta-siRNA), piwi-interacting RNA (piRNA), antisense RNA, etc. In recent years, other non-coding RNAs have been recognized as having RNA silencing activity, including transfer RNA (tRNA), small nuclear RNA (snoRNA), small nucleolar RNA (snoRNA), and repeats-derived RNA. These typical and atypical RNA silencing molecules differ in their substrate, biogenesis, effector proteins, and target downregulation patterns.
[0005] In addition, Argonaute proteins complex with small RNAs to form the core of the RNA-induced silencing complex (RISC) (RNA interference (RNAi) effector complex). The Argonaute family is divided into two branches, called Ago and Piwi. Ago proteins (e.g., Ago1 and Ago2) usually complex with miRNA and siRNA, while Piwi proteins (e.g., Piwi, Ago3, and Aubergine (Aub)) usually complex with piRNA.
[0006] Small interfering RNA (siRNA) is a double-stranded RNA molecule with a length of 20 to 25 nucleotides (nt), which causes no translation by degrading its transcript during or after transcription, thereby interfering with the expression of a specific gene with a complementary nucleotide sequence.
[0007] MicroRNA (miRNA) is a small endogenous non-coding RNA (ncRNA) with a length of 20 to 24 nt, which originates from a long self-complementary precursor. Mature miRNA regulates gene expression in two ways: (i) by inhibiting translation or (ii) by degrading the coding mRNA through complete or near-complete complementarity with the target transcript. Most plant target mRNAs contain a single miRNA complementary site, which leads to the cleavage and degradation of the target mRNA by the RNA silencing molecule and the RNA decay mechanism.
[0008] Piwi-interacting RNA (piRNA) is a small non-coding RNA, which is the product of a long single-stranded precursor molecule and is produced without any cleavage step. The length of piRNA is usually 26 to 31 nt, and most of them are antisense. PiRNA forms an RNA-protein complex by interacting with the Piwi protein. Antisense piRNA is usually loaded into Piwi or Aub.
[0009] Trans-acting siRNA (tasiRNA) is a class of small interfering RNA (siRNA) that inhibits gene expression through post-transcriptional gene silencing. Their biogenesis is initiated by the binding of miRNA to the tasiRNA precursor, which recruits RNA-dependent RNA polymerase (RdRp) to synthesize dsRNA from the tasiRNA precursor template. Next, such dsRNA is processed by DICER-LIKE 4 (DCL4) into "phased" spaced mature tasiRNA of about 21 nucleotides.
[0010] The latest advances in genome editing technologies have made it possible to alter DNA sequences in living cells. By editing only a few nucleotides out of billions of nucleotides in plant cells, these new technologies may be the most effective way to make crops grow better under adverse climates (crop performance and abiotic stress) and enhance resistance to biotic stress (insects, viruses, bacteria, beetles, nematodes, etc.). There are limited ways to achieve pest resistance using genome editing technologies (e.g., CRISPR / Cas9): knocking out plant susceptible genes (e.g., the well-known MLO gene) by introducing stop codons, frame shifts, insertions, deletions, etc.; or upregulating resistance genes (e.g., R genes) by modifying regulatory elements (e.g., promoters, microRNA binding sites, etc.). However, pathogen-specific methods are limited to transgenic CRISPR applications.
[0011] Previous work on genome editing of RNA molecules in various organisms (e.g., mice, humans, shrimp, plants) has focused on knocking out miRNA activity or altering its binding site in target RNAs, such as:
[0012] Zhao et al. (Zhao et al., Scientific Reports, 2014, 4:3943) provided a miRNA inhibition strategy using the CRISPR system in mouse cells. Zhao used a specifically designed gRNA to cleave a miRNA gene at a single site by Cas9, resulting in knockdown of the miRNA in mouse cells.
[0013] Jiang et al. (Jiang et al., RNA Biology, 2014, 11(10):1243 - 9) used CRISPR / Cas9 to substantially reduce human miR-93 from a population by targeting the 5’ region in HeLa cells. Small insertions and deletions (indels) were induced in the target region containing the Drosha processing site (i.e., the position where Drosha, a double-stranded RNA-specific RNase III enzyme, binds, cleaves, and thereby processes primary miRNA (pri-miRNA) into pre-miRNA in the nucleus of a host cell) and the seed sequence (i.e., the conserved heptametrical sequence, which is crucial for miRNA binding to mRNA and is usually located at positions 2 to 7 of the 5’ end of the miRNA). According to Jiang et al., even a single nucleotide deletion can completely knock out the target miRNA with high specificity.
[0014] Regarding plant genome editing, Bortesi and Fischer (Bortesi and Fischer, Biotechnology Advances, 2015, 33: 41-52) discussed the use of CRISPR-Cas9 technology in plants compared to ZFNs and TALENs, and Basak and Nithin (Basak and Nithin, Front Plant Sci., 2015, 6: 1001) demonstrated the use of CRISPR-Cas9 technology to knockout protein-coding genes in model plants (e.g., Arabidopsis and tobacco) and crops (e.g., wheat, maize, and rice).
[0015] In addition to disrupting miRNA activity or target binding sites, gene silencing methods that utilize artificial microRNA (amiRNA)-mediated gene silencing of endogenous and exogenous target genes have also been used (Tiwari et al., Plant Mol Biol., 2014, 86: 1). Similar to microRNA, amiRNA is single-stranded, approximately 21 nt long, and is designed by replacing the mature double-stranded miRNA sequence within pre-miRNA (Tiwari et al., 2014). These amiRNAs are introduced as a transgene into an artificial expression cassette (containing a promoter, terminator, etc.) (Carbonell et al., Plant Physiology, 2014, pp. 113.234989), processed through the small RNA biogenesis and silencing machinery, and downregulate target expression. According to Schwab et al. (Schwab et al., The Plant Cell, 2006, Vol. 18, 1121-1133), when expressed under tissue-specific or inducible promoters, amiRNAs are active and can be used for specific gene silencing in plants, especially when several related but not identical target genes need to be downregulated.
[0016] Senis et al. (Senis et al., Nucleic Acids Research, 2017, Vol. 45(1): e3) disclosed engineering a promoterless antiviral amiRNA into an endogenous miRNA locus. Specifically, Senis et al. inserted an amiRNA precursor transgene (hairpin pri-amiRNA) near a naturally occurring miRNA gene (e.g., miR122) by homology-directed DNA recombination induced by sequence-specific nucleases (e.g., Cas9 or TALEN). This method uses a promoterless and terminatorless amiRNA by taking advantage of the transcriptionally active DNA that expresses the natural miRNA (miR122), that is, the endogenous promoter and terminator drive and regulate the transcription of the inserted amiRNA transgene.
[0017] A variety of DNA-free methods for introducing RNA and / or proteins into cells have been previously described. For example, RNA transfection using electroporation and lipofection was described in U.S. Patent Application No. 20160289675. Cho described the direct delivery of the Cas9 / gRNA ribonucleoprotein (RNP) complex into cells by microinjecting the Cas9 protein and gRNA complex (Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins", Genetics, 2013, 195: 1177-1180). Kim described the delivery of the Cas9 protein / gRNA complex by electroporation (Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins", Genome Res., 2014, 24: 1012-1019). Zuris reported the delivery of the gRNA complex associated with the Cas9 protein by liposomes (Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", Nat Biotechnol., 2014, doi: 10.1038 / nbt.3081). SUMMARY OF THE INVENTION
[0018] In one aspect of some embodiments of the present invention, a method for modifying a gene encoding or being processed into a non-coding RNA molecule that does not have RNA silencing activity in a plant cell is provided, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity of the non-coding RNA molecule against a target RNA of interest, thereby modifying the gene encoding or being processed into the non-coding RNA molecule.
[0019] In one aspect of some embodiments of the present invention, there is provided a method for modifying a gene encoding or being processed into a non-coding RNA molecule that does not have RNA silencing activity in a plant cell, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity of the non-coding RNA molecule against a target RNA of interest.
[0020] In one aspect of some embodiments of the present invention, there is provided a method for modifying a gene encoding or being processed into an RNA silencing molecule against a target RNA in a plant cell, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.
[0021] In one aspect of some embodiments of the present invention, there is provided a method for modifying a gene encoding or being processed into an RNA silencing molecule against a target RNA in a plant cell, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different.
[0022] In one aspect of some embodiments of the present invention, there is provided a plant cell produced by the method of some embodiments of the present invention.
[0023] In one aspect of some embodiments of the present invention, there is provided a plant comprising the plant cell of some embodiments of the present invention.
[0024] In one aspect of some embodiments of the present invention, there is provided a method for producing a plant with reduced expression of a target gene, the method comprising: (a) breeding the plant of some embodiments of the present invention; and (b) selecting a plurality of progeny plants with reduced expression of the target RNA of interest or the second target RNA, or selecting progeny including a silencing specificity in the non-coding RNA molecule against a target RNA of interest, and the plurality of progeny plants or the progeny not including the DNA editing agent, thereby producing the plant with reduced expression of the target gene.
[0025] In one aspect of some embodiments of the present invention, a method for generating a plant having enhanced stress tolerance, increased yield, enhanced growth rate or enhanced yield quality is provided, the method comprising: modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality, thereby generating the plant.
[0026] In one aspect of some embodiments of the present invention, a method for generating a pathogen-tolerant or pathogen-resistant plant is provided, the method comprising: modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the pathogen, thereby generating the pathogen-tolerant or pathogen-resistant plant.
[0027] In one aspect of some embodiments of the present invention, a method for generating a pathogen-tolerant or pathogen-resistant plant is provided, the method comprising: modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the pathogen, thereby generating the pathogen-tolerant or pathogen-resistant plant.
[0028] In one aspect of some embodiments of the present invention, a method for generating a pest-tolerant or pest-resistant plant is provided, the method comprising: modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the pest, thereby generating the pest-tolerant or pest-resistant plant.
[0029] In one aspect of some embodiments of the present invention, a method for generating a pest-tolerant or pest-resistant plant is provided, the method comprising: modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the pest, thereby generating the pest-tolerant or pest-resistant plant.
[0030] In one aspect according to some embodiments of the present invention, a method for generating a herbicide-resistant plant is provided, the method comprising, for example, modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell according to some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the herbicide, thereby generating the herbicide-resistant plant.
[0031] In one aspect according to some embodiments of the present invention, a plant is provided, which is generated by the method according to some embodiments of the present invention.
[0032] In one aspect according to some embodiments of the present invention, a seed is provided, which is from the plant according to some embodiments of the present invention.
[0033] According to some embodiments of the present invention, the gene encoding or being processed into the non-coding RNA molecule is endogenous to the plant cell.
[0034] According to some embodiments of the present invention, the gene encoding the RNA silencing molecule is endogenous to the plant cell.
[0035] According to some embodiments of the present invention, the modification of the gene encoding or being processed into the non-coding RNA molecule comprises: endowing the non-coding RNA molecule with at least 45% complementarity to the target RNA of interest.
[0036] According to some embodiments of the present invention, the modification of the gene encoding the RNA silencing molecule comprises: endowing the RNA silencing molecule with at least 45% complementarity to the second target RNA.
[0037] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule is determined by measuring the RNA or protein level of the target RNA of interest.
[0038] According to some embodiments of the present invention, the silencing specificity of the RNA silencing molecule is determined by measuring the RNA level of the second target RNA.
[0039] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined phenotypically.
[0040] According to some embodiments of the present invention, the phenotypic determination is achieved by determining at least one plant phenotype selected from the group consisting of a leaf color of a plant, a flower color, a growth rate, a plant size, a crop yield, a fruit trait, a biotic stress tolerance, and an abiotic stress tolerance.
[0041] According to some embodiments of the present invention, the silencing specificity of the non-coding RNA molecule is determined genetically.
[0042] According to some embodiments of the present invention, the plant phenotype is determined prior to a plant genotype.
[0043] According to some embodiments of the present invention, the plant genotype is determined prior to a plant phenotype.
[0044] According to some embodiments of the present invention, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.
[0045] According to some embodiments of the present invention, the non-coding RNA molecule or the RNA silencing molecule is an RNA interference (RNAi) molecule.
[0046] According to some embodiments of the present invention, the RNA interference (RNAi) molecule is selected from the group consisting of a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a Piwi-interacting RNA (piRNA), and a trans-acting siRNA (tasiRNA).
[0047] According to some embodiments of the present invention, the non-coding RNA molecule is selected from the group consisting of a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), a long non-coding RNA (lncRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a repeat-derived RNA, and a transposable element RNA.
[0048] According to some embodiments of the present invention, the RNA molecule or the RNAi molecule is designed such that a sequence of the RNAi molecule is modified to retain structural originality and to be recognized by multiple cellular RNAi factors.
[0049] According to some embodiments of the present invention, the modification of the gene is achieved by a modification selected from the group consisting of a deletion, an insertion, a point mutation, and combinations thereof.
[0050] According to some embodiments of the present invention, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.
[0051] According to some embodiments of the present invention, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.
[0052] According to some embodiments of the present invention, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
[0053] According to some embodiments of the present invention, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.
[0054] According to some embodiments of the present invention, the modification is in a stem region, a loop region, and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
[0055] According to some embodiments of the present invention, the modification is an insertion.
[0056] According to some embodiments of the present invention, the modification is a deletion.
[0057] According to some embodiments of the present invention, the modification is a point mutation.
[0058] According to some embodiments of the present invention, the modification comprises a modification of up to 200 nucleotides.
[0059] According to some embodiments of the present invention, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0060] According to some embodiments of the present invention, the DNA editing agent comprises at least one gRNA operably linked to a plant-expressible promoter.
[0061] According to some embodiments of the present invention, the DNA editing agent does not comprise an endonuclease.
[0062] According to some embodiments of the present invention, the DNA editing agent comprises an endonuclease.
[0063] According to some embodiments of the present invention, the DNA editing agent is a DNA editing system selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), and CRISPR.
[0064] According to some embodiments of the present invention, the endonuclease comprises Cas9.
[0065] According to some embodiments of the present invention, the DNA editing agent is applied to the cell in the form of DNA, RNA, or RNP.
[0066] In some embodiments of the present invention, the DNA editing agent is linked to a reporter for monitoring expression in a plant cell.
[0067] In some embodiments of the present invention, the reporter is a fluorescent protein.
[0068] In some embodiments of the present invention, the target RNA of interest or the second target RNA is endogenous to the plant cell.
[0069] In some embodiments of the present invention, the target RNA of interest or the second target RNA is exogenous to the plant cell.
[0070] In some embodiments of the present invention, the plant cell is a protoplast.
[0071] In some embodiments of the present invention, the breeding includes hybridization or selfing.
[0072] In some embodiments of the present invention, the plant is non-transgenic (non-GMO).
[0073] In some embodiments of the present invention, the plant is selected from the group consisting of a crop, a flowering plant, and a tree.
[0074] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification and its definitions will prevail. Additionally, the materials, methods, and examples are illustrative only and are not intended to necessarily limit the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0075] Some embodiments of the present invention are described herein by way of example only, with reference to the accompanying drawings. Now specifically referring to the accompanying drawings, it should be understood that the details shown are by way of example and for the purpose of illustrative discussion of embodiments of the present invention. Thus, it is obvious that those skilled in the art will clearly know how to implement the embodiments of the present invention in combination with the description in the drawings.
[0076] In the accompanying drawings:
[0077] Figure 1This is a flowchart of an embodiment of Genome Editing Induced Gene Silencing (GEiGS) that uses siRNA targeting the PDS gene to replace endogenous miRNA, thereby inducing gene silencing of the endogenous PDS gene. To introduce the modification, a two-component system is being used. First, a CRISPR / CAS9 system in a vector containing GFP creates a cleavage at a selected locus through multiple designed specific guide RNAs to facilitate homologous DNA repair (HDR) at the site. Second, a donor sequence (with the modifications required for the miRNA sequence) is introduced as a template for the HDR to target multiple newly assigned genes. This system is being used in protoplast transformation, and through FACS enrichment (due to the GFP signal in the CRISPR / CAS9 vector), multiple plants are recovered and regenerated.
[0078] Figures 2A to 2C Photographs showing that silencing of the PDS gene causes photobleaching are presented. Tobacco (Nicotiana) ( Figures 2A to 2B ) and Arabidopsis ( Figure 2C ) plants with silencing of the PDS gene cause photobleaching in Nicotiana benthamiana ( Figure 2B ) and Arabidopsis ( Figure 2C , right). The photographs were taken three and a half weeks after PDS silencing.
[0079] Figures 3A to 3D Photographs of using GEiGS to knockdown the GFP expression level in Arabidopsis are shown. Compared with protoplasts ([[]]ID=17]] Figures 3C to 3D ) edited with GEiGS to express GFP siRNA, Arabidopsis protoplasts expressing GFP are shown as the control group ( Figures 3A to 3B ). Notably, GEiGS protoplasts or plants are silenced to express the GFP protein.
[0080] Figure 4 Flowchart of an embodiment of GEiGS that replaces endogenous miRNA with siRNA targeting GFP, generating Arabidopsis plants resistant to GFP with active RNAi. To introduce the modification, a CRISPR / CAS9 system in a vector containing RFP generates a cleavage at a selected locus through multiple designed specific guide RNAs to facilitate homologous DNA repair (HDR) at the site. Secondly, a donor sequence (with the modifications required for the miRNA sequence) is introduced as a template for the HDR to target the GFP gene. This system is being used in protoplasts expressing GFP, and enrichment of putative modifications (due to the RFP signal in the CRISPR / CAS9 vector) is being carried out by FACS and the plants are recovered, and the GFP signal intensity of the regenerated plants is being analyzed.
[0081] Figure 5 Flowchart of an embodiment of GEiGS that replaces endogenous miRNA with siRNA targeting GFP, generating Arabidopsis plants resistant to GFP with GEiGS-directed RNAi. Notably, GEiGS plants silence GFP expression after plant transformation. RFP is being used for cell enrichment with a transiently present CRISPR / CAS9 vector.
[0082] Figure 6 Flowchart of an embodiment of GEiGS that replaces endogenous miRNA with siRNA targeting GFP, generating plants resistant to virus infection (e.g., TMV infection (i.e., exogenous gene)). RFP is being used for cell enrichment with a transiently present CRISPR / CAS9 vector.
[0083] Figure 7 Photo of a lodging banana plant suffering from Toppling Disease caused by the burrowing nematode (Radopholus similis).
[0084] Figure 8 Table showing the occurrence of Radopholus similis and Pratylenchus coffeae on different crops in the Tay Nguyen region.
[0085] Figure 9It is a flowchart of an embodiment of a computational pipeline for generating multiple GEiGS templates. The computational GEiGS pipeline applies biological metadata and is capable of automatically generating multiple GEiGS DNA donor templates for minimally editing multiple endogenous non-coding RNA genes (e.g., multiple miRNA genes), thereby resulting in a new gain of function, namely redirecting their silencing ability to the expression of target genes of interest.
[0086] Figure 10 It is a flowchart of an embodiment showing the design of a pest-resistant plant targeting any desired exogenous pest gene. GEiGS, which replaces endogenous miRNA with siRNA targeting pathogen / pest essential genes, generates plants resistant to pathogen / pest infection.
[0087] Figure 11 It is a flowchart of an embodiment showing the main stages required for designing an RNA silencing molecule and minimally editing the bases of miRNA genes.
[0088] Figures 12A to 12G It shows the primary transcripts of miR-390 and the modified miR-390 structure and the targeted sequences. The secondary structure representation of the primary transcript of miR390 and its modified forms - ( Figure 12A ) wild type; ( Figures 12B to 12C ) modified form targeting GFP; ( Figures 12D to 12E ) modified form targeting AtPDS3; ( Figures 12F to 12G ) modified form targeting AtADH1. The mature miRNA / siRNA is outlined in red and shows structural conservation by design. The targeted regions operated by the CRISPR / CAS9 system are outlined in purple, and the NGG sequence is marked in yellow ( Figure 12A ).
[0089] Figures 13A to 13G It shows the primary transcripts of miR-173 and the modified miR-173 structure and the targeted sequences. The secondary structure representation of the primary transcript of miR173 and its modified forms - ( Figure 13A ) wild type; ( Figures 13B to 13C ) modified form targeting GFP; ( Figures 13D to 13E ) modified form targeting AtPDS3; ( Figures 13F to 13G ) modified form targeting AtADH1. The mature miRNA / siRNA is outlined in red and shows structural conservation by design. The targeted regions operated by the CRISPR / CAS9 system are outlined in purple, and the NGG sequence is highlighted in yellow ( Figure 13A ).
[0090] Figure 13H Examples of multiple GEiGS oligonucleotide designs are shown, where the precursor structure plays no role in biogenesis and thus does not need to be maintained. The designs are based on Brassica rapa bnTAS3B tasiRNA. From top to bottom: wild-type tasiRNA, GEiGS design with the least sequence variation, and GEiGS design with the most sequence variation. The selection of non-coding RNA precursors that generate mature small RNA molecules is highlighted in green. The sequence differences between the GEiGS oligonucleotides and the wild-type sequence are highlighted in red. Notably, unlike miRNA and tRNA, tasiRNA biogenesis does not depend on the precursor secondary structure.
[0091] Figures 14A to 14D Gene targeting by miR-173 and its modified forms is shown.( Figure 14A ) Wild-type miR-173 targets the TAS1c transcript (red) through the sequence complementarity of the mature miRNA with a sequence in the gene. The newly modified miRNAs (SWAP 1, 2, 3, 4, 9, and 10) are designed to target ( Figure 14B ) GFP, ( Figure 14C ) AtPDS3, and ( Figure 14D ) AtADH1 through their sequence complementarity (red). Modified nucleotides from the wt sequence are written in lowercase.
[0092] Figures 15A to 15D Gene targeting by miR-390 and its modified forms is shown.( Figure 15A ) Wild-type miR-390 targets the TAS3 transcript (red) through the sequence complementarity of the mature miRNA with a sequence in the gene. The newly modified miRNAs (SWAP 5, 6, 7, 8, 11, and 12) are designed to target ( Figure 15B ) GFP, ( Figure 15C ) AtPDS3, and ( Figure 15D ) AtADH1 through their sequence complementarity (red). Modified nucleotides from the wt sequence are written in lowercase.
[0093] Figure 16Shows the PDS3 phenotype / genotype: Phenotypic plants selected for bleaching were genotyped by internal amplicon PCR and then subjected to restriction enzyme digestion analysis with BtsαI (NEB) to verify the presence of the donor relative to the wild-type sequence. Lane 1: Treated plants without donor restriction; Lanes 2 to 4: PDS3-treated plants with donor restriction; Lane 5: Unrestricted positive plasmid donor control; Lane 6: Water control without template; Lane 7: Restricted positive plasmid donor; Lane 8: Plants bombarded with restricted negative donor; Lane 9: Restricted untreated control plants. The amplicons were subsequently subjected to external PCR amplification and sequencing to verify the insertion.
[0094] Figure 17 Shows the ADH1 phenotype / genotype: Plants were selected for resistance to allyl alcohol and genotyped by internal amplicon PCR and then subjected to restriction digestion with BccI (NEB) to verify the presence of the donor. Lane 1: Restricted allyl alcohol-sensitive control plants; Lanes 2 to 4: Allyl alcohol-resistant plants with donor restriction; Lane 5: Unrestricted positive plasmid donor control; Lane 6: No-template control; Lane 7: Restricted positive plasmid donor; Lane 8: Plants bombarded with restricted non-specific donor; Lane 9: Restricted non-allyl alcohol-treated control.
[0095] Figure 18 Is a figure showing gene expression analysis in miR-173-modified plants targeting the AtPDS3 transcript. Analysis of AtPDS3 expression was performed by qRT-PCR in the regeneration bombarded with GEiGS#4 and SWAP3 compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, an 82% decrease in the average observed gene expression level was seen when miR-173 was modified to target AtPDS3 compared to control plants (error bars show SD; p-value calculated based on Ct values < 0.01).
[0096] Figure 19 Is a figure showing gene expression analysis in miR-390-modified plants targeting the AtPDS3 transcript. Analysis of AtADH1 expression was performed by qRT-PCR in the regeneration bombarded with GEiGS#1 and SWAP11 compared to plants bombarded with GEiGS#5 and SWAP1 and 2 (GFP). Notably, an 82% decrease in the average observed gene expression level was seen when miR-390 was modified to target AtADH1 compared to control plants (error bars show SD; p-value calculated based on Ct values < 0.01). Detailed Description
[0097] Some embodiments of the present invention relate to modifying genes that are used to encode or are processed into non-coding RNA molecules (including RNA silencing molecules), and particularly but not exclusively to using the same genes to silence the expression of endogenous or exogenous target genes of interest in plants.
[0098] The principles and operations of the present invention can be better understood with reference to the accompanying drawings and the following description.
[0099] Before explaining in detail at least one embodiment of the present invention, it should be understood that the application of the present invention is not necessarily limited to the details set forth in the following description or illustrated by the examples. The present invention is capable of other embodiments or of being practiced or carried out in various ways. In addition, it should be understood that the terminology and terms used herein are for the purpose of description and should not be regarded as restrictive.
[0100] Previous work on genome editing of multiple RNA molecules in various organisms (e.g., mice, humans, plants) has focused on using transgenes to disrupt miRNA activity or multiple target binding sites. Genome editing in plants has further focused on using CRISPR-Cas9 technology, ZFNs, and TALENs for knocking out multiple genes or multiple insertions in a variety of model plants. In addition, gene silencing using artificial microRNA transgenes to silence multiple endogenous and exogenous target genes in various plants has also been described (Molnar A et al., Plant J., 2009, 58(1): 165-74, doi: 10.1111 / j.1365-313X.2008.03767.x, Epub Jan 19, 2009; Borges and Martienssen, Nature Reviews Molecular Cell Biology|AOP, published online Nov 4, 2015; doi: 10.1038 / nrm4085). The multiple artificial miRNA transgenes are introduced into multiple plant cells within an artificial expression cassette (including a promoter, terminator, selectable marker, etc.) and target expression is downregulated.
[0101] In practicing the present invention, the inventors have designed a gene editing technique that is designed to target and interfere with a non-natural target gene of interest (endogenous or exogenous to the plant cell) for multiple non-coding RNA molecules (e.g., endogenous). The gene editing technique described herein does not implement multiple classical molecular genetic and transgenic tools that include multiple expression cassettes (with a promoter, terminator, selectable marker).
[0102] As shown below and in the Examples section that follows, the inventors have designed a Genome Editing Induced Gene Silencing (GEiGS) platform that can utilize multiple endogenous non-coding RNA molecules in a plant cell (including, for example, multiple RNA silencing molecules (e.g., siRNA, miRNA, piRNA, tasiRNA, tRNA, rRNA, antisense RNA, snRNA, snoRNA, etc.)) and modify them to target and downregulate any RNA target of interest (see Figure 1 for an exemplary flowchart). Using GEiGS, the method can screen multiple potential non-coding RNA molecules, edit multiple nucleotides in these endogenous RNA molecules, thereby redirecting their specificity to effectively and specifically target and downregulate any RNA of interest (including endogenous and / or exogenous RNA encoded by various pathogens and various pests (see Figure 9 for an exemplary flowchart). In summary, GEiGS can be used as a novel non-transgenic technology for increasing crop yield, crop growth rate, crop quality, and protecting crops from stress, pathogens, pests, and herbicides.
[0103] Accordingly, in one aspect of the present invention, there is provided a method for modifying a gene encoding or being processed into a non-coding RNA molecule that does not have RNA silencing activity in a plant cell, the method comprising introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity on the non-coding RNA molecule for a target RNA of interest, thereby modifying the gene encoding or being processed into the non-coding RNA molecule.
[0104] In another aspect of the present invention, there is provided a method for modifying a gene encoding or being processed into an RNA silencing molecule for a target RNA in a plant cell, the method comprising: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting the specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.
[0105] As used herein, the term "plant" includes whole plants, grafted plants, ancestors and progeny of the plants, and plant parts, including seeds, seedlings, stems, roots (including tubers), rhizomes, scions, and plant cells, tissues, and organs. The plant can be in any form, including suspension cultures, embryos, meristems, calli, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that may be useful in the methods of the present invention include all plants belonging to the superfamily Viridiplantee, particularly monocotyledonous and dicotyledonous plants selected from the following, including a fodder or leguminous plant, an ornamental plant, a food crop, a tree or shrub, selected from the following list: Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp., Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp., Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp.) Cinnamon (Cinnamomum cassia), Arabica coffee (Coffea arabica), Mopane tree (Colophospermum mopane), Crown vetch (Coronillia varia), Cotoneaster (Cotoneaster serotina), Hawthorn (Crataegus spp.), Cucumber (Cucumis spp.), Cypress (Cupressus spp.), Silver fern (Cyathea dealbata), Quince (Cydonia oblonga), Japanese cedar (Cryptomeria japonica), Lemongrass (Cymbopogon spp.), Silver fern (Cynthea dealbata), Quince (Cydonia oblonga), Money cowry rosewood (Dalbergia monetaria), Large-leaved davallia (Davallia divaricata), Desmodium (Desmodium spp.), Tree fern (Dicksonia squarosa), Amplectent dibeteropogon (Dibeteropogon amplectens), Dioclea (Dioclea spp.), Dolichos (Dolichos spp.), Erect dorycnium (Dorycnium rectum), Pyramidal barnyard grass (Echinochloa pyramidalis), Rhodiola (Ehraffia spp.), Finger millet (Eleusine coracana), Lovegrass (Eragrestis spp.), Erythrina (Erythrina spp.), Eucalyptus (Eucalypfus spp.), False ebony (Euclea schimperi), Hairy eulalia (Eulalia villosa), Buckwheat (Pagopyrum spp.), Feijoa (Feijoa sellowlana), Strawberry (Fragaria spp.), Flemingia (Flemingia spp.), Freycinetia banksli, Japanese geranium (Geranium thunbergii), Ginkgo (GinAgo biloba), Wild soybean (Glycine javanica), Gliricidia (Gliricidia spp.), Upland cotton (Gossypium hirsutum), Grevillea (Grevillea spp.), Sheathed guibourtia (Guibourtia coleosperma), Hedysarum (Hedysarum spp.) Hemarthria altissima, Heteropogon contortus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hyperthelia dissoluta, Indigo incarnata, Iris spp., Leptarrhena pyrolifolia, Lespedeza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesii, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago sativa, Metasequoia glyptostroboides, Musa sapientum, banana, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativum, Podocarpus totara, Pogonarthria fleckii, Pogonarthria squarrosa, Populus spp.) Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp., Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp.)), grape (Vitis vinifera), Watsonia pyramidata, calla lily (Zantedeschia aethiopica), maize (Zea mays), amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, tree. Alternatively, algae and other non-viridiplantae can be used in the methods of some embodiments of the present invention.
[0106] According to a specific embodiment, the plant is a crop, a flowering plant or a tree.
[0107] According to a specific embodiment, the plant is a woody plant species, for example, kiwifruit (Actinidia chinensis) (Actinidiaceae), cassava (Manihotesculenta) (Euphorbiaceae), tulip tree (Liriodendron tulipifera) (Magnoliaceae), poplar (Populus) (Salicaceae), sandalwood tree (Santalum album) (Santalaceae), elm (Ulmus) (Ulmaceae) and different species of Rosaceae (apple, plum, pear) and Rutaceae (citrus, lime), gymnosperms (e.g., white spruce (Picea glauca) and loblolly pine (Pinus taeda)), forest trees (e.g., Betulaceae, Fagaceae, gymnosperms and tropical tree species), fruit trees, shrubs or herbaceous plants (e.g., banana, cocoa, coconut, coffee, date, grape and tea) and oil palm.
[0108] According to a specific embodiment, the plant is a tropical crop, for example, coffee, macadamia nut, banana, pineapple, taro, papaya, mango, barley, beans, cassava, chickpea, cocoa (chocolate), cowpea, maize (corn), millet, rice, sorghum, sugarcane, sweet potato, tobacco, taro, tea, yam.
[0109] "Grain", "seed" or "bean" refers to the reproductive unit of a flowering plant that is capable of developing into another such plant. As used herein, the multiple terms are used synonymously and interchangeably.
[0110] According to a specific embodiment, the plant is a plant cell, for example, a plant cell in an embryogenic cell suspension.
[0111] According to a specific embodiment, the plant is a protoplast.
[0112] The multiple protoplasts are derived from any plant tissue, for example, fruits, multiple flowers, multiple roots, multiple leaves, multiple embryos, embryogenic cell suspensions, callus or seedling tissues.
[0113] As used herein, the term "non-coding RNA molecule" refers to an RNA sequence that is not translated into an amino acid sequence and does not encode a protein.
[0114] According to one embodiment, the non-coding RNA molecule is generally subject to the RNA silencing processing mechanism or activity. However, some variations of multiple nucleotides are also contemplated herein (for example, for miRNAs of up to 24 nucleotides), which may trigger a processing mechanism leading to RNA interference or translational inhibition.
[0115] According to a specific embodiment, the non-coding RNA molecule is endogenous (naturally occurring, for example, native) to the cell. It should be understood that the non-coding RNA molecule can also be exogenous to the cell (i.e., externally added and not naturally occurring in the cell).
[0116] According to some embodiments, the non-coding RNA molecule includes an inherent translational inhibition activity.
[0117] According to some embodiments, the non-coding RNA molecule includes an inherent RNAi activity.
[0118] According to some embodiments, the non-coding RNA molecule does not include an inherent translational inhibition activity or an inherent RNAi activity (i.e., the non-coding RNA molecule does not have an RNA silencing activity).
[0119] According to one embodiment of the present invention, the non-coding RNA molecule is specific for a target RNA (e.g., a natural target RNA) and does not cross-inhibit or silence a second target RNA or a target RNA of interest, unless designed to do so (as described below), and exhibits a global homology of 100% or less, e.g., less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology with the target gene; as determined at the RNA or protein level by RT-PCR, immunoblotting, immunohistochemistry and / or flow cytometry, sequencing or any other detection method.
[0120] According to one embodiment, the non-coding RNA molecule is an RNA silencing or RNA interference (RNAi) molecule.
[0121] The term "RNA silencing" or RNAi refers to a cellular regulatory mechanism in which multiple non-coding RNA molecules (the "RNA silencing molecules" or "RNAi molecules") mediate co-transcriptional or post-transcriptional inhibition of gene expression or translation in a sequence-specific manner.
[0122] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition during transcription (co-transcriptional gene silencing).
[0123] According to a specific embodiment, co-transcriptional gene silencing includes epigenetic silencing (e.g., a chromatic state that prevents the expression of functional genes).
[0124] According to one embodiment, the RNA silencing molecule is capable of mediating RNA inhibition post-transcriptionally (post-transcriptional gene silencing).
[0125] Post-transcriptional gene silencing (PTGS) generally refers to the process of degradation or cleavage of multiple messenger RNA (mRNA) molecules (usually occurring in the cytoplasm), which reduces their activity by preventing translation. For example, and as discussed in detail below, a guide strand of an RNA silencing molecule pairs with a complementary sequence in an mRNA molecule and induces cleavage, e.g., by Argonaute 2 (Ago2).
[0126] Co-transcriptional gene silencing generally refers to the inactivation of gene activity (i.e., transcriptional repression), and usually occurs in the nucleus. This inhibition of gene activity is mediated by multiple epigenetically related factors, for example, methyltransferases, which methylate target DNA and histones. Thus, in co-transcriptional gene silencing, the binding of a small RNA to a target RNA (small RNA-transcript interaction) disrupts the stability of the target nascent transcript and recruits multiple DNA and histone modifying enzymes (i.e., multiple epigenetic factors), thereby inducing chromatin remodeling into a structure that inhibits gene activity and transcription. In addition, in co-transcriptional gene silencing, multiple long non-coding RNA scaffolds associated with chromatin may recruit multiple chromatin modifying complexes independently of multiple small RNAs. These co-transcriptional silencing mechanisms form multiple RNA surveillance systems that detect and silence inappropriate transcriptional events and provide a memory of these events through multiple self-reinforcing epigenetic loops (as described in D. Hoch and D. Moazed, RNA-mediated epigenetic regulation of gene expression, Nat Rev Genet., 2015, 16(2): 71-84).
[0127] According to one embodiment of the present invention, the RNAi biogenesis / processing mechanism produces the RNA silencing molecule.
[0128] According to one embodiment of the present invention, the RNAi biogenesis / processing mechanism produces the RNA silencing molecule, but the specific target has not been identified.
[0129] According to one embodiment, the non-coding RNA molecule has the ability to induce RNA interference (RNAi).
[0130] The following is a detailed description of non-coding RNA molecules including an inherent RNAi activity (e.g., being RNA silencing molecules) that can be used according to multiple specific embodiments of the present invention.
[0131] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.
[0132] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a single-stranded RNA (ssRNA) precursor.
[0133] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a single-stranded RNA precursor with a double-stranded structure.
[0134] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a dsRNA precursor (e.g., including full and partial base pairing).
[0135] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from an unstructured RNA precursor.
[0136] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a protein-coding RNA precursor.
[0137] According to one embodiment, the non-coding RNA molecule or the RNA silencing molecule is processed from a non-coding RNA precursor.
[0138] According to one embodiment, the dsRNA can be derived from two different complementary RNAs, or from a single RNA that folds on itself to form dsRNA.
[0139] Based on full and partial paired RNAs (i.e., double-stranded RNA; dsRNA), siRNA, and shRNA - the presence of multiple long dsRNAs in multiple cells stimulates the activity of a ribonuclease III enzyme (called dicer). Dicer (also known as endoribonuclease Dicer or helicase with RNase motif) is an enzyme that is commonly called Dicer-like (DCL) protein in multiple plants. Different plants have different numbers of DCL genes. Thus, for example, the Arabidopsis genome typically has four DCL genes, rice has eight DCL genes, and the maize genome has five DCL genes. Dicer is involved in the process of processing the dsRNA into multiple short fragments of dsRNA (called short interfering RNA (siRNA)). The length of the siRNA derived from dicer activity is typically about 21 to about 23 nucleotides, and includes an approximately 19 base pair duplex with two 3' nucleotide overhangs.
[0140] Accordingly, some embodiments of the present invention contemplate modifying a gene encoding a dsRNA to redirect a silencing specificity (including silencing activity) to a second target RNA (i.e., the target of interest).
[0141] According to one embodiment, multiple dsRNA precursors longer than 21 bp are used. Various studies have shown that long dsRNAs can be used to silence gene expression without inducing a stress response or causing significant off-target effects - see, for example, (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13: 3803 to 3810; Bhargava A et al., Brain Res. Protoc., 2004, 13: 115 to 125; Diallo M. et al., Oligonucleotides, 2003, 13: 381 to 392; Paddison P.J. et al., Proc. Natl. Acad. Sci. USA, 2002,; 99: 1443 to 1448; Tran N. et al., FEBS Lett., 2004, 573: 127 to 134).
[0142] The term "siRNA" refers to small inhibitory RNA duplexes (usually between 18 and 30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21-mers, having a central 19-bp duplex region and symmetric 2-base 3'-overhangs at the termini, although recently it has been described that chemically synthesized RNA duplexes 25 to 30 bases in length can be 100-fold more potent than 21-mers at the same position. It has been shown that the observed increased potency obtained by using longer RNAs to trigger RNAi is caused by providing a substrate (27-mer) rather than a product (21-mer) for Dicer, which increases the rate or efficiency of entry of the siRNA duplex into RISC.
[0143] It has been found that the position (rather than the composition) of the 3'-overhang affects the potency of an siRNA, and asymmetric duplexes having a 3'-overhang on the antisense strand are generally more potent than those having the 3'-overhang on the sense strand (Rose et al., 2005).
[0144] The strands of a double-stranded interfering RNA (e.g., siRNA) can be linked to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as described above, the RNA silencing molecules of some embodiments of the present invention can also be a short hairpin RNA (shRNA).
[0145] As used herein, the term short hairpin RNA (“shRNA”) refers to an RNA molecule having a stem-loop structure, comprising a first and a second region of complementary sequences, the degree of complementarity and the orientation of the regions being sufficient to allow base pairing between the regions, the first and second regions being joined by a loop region, the loop being due to a lack of base pairing between a plurality of nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11, and some of the nucleotides in the loop may participate in base pairing interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5’-CAAGAGA-3’ and 5’-UUACAA-3’ (International Patent Application Nos. WO2013126963 and WO2014107763). Those skilled in the art will recognize that the resulting single-stranded oligonucleotide forms a stem-loop or hairpin structure, including a double-stranded region capable of interacting with the RNAi machinery.
[0146] The RNA silencing molecules of some embodiments of the invention need not be limited to those molecules containing only RNA, but further include a plurality of chemically modified nucleotides and non-nucleotides.
[0147] The invention contemplates various types of siRNAs, including trans-acting siRNAs (Ta-siRNAs), repeat-associated siRNAs (Ra-siRNAs), and natural-antisense transcript-derived siRNAs (Nat-siRNAs).
[0148] According to one embodiment, the silencing RNA comprises “piRNA”, which is a class of Piwi-interacting RNAs, approximately 26 and 31 nucleotides in length. A plurality of piRNAs typically form a plurality of RNA-protein complexes by interacting with a plurality of Piwi proteins, i.e., a plurality of antisense piRNAs are typically loaded into a plurality of Piwi proteins (such as Piwi, Ago3, and Aubergine (Aub)).
[0149] miRNA - According to another embodiment, the RNA silencing molecule can be a miRNA.
[0150] The terms "microRNA", "miRNA", and "miR" are synonyms and refer to a collection of multiple non-coding single-stranded RNA molecules approximately 19 to 24 nucleotides in length that regulate gene expression. miRNAs are widespread in various organisms (e.g., insects, mammals, plants, nematodes) and have been shown to play roles in development, homeostasis, and disease etiology.
[0151] Initially, the pre-miRNA exists as a long, imperfect double-stranded stem-loop RNA, which is further processed by Dicer into an siRNA-like duplex, including the mature guide strand (miRNA) and a fragment of similar size (referred to as the passenger strand (miRNA*)). The miRNA and miRNA* can be derived from opposite arms of the pri-miRNA and pre-miRNA. Multiple miRNA* sequences can be found in libraries of cloned miRNAs, but the occurrence rate is generally lower than that of miRNAs.
[0152] Although initially present as a double-stranded type with miRNA*, the miRNA ultimately becomes incorporated into a ribonucleoprotein complex in the form of a single-stranded RNA, called the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can cause variability in the specificity of the miRNA / miRNA* duplex, the binding site of the target gene, the activity of the miRNA (inhibition or activation), and which strand of the miRNA / miRNA* duplex is loaded into the RISC.
[0153] When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex loaded into the RISC is the one with less tightly paired 5'-ends. In the case of roughly equal 5'-pairing at both ends of the miRNA:miRNA*, both miRNA and miRNA* may have gene silencing activity.
[0154] The RISC identifies multiple target nucleic acids based on the high complementarity between the miRNA and the mRNA, particularly through nucleotides 2 to 8 of the miRNA (referred to as the "seed sequence").
[0155] Many studies have looked at the described base pairing requirements between miRNAs and their mRNA targets for achieving efficient translational repression (reviewed by Bartel (Cell 116:281, 2004)). Multiple computational studies analyzing miRNA binding across the genome have shown a specific role for bases 2 to 8 at the 5' end of the miRNA (also called the "seed sequence") in target binding, but the role of the first nucleotide, which is usually an "A", has also been recognized (Lewis et al., Cell 120:15, 2005). Similarly, Krek et al. used nucleotides 1 to 7 or 2 to 8 to identify and validate multiple targets (Nat Genet. 37:495, 2005). The multiple target sites in the mRNA can be in the 5'UTR, 3'UTR, or coding region. Interestingly, multiple miRNAs can regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may suggest that the cooperative action of multiple RISCs provides the most efficient translational repression.
[0156] miRNAs may direct the RISC to downregulate gene expression by one of two mechanisms: mRNA cleavage or translational repression. If the mRNA has a degree of complementarity with the miRNA, the miRNA can specify cleavage of the mRNA. When a miRNA directs cleavage, the cut typically occurs between nucleotides that pair with residues 10 and 11 of the miRNA. Alternatively, if the miRNA does not have the necessary degree of complementarity with the miRNA, the miRNA can repress translation. Translational repression may be more prevalent in animals due to the lower degree of complementarity between the miRNA and the binding site.
[0157] It should be noted that there may be variability in the 5' and 3' ends of any pair of miRNA and miRNA*. This variability may be due to variability relative to the cleavage sites in the enzymatic processing by Drosha and Dicer. Variability at the 5' and 3' ends of miRNAs and miRNA* may also be due to mismatches in the multiple stem structures of the pri-miRNA and pre-miRNA. Mismatches in the multiple stem-loops may give rise to a large number of different hairpin structures. Variability in the multiple stem structures may also cause variability in the multiple products generated by cleavage by Drosha and Dicer.
[0158] It should be understood that the pre-miRNA sequence may include 45 to 90, 60 to 80, or 60 to 70 nucleotides, while the pri-miRNA sequence may include 45 to 30,000, 50 to 25,000, 100 to 20,000, 1,000 to 1,500, or 80 to 100 nucleotides.
[0159] According to one embodiment, the miRNA includes miR-390a (as shown in SEQ ID NO: 28).
[0160] According to one embodiment, the miRNA includes miR-173 (as shown in SEQ ID NO: 29).
[0161] Antisense - Antisense is a single-stranded RNA designed to prevent or inhibit the expression of a gene by specifically hybridizing with its mRNA. Downregulation of a target RNA can be achieved using an antisense polynucleotide that is capable of specifically hybridizing with an mRNA transcript encoding the target RNA.
[0162] As previously mentioned, the non-coding RNA molecule may not include a typical (intrinsic) RNAi activity (e.g., not a typical RNA silencing molecule, or its target has not been identified). Such non-coding RNA molecules include the following:
[0163] According to one embodiment, the non-coding RNA molecule is a transfer RNA (tRNA). The term "tRNA" refers to an RNA molecule that serves as the physical connection between the nucleotide sequence of multiple nucleic acids and the amino acid sequence of multiple proteins, formerly known as soluble RNA or sRNA. The length of tRNA is typically about 76 to 90 nucleotides.
[0164] According to one embodiment, the non-coding RNA molecule is a ribosomal RNA (rRNA). The term "rRNA" refers to the RNA component of the ribosome, i.e., the small ribosomal subunit or the large ribosomal subunit.
[0165] According to one embodiment, the non-coding RNA molecule is a small nuclear RNA (snRNA or U-RNA). The term "sRNA" or "U-RNA" refers to small RNA molecules found within multiple splicing speckles and multiple Cajal bodies in the nuclei of multiple eukaryotic cells. The length of snRNA is typically about 150 nucleotides.
[0166] According to one embodiment, the non-coding RNA molecule is a small nucleolar RNA (snoRNA). The term "snoRNA" refers to a class of small RNA molecules that mainly direct chemical modifications of other RNAs (e.g., rRNA, tRNA, and snRNA). snoRNAs are generally divided into two classes: C / D box snoRNAs are typically about 70 to 120 nucleotides in length and are associated with methylation; and H / ACA box snoRNAs are typically about 100 to 200 nucleotides in length and are associated with pseudouridylation.
[0167] Similar to snoRNAs are scaRNAs (i.e., Small Cajal body RNA genes), which have a role in RNA maturation similar to that of snoRNAs, but their targets are spliceosomal snRNAs, and they perform site-specific modifications on multiple spliceosomal snRNA precursors (in the multiple Cajal bodies of the nucleus).
[0168] According to one embodiment, the non-coding RNA molecule is an extracellular RNA (exRNA). The term "exRNA" refers to RNA species (e.g., exosomal RNA) that exist outside the multiple cells that transcribed them.
[0169] According to one embodiment, the non-coding RNA molecule is a long non-coding RNA (lncRNA). The term "lncRNA" or "long ncRNA" refers to non-protein-coding transcripts that are typically longer than 200 nucleotides.
[0170] Non-limiting examples of multiple non-coding RNA molecules include, but are not limited to, microRNA (miRNA), piwi-interacting RNA (piRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), small nuclear RNA (snRNA or URNA), small nucleolar RNA (snoRNA), small Cajal body RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), extracellular RNA (exRNA), repeat-derived RNA, transposable element RNA, and long non-coding RNA (lncRNA).
[0171] According to one embodiment, non-limiting examples of multiple RNAi molecules include but are not limited to small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), and trans-acting siRNA (tasiRNA).
[0172] As described above, the methods of some embodiments of the present invention are used to redirect the silencing activity and / or specificity of the non-coding RNA molecule (or, if the non-coding RNA molecule does not have an inherent ability to silence an RNA molecule, to generate a silencing activity and / or specificity) to a second target RNA or to a target RNA of interest.
[0173] According to one embodiment, the target RNA and the second target RNA are different.
[0174] According to one embodiment, a method for modifying a gene encoding or being processed into an RNA silencing molecule in a plant cell includes introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting the silencing activity and / or specificity of the RNA silencing molecule to a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.
[0175] As used herein, the term "redirecting silencing specificity" refers to reprogramming the original specificity of a non-coding RNA (e.g., an RNA silencing molecule) to a non-natural target of the non-coding RNA (e.g., an RNA silencing molecule). Thus, the original specificity of the non-coding RNA is eliminated (i.e., loss of function), and the new specificity is directed to an RNA target different from the natural target (i.e., the RNA of interest), i.e., gain of function. It should be understood that gain of function occurs only when the non-coding RNA does not have silencing activity.
[0176] As used herein, the term "target RNA" refers to an RNA sequence that is naturally bound by a non-coding RNA molecule. Thus, those skilled in the art consider the target RNA to be a substrate of the non-coding RNA.
[0177] As used herein, the term "second target RNA" refers to an RNA sequence (coding or non-coding) that is not naturally bound by a non-coding RNA molecule. Thus, the second target RNA is not a natural substrate of the non-coding RNA.
[0178] As used herein, the term "target RNA of interest" refers to an RNA sequence (coding or non-coding) that is to be silenced by a designed non-coding RNA molecule.
[0179] As used herein, the phrase "silencing a target gene" refers to the absence or an observable decrease in the level of mRNA and / or protein product from the target gene (e.g., due to co-transcriptional and / or post-transcriptional gene silencing). Thus, silencing of a target gene can be a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% decrease compared to a target gene not targeted by the designed non-coding RNA molecule of the invention.
[0180] The result of silencing can be confirmed by examining multiple external characteristics of a plant cell or a whole plant or other organism (from which the designed non-coding RNA molecule is extracted) or by various biochemical techniques (as described below).
[0181] It should be understood that the designed non-coding RNA molecule of some embodiments of the invention can have one (or some) off-target specific effects, provided that it does not affect agriculturally valuable traits (e.g., biomass, yield, etc.).
[0182] According to one embodiment, the second target RNA or target RNA of interest is endogenous to the plant cell. Exemplary endogenous second target RNAs or target RNAs of interest include, but are not limited to, a gene product that is sensitive to stress, infection, herbicide, or a gene product related to plant growth rate, crop yield, as further discussed below.
[0183] According to one embodiment, the second target RNA or target RNA of interest is exogenous to the plant cell (also referred to herein as heterologous). In this case, the second target RNA or target RNA of interest is a gene product of a non-natural part of the plant genome. Exemplary exogenous second target RNAs include, but are not limited to, a gene product of a plant pathogen, such as, but not limited to, an insect, a virus, a bacterium, a fungus, a nematode, as further discussed below. An exogenous target RNA (coding or non-coding) can include a nucleic acid sequence that shares sequence identity with an endogenous RNA sequence of the plant (e.g., can be partially homologous to an endogenous nucleic acid sequence).
[0184] The specific binding of an endogenous non-coding RNA molecule to a target RNA can be determined by computational algorithms (e.g., BLAST) and can be identified by methods including, for example, Northern blot, In Situ Hybridization, QuantiGene Plex assay, etc.
[0185] The use of the terms "complementarity" or "complementary" refers to the non-coding RNA molecule (or at least a part thereof in the form of the processed small RNA, or at least one strand or a part thereof of a double-stranded polynucleotide, or a part of a single-stranded polynucleotide) hybridizing to the target RNA or a fragment thereof under physiological conditions to effect regulation, action, or inhibition of the target gene. For example, in some embodiments, a non-coding RNA molecule has 100% sequence identity or at least about 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, or more consecutive nucleotides in the target RNA (or multiple family members of a given target gene).
[0186] As used herein, a non-coding RNA molecule or its processed small RNA form is said to exhibit "perfect complementarity" when each nucleotide of one of the multiple sequences read from 5' to 3' is complementary to each nucleotide of another sequence read from 3' to 5'. A nucleotide sequence that is perfectly complementary to a reference nucleotide sequence will exhibit the same sequence as the reverse complementary sequence of the reference nucleotide sequence.
[0187] Methods for determining sequence complementarity are well known in the art and include, but are not limited to, various bioinformatics tools well known in the art (e.g., BLAST, multiple sequence alignment).
[0188] According to one embodiment, if the non-coding RNA molecule is an siRNA or is processed into an siRNA, the complementarity with its target sequence is in the range of 90 to 100% (e.g., 100%).
[0189] According to one embodiment, if the non-coding RNA molecule is a miRNA or piRNA, or is processed into a miRNA or piRNA, the complementarity with its target sequence is in the range of 33 to 100%.
[0190] According to one embodiment, if the non-coding RNA molecule is a miRNA, the complementarity of its seed sequence (i.e., nucleotides 2 to 8 from the 5') with the target sequence is in the range of 85 to 100% (e.g., 100%).
[0191] According to one embodiment, the non-coding RNA can be further processed into a small RNA form (e.g., processing pre-miRNA into a mature miRNA). In this case, the homology is measured based on the processed small RNA form (e.g., the mature miRNA sequence).
[0192] As used herein, the term "small RNA form" refers to the mature small RNA capable of hybridizing with a target RNA (or a fragment thereof). According to one embodiment, the small RNA form has a silencing activity.
[0193] According to one embodiment, the complementarity with the target sequence is at least about 33% of the processed small RNA form (e.g., 33% of 21 to 28 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 33% of the mature miRNA sequence (e.g., 21 nt) includes seed complementarity (e.g., 7 nt of the 21 nt).
[0194] According to one embodiment, the complementarity with the target sequence is at least about 45% of the processed small RNA form (e.g., 45% of 21 to 28 nt). Thus, for example, if the non-coding RNA molecule is a miRNA, 45% of the mature miRNA sequence (e.g., 21 nt) includes seed complementarity (e.g., 9 to 10 nt of the 21 nt).
[0195] According to one embodiment, the non-coding RNA molecule (i.e., before modification) is typically selected as a molecule having about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or up to 99% complementarity with the sequence of the second target RNA or the target RNA of interest.
[0196] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 99% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0197] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 98% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0198] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 97% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0199] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 96% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0200] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 95% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0201] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 94% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0202] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 93% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0203] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 92% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0204] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 91% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0205] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is generally selected as a molecule having no more than 90% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0206] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is typically selected as a molecule having no more than 85% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0207] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is typically selected as a molecule having no more than 50% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0208] According to a specific embodiment, the non-coding RNA molecule (i.e., before modification) is typically selected as a molecule having no more than 33% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0209] According to one embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed such that the sequence for the second target RNA or the target RNA of interest includes at least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity.
[0210] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 33% complementarity to the second target RNA or the target RNA of interest (e.g., 85 to 100% seed match).
[0211] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 40% complementarity to the second target RNA or the target RNA of interest.
[0212] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 45% complementarity to the second target RNA or the target RNA of interest.
[0213] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 50% complementarity to the second target RNA or the target RNA of interest.
[0214] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 45% complementarity to the second target RNA or the target RNA of interest.
[0215] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 60% complementarity to the second target RNA or the target RNA of interest.
[0216] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 70% complementarity to the second target RNA or the target RNA of interest.
[0217] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 80% complementarity to the second target RNA or the target RNA of interest.
[0218] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 85% complementarity to the second target RNA or the target RNA of interest.
[0219] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 90% complementarity to the second target RNA or the target RNA of interest.
[0220] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 91% complementarity to the second target RNA or the target RNA of interest.
[0221] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 92% complementarity to the second target RNA or the target RNA of interest.
[0222] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 93% complementarity to the second target RNA or the target RNA of interest.
[0223] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 94% complementarity to the second target RNA or the target RNA of interest.
[0224] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 95% complementarity to the second target RNA or the target RNA of interest.
[0225] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 96% complementarity to the second target RNA or the target RNA of interest.
[0226] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 97% complementarity to the second target RNA or the target RNA of interest.
[0227] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 98% complementarity to the second target RNA or the target RNA of interest.
[0228] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 99% complementarity to the second target RNA or the target RNA of interest.
[0229] According to a specific embodiment, the non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have 100% complementarity to the second target RNA or the target RNA of interest.
[0230] To induce the silencing activity and / or specificity of a non-coding RNA molecule and / or redirect the silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) to a second target RNA or a target RNA of interest, the gene encoding the non-coding RNA molecule (e.g., an RNA silencing molecule) is modified using a DNA editing agent.
[0231] The following is a description of various non-limiting examples of methods and DNA editing agents for introducing multiple nucleic acid alterations into a gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule), and reagents for implementing the methods and DNA editing agents that can be used according to specific embodiments of the present disclosure.
[0232] Genome editing using engineered endonucleases - This method refers to a reverse genetics approach that typically uses engineered endonucleases to cut at desired locations in the genome and generate multiple specific double-stranded breaks (DSBs), which are then repaired by multiple intracellular processes, such as homologous recombination (HR) or non-homologous end-joining (NHEJ). NHEJ directly ligates the DNA ends of a double-stranded break (DSB) (with or without minimal end modifications), while HR utilizes a homologous donor sequence as a template (i.e., sister chromatids formed during S phase) for regenerating / replicating the missing DNA sequence at the break site. To introduce multiple specific nucleotide modifications into the genomic DNA, a donor DNA repair template (exogenously provided single-stranded or double-stranded DNA) containing the desired sequence must be present during HR.
[0233] Genome editing cannot be performed using traditional restriction endonucleases because most restriction enzymes recognize several base pairs on the DNA as their targets, and these sequences are typically found at many locations in the genome, resulting in multiple cuts that are not limited to a desired location. To overcome this challenge and generate multiple site-specific single-stranded or double-stranded breaks (DSBs), several different classes of nucleases have been discovered and bioengineered to date. These include meganucleases, zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs), and the CRISPR / Cas9 system.
[0234] Meganucleases - Meganucleases are typically classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by multiple structural motifs that affect catalytic activity and recognition sequence. For example, multiple members of the LAGLIDADG family are characterized by having one or two copies of the conserved LAGLIDADG motif. These four meganuclease families differ significantly from each other in terms of multiple conserved structural elements as well as DNA recognition sequence specificity and catalytic activity. Meganucleases are typically found in microbial species and have the unique property of having very long recognition sequences (>14bp), thus making their use for cutting at a desired location naturally very specific.
[0235] This can be used to create multiple site-specific double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high-throughput screening methods have been used to generate multiple meganuclease variants that recognize multiple unique sequences. For example, various meganucleases have been fused to generate multiple hybrid enzymes that recognize a new sequence.
[0236] Alternatively, multiple DNA-interacting amino acids of the meganuclease can be altered to design sequence-specific meganucleases (see, for example, U.S. Patent No. 8,021,867). Meganucleases can be designed using, for example, the methods described in Certo, MT et al. (Nature Methods, 2012, 9:073 to 975), U.S. Patent Nos. 8,304,222, 8,021,867, 8,119,381, 8,124,369, 8,129,134, 8,133,697, 8,143,015, 8,143,016, 8,148,098, or 8,163,514, each of which is incorporated herein by reference in its entirety. Alternatively, commercially available technologies (such as the Directed Nuclease Editor TM (Directed Nuclease Editor TM ) genome editing technology) can be used to obtain meganucleases with site-specific cleavage characteristics.
[0237] ZFNs and TALENs - Two different engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both been shown to be effective in generating multiple targeted double-strand breaks (DSBs) (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).
[0238] Basically, ZFN and TALEN endonuclease technologies utilize a non-specific DNA-cleaving enzyme that is linked to a specific DNA-binding domain (a series of multiple zinc finger domains or multiple TALE repeats, respectively). Typically, a restriction enzyme is selected whose DNA recognition site and cleavage site are separated from each other. The cleavage portion is separated and then linked to a DNA-binding domain, thereby generating an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with this property is FokI. Additionally, an advantage of FokI is that it requires dimerization to have nuclease activity, which means that as each nuclease partner recognizes a unique DNA sequence, the specificity is significantly increased. To enhance this effect, multiple Fok1 nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The functioning of the heterodimers as nucleases avoids the possibility of unwanted homodimer activity and thus increases the specificity of the double-strand break (DSB).
[0239] Thus, for example, to target a specific locus, multiple ZFNs and multiple TALENs are constructed as nuclease pairs, with each molecule in the pair designed to bind to adjacent sequences at the target site. After transient expression in cells, the nucleases bind to their target sites, and the FokI domains heterodimerize to generate a double-strand break (DSB). Repair of these double-strand breaks (DSBs) via the non-homologous end-joining (NHEJ) pathway typically results in multiple small deletions or multiple small sequence insertions (indels). Since each repair via NHEJ is unique, using a single nuclease pair can generate an allelic series with a range of different insertions or deletions at the target site.
[0240] Generally, in gene editing, NHEJ is relatively accurate (approximately 85% of DSBs are repaired via NHEJ within about 30 minutes from detection in human cells). Mistaken NHEJ is dependent because when the repair is accurate, the nuclease will continue to cleave until the repair product mutates and the recognition / cleavage site / PAM motif disappears / mutates, or the transiently introduced nuclease is no longer present.
[0241] The length of the deletion ranges from a few base pairs to several hundred base pairs, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a DNA fragment homologous to the targeted region is introduced in combination with the nuclease pair, the double-strand break (DSB) can be repaired by homologous recombination (HR) to generate multiple specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).
[0242] Although the nuclease moieties of multiple ZFNs and multiple TALENs have similar properties, the difference between these engineered nucleases lies in their DNA recognition peptides. ZFNs rely on Cys2-His2 zinc fingers, while TALENs rely on TALEs. These DNA recognition peptide domains of both have the feature that they exist in combinations of their proteins naturally. Multiple Cys2-His2 zinc fingers usually exist in multiple repeats spaced 3 bp apart and in multiple different combinations of various nucleic acid interacting proteins. On the other hand, multiple TALEs exist in multiple repeats with a one-to-one recognition rate between the multiple amino acids and the multiple recognized nucleotide pairs. Since both zinc fingers and TALEs occur in a repetitive pattern, different combinations can be tried to create a wide variety of sequence specificities. Multiple methods for preparing site-specific zinc finger endonucleases include, for example, modular assembly (where multiple zinc fingers associated with a triplet sequence are linked in a row to cover the desired sequence), OPEN (low-stringency selection of multiple peptide domains relative to multiple triplet nucleotides, followed by high-stringency selection of multiple peptide combinations relative to the final target in multiple bacterial systems), and bacterial one-hybrid screening of multiple zinc finger libraries, etc. ZFNs can also be commercially designed and obtained from, for example, Sangamo Biosciences TM (Richmond, California).
[0243] Methods for designing and obtaining TALENs are described, for example, in Reyon et al. (Nature Biotechnology, May 2012; 30(5):460-465), Miller et al. (Nat Biotechnol., 2011, 29:143-148), Cermak et al. (Nucleic Acids Research, 2011, 39(12):e82), and Zhang et al. (Nature Biotechnology, 2011, 29(2):149-153). A recently developed web-based program (called Mojo Hand), introduced by the Mayo Clinic, is used to design multiple TAL and TALEN constructs for genome editing applications (accessible at www.talendesign.org). ZFNs can also be commercially designed and obtained, for example, from Sangamo Biosciences TM (Richmond, California).
[0244] The T-GEE system (Target Gene’s Genome Editing Engine) - provides a programmable nucleoprotein molecular complex that contains a polypeptide moiety and a specificity conferring nucleic acid (SCNA), which assembles in vivo in a target cell and is capable of interacting with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex is capable of specifically modifying and / or editing a target site within the target nucleic acid sequence and / or modifying the function of the target nucleic acid sequence. The nucleoprotein composition includes (a) a polynucleotide molecule encoding a chimeric polypeptide and including (i) a functional domain capable of modifying the target site and (ii) a linker domain capable of interacting with the specificity conferring nucleic acid; and (b) the specificity conferring nucleic acid (SCNA), which includes (i) a nucleotide sequence complementary to regions flanking the target site of the target nucleic acid and (ii) a recognition region capable of specifically attaching to the linker domain of the polypeptide. The composition has a high degree of specificity and the ability of the molecular complex to bind to the target nucleic acid through base pairing of the specificity conferring nucleic acid with a target nucleic acid, and is capable of accurately, reliably, and cost-effectively modifying a predetermined nucleic acid sequence target. The composition has low genotoxicity, modular assembly, utilizes a single platform that does not require customization, can be used independently outside a dedicated core facility, and has a short development cycle and low cost.
[0245] CRISPR-Cas systems and all of their variants (also referred to herein as "CRISPR") - Many bacteria and archaea contain endogenous RNA-based adaptive immune systems that degrade multiple nucleic acids of invading multiple bacteriophages and multiple plasmids. These systems consist of multiple clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that generate multiple RNA components and multiple CRISPR-associated (Cas) genes (encoding multiple protein components). The multiple CRISPR RNAs (crRNAs) contain short homology to the DNA of multiple specific viruses and plasmids and direct the Cas nuclease to degrade multiple nucleic acids complementary to the corresponding pathogens. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes have shown that three components form an RNA / protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA with 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al., Science, 2012, 337: 816-821).
[0246] Further demonstration has shown that a synthetic chimeric guide RNA (gRNA) consisting of a fusion between the crRNA and the tracrRNA can direct Cas9 in vitro to cleave multiple DNA targets complementary to the crRNA. It has also been shown that co-transient expression of Cas9 with multiple synthetic gRNAs can be used to generate targeted multiple double-strand breaks (DSBs) in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).
[0247] The CRISPR / Cas system for genome editing contains two distinct components: a gRNA and an endonuclease, such as Cas9.
[0248] The gRNA (also referred to herein as short guide RNA (sgRNA)) is typically a 20-nucleotide sequence that encodes a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA (linking the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript). Through the base pairing between the gRNA sequence and the complementary genomic DNA, the gRNA / Cas9 complex is recruited to the target sequence. For successful binding to Cas9, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex positions Cas9 on the genomic target sequence, such that Cas9 can cleave both strands of the DNA, resulting in a double-strand break (DSB). Similar to ZFNs and TALENs, the double-strand breaks (DSBs) generated by CRISPR / Cas can undergo homologous recombination or NHEJ and are prone to specific sequence modifications during DNA repair.
[0249] The Cas9 nuclease has two functional domains: RuvC and HNH, each of which cleaves a different DNA strand. When both of these domains are active, Cas9 causes multiple double-strand breaks (DSBs) in the genomic DNA.
[0250] A significant advantage of CRISPR / Cas is the combination of the high efficiency of this system with the ability to easily generate multiple synthetic gRNAs. This results in a system that can be readily modified to target multiple modifications at different genomic loci and / or target multiple different modifications at the same locus. Additionally, protocols have been established that can simultaneously target multiple genes. Most cells carrying the mutation exhibit multiple biallelic mutations in the multiple targeted genes.
[0251] However, the flexibility evident in the base pairing interaction between the gRNA sequence and the genomic DNA target sequence allows for cleavage by Cas9 of sequences that do not perfectly match the target sequence.
[0252] Multiple modified forms of the Cas9 enzyme that contain a single inactive catalytic domain (RuvC- or HNH-) are referred to as "nickases". Having only one active nuclease domain, the Cas9 nickase only cleaves one strand of the target DNA, thereby generating a single-strand break or "nick". A single-strand break or nick is mostly repaired by single-strand break repair mechanisms that involve proteins such as, but not limited to, PARP (sensor) and the XRCC1 / LIG III complex (ligation). If a single-strand break (SSB) is generated on a naturally occurring SSB by multiple topoisomerase I poisons or by multiple drugs trapping RARP1, these may persist and when the cell enters the S phase and the replication fork encounters such an SSB, they will become multiple single-ended DSBs that can only be repaired by HR. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are considered a double-strand break, typically in a "double nick" CRISPR system. A double nick, essentially a non-parallel DSB, can be repaired by HR or NHEJ like other DSBs, depending on the desired effect on the gene target and the presence of a donor sequence and the cell cycle stage (HR is less abundant and can only occur in the S and G2 phases of the cell cycle). Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to generate a double nick (by designing two gRNAs and target sequences adjacent and on multiple opposite strands of the genomic DNA) will reduce off-target effects because either gRNA alone will make a nick that is less likely to alter the genomic DNA, even though these events are not impossible.
[0253] Modified forms of the Cas9 enzyme that contain two inactive catalytic domains (dead Cas9 or dCas9) do not have nuclease activity but are still able to bind to DNA based on gRNA specificity. The dCas9 can be used as a platform for multiple DNA transcriptional regulators to activate or inhibit gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA will interfere with gene transcription.
[0254] There are many publicly available tools that can help select and / or design multiple target sequences, as well as multiple unique gRNA lists for different genes in different species determined bioinformatically, such as, but not limited to, the Target Finder of the Feng Zhang laboratory, the E-CRISP of the Michael Boutros laboratory, the RGEN tool: Cas-OFFinder, CasFinder: a flexible algorithm for identifying specific Cas9 targets in the genome, and the CRISPR Optimal Target Finder.
[0255] To use the CRISPR system, both the gRNA and a Cas endonuclease (e.g., Cas9) should be expressed or present in a target cell (e.g., as a ribonucleoprotein complex). The insertion vector can contain two cassettes on a single plasmid, or the multiple cassettes are expressed by two separate plasmids. Multiple CRISPR plasmids are commercially available, e.g., the px330 plasmid from Addgene (75 Sidney St, Suite 550A·Cambridge, MA 02139). Svitashev et al. (Plant Physiology, 169(2): 931-945, 2015), Kumar and Jain (J Exp Bot, 66: 47-57, 2015), and U.S. Patent Application Publication No. 20150082478 disclose at least the use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) guide RNA technology and a Cas endonuclease to modify the plant genome, the contents of which are incorporated herein by reference in their entirety. Cas endonucleases that can be used for DNA editing via gRNA include, but are not limited to, Cas9, Cpf1 (Zetsche et al., Cell, 163(3): 759-71, 2015), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell., November 5, 2015; 60(3): 385-97).
[0256] According to a specific embodiment, the CRISPR includes a short guide RNA (sgRNA) that includes a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 4 or SEQ ID NOs: 235 to 366.
[0257] The "hit and run" or "in-out" gene targeting strategy involves a two-step recombination procedure. In the first step, an insertion vector containing a dual positive / negative selection marker cassette is used to introduce the desired sequence change. The insertion vector contains a single contiguous region homologous to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a site within the homology region, introduced into the cells, and positive selection is performed to isolate homologous recombination-mediated events. The DNA carrying the homologous sequences can be provided in the form of a plasmid, single-stranded, or double-stranded oligonucleotide. These homologous recombinants contain a local duplication separated by the intervening vector sequence containing the selection cassette. In the second step, negative selection is performed on the targeted clones to identify cells that have lost the selection cassette through intrachromosomal recombination between the repeat sequences. The local recombination event removes the repeats and, depending on the recombination sites, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without the retention of any exogenous sequences.
[0258] The "double-replacement" or "tag and exchange" strategy: involves a two-step selection procedure similar to the "hit and run" gene targeting method but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homologous arms is used to insert a dual positive / negative selection cassette near the location where the mutation is to be introduced. After introducing the system components into the cells and performing positive selection, HR-mediated events can be identified. Next, a second targeting vector containing a homologous region to the desired mutation is introduced into the targeted clones, and negative selection is performed to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating the unwanted exogenous sequences.
[0259] According to a specific embodiment, the DNA editing agent comprises a DNA targeting module (e.g., gRNA).
[0260] According to a specific embodiment, the DNA editing agent does not comprise an endonuclease.
[0261] According to a specific embodiment, the DNA editing agent comprises a nuclease (e.g., an endonuclease) and a DNA targeting module (e.g., gRNA).
[0262] According to a specific embodiment, the DNA editing agent is a CRISPR / Cas, e.g., gRNA and Cas9.
[0263] According to a specific embodiment, the DNA editing agent is TALEN.
[0264] According to a specific embodiment, the DNA editing agent is ZEN.
[0265] According to a specific embodiment, the DNA editing agent is mega nuclease.
[0266] According to one embodiment, the DNA editing agent is linked to a reporter for monitoring expression in a plant cell.
[0267] According to one embodiment, the reporter is a fluorescent reporter protein.
[0268] The term "a fluorescent protein" refers to a polypeptide that emits fluorescence and is typically detected by flow cytometry, microscopy, or any fluorescence imaging system, and thus can be used as a basis for selecting multiple cells expressing this protein.
[0269] Multiple examples of multiple fluorescent proteins that can be used as multiple reporters are but not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent proteins (e.g., dsRed, mCherry, RFP). A non-limiting list of fluorescent or other reporters includes multiple proteins detected by luminescence (e.g., luciferase) or colorimetric assay (e.g., GUS). According to a specific embodiment, the fluorescent reporter is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.
[0270] A review of multiple new classes and multiple applications of multiple fluorescent proteins can be found in Trends in Biochemical Sciences (Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y., "The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins", Trends in Biochemical Sciences, doi: 10.1016 / j.tibs.2016.09.010).
[0271] According to another embodiment, the reporter is an endogenous gene of a plant. An exemplary reporter is the phytoene desaturase gene (PDS3), which encodes one of several important enzymes in the carotenoid biosynthesis pathway, and whose silencing results in an albino / bleached phenotype. Thus, plants with reduced PDS3 expression exhibit reduced chlorophyll levels, up to complete albinism and dwarfism. Other genes that can be used according to this teaching include, but are not limited to, genes involved in crop protection. Exemplary genes are described in Table 1B below.
[0272] According to another embodiment, the reporter is an antibiotic selection marker. Examples of antibiotic selection markers that can be used as reporters are, but are not limited to, neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Other marker genes that can be used according to this teaching include, but are not limited to, gentamycin acetyltransferase (accC3) resistance and bleomycin and phleomycin resistance genes.
[0273] It should be understood that the enzyme NPTII inactivates many aminoglycoside antibiotics by phosphorylation, e.g., kanamycin, neomycin, geneticin (or G418), and paromomycin. Among them, kanamycin, neomycin, and paromomycin are used in a variety of plant species.
[0274] According to another embodiment, the reporter is a toxicity selection marker. An exemplary toxicity selection marker that can be used as a reporter is, but is not limited to, allyl alcohol selection using the alcohol dehydrogenase (ADH1) gene. ADH1 includes a group of dehydrogenases that catalyze the interconversion between alcohols and aldehydes or ketones and the simultaneous reduction of NAD+ or NADP+, breaking down alcoholic toxic substances in multiple tissues. Plants with reduced ADH1 expression exhibit increased tolerance to allyl alcohol. Thus, plants with reduced ADH1 are resistant to the toxic effects of allyl alcohol.
[0275] Regardless of the DNA editing agent used, the method of the present invention is employed such that the gene encoding the non-coding RNA molecule (e.g., RNA silencing molecule) is modified by at least one of a deletion, an insertion, or a point mutation.
[0276] According to one embodiment, the modification is in a structured region of the non-coding RNA molecule or the RNA silencing molecule.
[0277] According to one embodiment, the modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.
[0278] According to one embodiment, the modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.
[0279] According to one embodiment, the modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.
[0280] According to one embodiment, the modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
[0281] According to one embodiment, the modification is in a stem region, a loop region, and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
[0282] According to a specific embodiment, the modification comprises a modification of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native non-coding RNA molecule, e.g., RNA silencing molecule).
[0283] According to one embodiment, the modification comprises a modification of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to the native non-coding RNA molecule, e.g., RNA silencing molecule).
[0284] According to one embodiment, the modification can be a continuous nucleic acid sequence (e.g., at least 5, 10, 20, 30, 40, 50, 100, 150, 200 bases).
[0285] According to one embodiment, the modification can be in a discontinuous manner, e.g., throughout a nucleic acid sequence of 20, 50, 100, 150, 200, 500, 1000.
[0286] According to a specific embodiment, the modification comprises a modification of at most 200 nucleotides.
[0287] According to a specific embodiment, the modification comprises a modification of at most 150 nucleotides.
[0288] According to a specific embodiment, the modification comprises a modification of at most 100 nucleotides.
[0289] According to a specific embodiment, the modification comprises a modification of at most 50 nucleotides.
[0290] According to a specific embodiment, the modification comprises a modification of at most 25 nucleotides.
[0291] According to a specific embodiment, the modification comprises a modification of at most 20 nucleotides.
[0292] According to a specific embodiment, the modification comprises a modification of at most 15 nucleotides.
[0293] According to a specific embodiment, the modification comprises a modification of at most 10 nucleotides.
[0294] According to a specific embodiment, the modification comprises a modification of at most 5 nucleotides.
[0295] According to one embodiment, the modification depends on the structure of the RNA silencing molecule.
[0296] Thus, when the RNA silencing molecule contains a non-essential structure (i.e., a secondary structure of the RNA silencing molecule does not play a role in its proper biogenesis and / or function), or is pure dsRNA (i.e., the RNA silencing molecule has a complete or almost complete dsRNA), some modifications (e.g., 20 to 30 nucleotides, e.g., 1 to 10 nucleotides, e.g., 5 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.
[0297] According to another embodiment, when the RNA silencing molecule has an essential structure (i.e., the proper biogenesis and / or activity of the RNA silencing molecule depends on its secondary structure), a plurality of larger modifications are introduced (e.g., 10 to 200 nucleotides, e.g., 50 to 150 nucleotides, e.g., more than 30 nucleotides and not more than 200 nucleotides, 30 to 200 nucleotides, 35 to 200 nucleotides, 35 to 150 nucleotides, 35 to 100 nucleotides) to redirect the silencing specificity of the RNA silencing molecule.
[0298] According to one embodiment, the modification causes the recognition / cutting site / PAM motif of the RNA silencing molecule to be modified to eliminate the original PAM recognition site.
[0299] According to a specific embodiment, the modification is in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acids in a PAM motif.
[0300] According to one embodiment, the modification includes an insertion.
[0301] According to a specific embodiment, the insertion includes an insertion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0302] According to one embodiment, the insertion includes an insertion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0303] According to a specific embodiment, the insertion includes an insertion of at most 200 nucleotides.
[0304] According to a specific embodiment, the insertion includes an insertion of at most 150 nucleotides.
[0305] According to a specific embodiment, the insertion includes an insertion of at most 100 nucleotides.
[0306] According to a specific embodiment, the insertion comprises an insertion of at most 50 nucleotides.
[0307] According to a specific embodiment, the insertion comprises an insertion of at most 25 nucleotides.
[0308] According to a specific embodiment, the insertion comprises an insertion of at most 20 nucleotides.
[0309] According to a specific embodiment, the insertion comprises an insertion of at most 15 nucleotides.
[0310] According to a specific embodiment, the insertion comprises an insertion of at most 10 nucleotides.
[0311] According to a specific embodiment, the insertion comprises an insertion of at most 5 nucleotides.
[0312] According to one embodiment, the modification comprises a deletion.
[0313] According to a specific embodiment, the deletion comprises a deletion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0314] According to one embodiment, the deletion comprises a deletion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0315] According to a specific embodiment, the deletion comprises a deletion of at most 200 nucleotides.
[0316] According to a specific embodiment, the deletion comprises a deletion of at most 150 nucleotides.
[0317] According to a specific embodiment, the deletion comprises a deletion of at most 100 nucleotides.
[0318] According to a specific embodiment, the deletion comprises a deletion of at most 50 nucleotides.
[0319] According to a specific embodiment, the deletion comprises a deletion of at most 25 nucleotides.
[0320] According to a specific embodiment, the deletion comprises a deletion of at most 20 nucleotides.
[0321] According to a specific embodiment, the deletion comprises a deletion of at most 15 nucleotides.
[0322] According to a specific embodiment, the deletion comprises a deletion of at most 10 nucleotides.
[0323] According to a specific embodiment, the deletion comprises a deletion of at most 5 nucleotides.
[0324] According to one embodiment, the modification comprises a point mutation.
[0325] According to a specific embodiment, the point mutation comprises a point mutation of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0326] According to one embodiment, the point mutation comprises a point mutation of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (compared to a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0327] According to a specific embodiment, the point mutation comprises a point mutation of at most 200 nucleotides.
[0328] According to a specific embodiment, the point mutation comprises a point mutation of at most 150 nucleotides.
[0329] According to a specific embodiment, the point mutation comprises a point mutation of at most 100 nucleotides.
[0330] According to a specific embodiment, the point mutation comprises a point mutation of at most 50 nucleotides.
[0331] According to a specific embodiment, the point mutation includes a point mutation of at most 25 nucleotides.
[0332] According to a specific embodiment, the point mutation includes a point mutation of at most 20 nucleotides.
[0333] According to a specific embodiment, the point mutation includes a point mutation of at most 15 nucleotides.
[0334] According to a specific embodiment, the point mutation includes a point mutation of at most 10 nucleotides.
[0335] According to a specific embodiment, the point mutation includes a point mutation of at most 5 nucleotides.
[0336] According to one embodiment, the modification includes a combination of any one of a deletion, an insertion, and / or a point mutation.
[0337] According to one embodiment, the modification includes nucleotide replacement (e.g., nucleotide swapping).
[0338] According to a specific embodiment, the swapping includes swapping about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared with a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0339] According to one embodiment, the nucleotide swapping includes nucleotide replacement of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared with a native non-coding RNA molecule, e.g., an RNA silencing molecule).
[0340] According to a specific embodiment, the nucleotide swapping includes nucleotide replacement of at most 200 nucleotides.
[0341] According to a specific embodiment, the nucleotide swapping includes nucleotide replacement of at most 150 nucleotides.
[0342] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 100 nucleotides.
[0343] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 50 nucleotides.
[0344] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 25 nucleotides.
[0345] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 20 nucleotides.
[0346] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 15 nucleotides.
[0347] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 10 nucleotides.
[0348] According to a specific embodiment, the nucleotide exchange includes nucleotide substitutions of up to 5 nucleotides.
[0349] According to one embodiment, the gene encoding the non-coding RNA molecule (e.g., an RNA silencing molecule) is modified by exchanging a sequence of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA).
[0350] According to a specific embodiment, the sequence of an siRNA for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) includes a nucleic acid sequence selected from the group consisting of SEQ ID NO: 5 to 12 or SEQ ID NO: 103 to 234.
[0351] According to one embodiment, the guide strand of the non-coding RNA molecule (e.g., an RNA silencing molecule, e.g., multiple miRNA precursors (pri / pre-miRNA) or multiple siRNA precursors (dsRNA)) is modified to retain the originality of the structure and maintain the same base pairing profile.
[0352] According to one embodiment, the passenger strand of the non-coding RNA molecule (e.g., an RNA silencing molecule, e.g., multiple miRNA precursors (pri / pre-miRNA) or multiple siRNA precursors (dsRNA)) is modified to retain the originality of the structure and maintain the same base pairing profile.
[0353] As used herein, the term "structural originality" refers to the secondary RNA structure (i.e., the base pairing profile). Maintaining the structural originality is very important for the correct and efficient biogenesis / processing of the non-coding RNA (e.g., RNA silencing molecules, e.g., siRNA or miRNA), which is structure-dependent rather than simply sequence-dependent.
[0354] According to one embodiment, the non-coding RNA (e.g., RNA silencing molecule) is modified in the guide strand (silencing strand) to have about 50 to 100% complementarity with the target RNA (as described above), while the passenger strand is modified to retain the original (unmodified) non-coding RNA structure.
[0355] According to one embodiment, the non-coding RNA (e.g., RNA silencing molecule) is modified such that the seed sequence (e.g., nucleotides 2 to 8 of the miRNA from the 5' end) is complementary to the target sequence.
[0356] According to a specific embodiment, the RNA silencing molecule (i.e., RNAi molecule) is designed such that a sequence of the RNAi molecule is modified to retain the structural originality and is recognized by cellular RNAi processing and multiple executing factors.
[0357] According to a specific embodiment, the non-coding RNA molecule (i.e., rRNA, tRNA, lncRNA, snoRNA, etc.) is designed such that a sequence of the RNAi molecule is modified to be recognized by cellular RNAi processing and multiple executing factors.
[0358] The DNA editing agent of the present invention can be introduced into multiple plant cells using multiple DNA delivery methods (e.g., via multiple expression vectors) or using multiple DNA-free methods.
[0359] According to one embodiment, the gRNA (or any other DNA recognition module used, depending on the DNA editing system used) can be provided to the cell as RNA.
[0360] Therefore, it should be understood that the present technology relates to introducing the DNA editing agent using multiple transient DNA or DNA-free methods, e.g., RNA transfection (e.g., mRNA + gRNA transfection) or ribonucleoprotein (RNP) transfection (e.g., protein-RNA complex transfection, e.g., Cas9 / gRNA ribonucleoprotein (RNP) complex transfection).
[0361] For example, Cas9 can be introduced as a DNA expression plasmid, an in vitro transcript (i.e., RNA), or as a recombinant protein bound to the RNA moiety in a ribonucleoprotein particle (RNP). The gRNA can be delivered, for example, as a DNA plasmid or an in vitro transcript (i.e., RNA).
[0362] According to the present teachings, any method known in the art for RNA or RNP transfection can be used, such as but not limited to, microinjection (e.g., as described by Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins", Genetics, 2013, 195: 1177-1180, incorporated herein by reference), electroporation (e.g., as described by Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins", Genome Res., 2014, 24: 1012-1019, incorporated herein by reference), or lipid-mediated transfection, e.g., using liposome (e.g., as described by Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", Nat Biotechnol., 2014, doi:10.1038 / nbt.3081, incorporated herein by reference). Multiple other methods of RNA transfection are described in U.S. Patent Application No. 20160289675, the entire content of which is incorporated herein by reference.
[0363] One advantage of the multiple RNA transfection methods of the present invention is that RNA transfection is inherently transient and vector-free. An RNA transgene can be delivered as a minimal expression cassette to a cell and expressed therein without the need for any other sequences (e.g., viral sequences).
[0364] According to one embodiment, the DNA editing agent of the present invention is introduced into the plant cell using multiple expression vectors.
[0365] The "expression vectors" (also referred to herein as "a nucleic acid construct", "vector" or "construct") of some embodiments of the present invention include multiple additional sequences (e.g., shuttle vector) that provide this vector suitable for replication in prokaryotes, eukaryotes or preferably both.
[0366] The constructs useful in the multiple methods according to some embodiments of the present invention can be constructed using recombinant DNA techniques well known to those skilled in the art. The multiple nucleic acid sequences can be inserted into multiple vectors, which can be commercially available, suitable for transformation into multiple plants and suitable for transient expression of the gene of interest in the multiple transformed cells. The genetic construct can be an expression vector, wherein the nucleic acid sequence is operably linked to one or more regulatory sequences, thereby allowing expression in the multiple plant cells.
[0367] According to one embodiment, in order to express a functional DNA editing agent, in the case where the cleaving module (nuclease) is not a part of the DNA recognition unit, the expression vector can be used to encode the cleaving module as well as the DNA recognition unit (e.g., gRNA in the case of CRISPR / Cas).
[0368] Alternatively, the cleaving module (nuclease) and the DNA recognition unit (e.g., gRNA) can be cloned into multiple separate expression vectors. In this case, at least two different expression vectors must be transformed into the same plant cell.
[0369] Alternatively, when no nuclease is used (i.e., not applied to the cell from an exogenous source), a single expression vector can be used to clone and express the DNA recognition unit (e.g., gRNA).
[0370] Multiple typical expression vectors can also contain a transcription and translation initiation sequence, transcription and translation terminators, and optionally a polyadenylation signal.
[0371] According to one embodiment, the DNA editing agent includes a nucleic acid agent encoding at least one DNA recognition unit (e.g., gRNA), the DNA recognition unit being operatively linked to a cis-acting regulatory element (e.g., a promoter) that is active in a plurality of plant cells.
[0372] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from the same expression vector. Such a vector may include a single cis-acting regulatory element (e.g., a promoter) that is active in a plurality of plant cells for the expression of both the nuclease and the DNA recognition unit. Alternatively, the nuclease and the DNA recognition unit may each be operably linked to a cis-acting regulatory element (e.g., a promoter) that is active in a plurality of plant cells.
[0373] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., gRNA) are encoded from different expression vectors, wherein each expression vector is operably linked to a cis-acting regulatory element (e.g., a promoter) that is active in a plurality of plant cells.
[0374] As used herein, the phrase "plant-expressible" or "active in a plurality of plant cells" refers to a promoter sequence, including any other regulatory elements added to or contained therein, that is at least capable of inducing, conferring, activating, or enhancing expression in a plant cell, tissue, or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue, or organ.
[0375] The plant promoter used may be a constitutive promoter, a tissue-specific promoter, an inducible promoter, a chimeric promoter, or a developmentally regulated promoter.
[0376] Examples of a number of preferred promoters useful for the various methods of some embodiments of the present invention are shown in Tables I, II, III, and IV.
[0377] Table I: Exemplary constitutive promoters for practicing some embodiments of the present invention
[0378]
[0379] Table II: Exemplary seed-preferred promoters for practicing some embodiments of the present invention
[0380]
[0381]
[0382] Table III: Multiple exemplary flower-specific promoters for practicing the present invention
[0383]
[0384] Table IV: Multiple alternative rice promoters for practicing the present invention
[0385]
[0386]
[0387]
[0388] The inducible promoter is a promoter that is induced in a specific plant tissue, by a developmental stage, or by a specific stimulus (e.g., multiple stress conditions, including, for example, light, temperature, chemicals, drought, high salt, osmotic shock, oxidative conditions, or in the case of pathogenicity), and includes but is not limited to the light-inducible promoter from the pea rbcS gene, the promoter from the alfalfa rbcS gene, multiple promoters DRE, MYC, and MYB that are active in drought; multiple promoters INT, INPS, prxEa, Ha hsp17.7G4, and RD21 that are active in high salt and osmotic stress, and multiple promoters hsr203J and str246C that are active under pathogen stress.
[0389] According to one embodiment, the promoter is a pathogen-inducible promoter. These promoters direct the expression of multiple genes in multiple plants after infection with a pathogen (e.g., bacteria, fungi, viruses, nematodes, and insects). Such promoters include promoters from pathogenesis-related proteins (PR proteins), which are induced after being infected with a pathogen; for example, multiple PR proteins, multiple SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al., 1983, Neth. J. Plant Pathol., 89: 245 to 254; Uknes et al., 1992, Plant Cell, 4: 645 to 656; and Van Loon, 1985, Plant Mol. Virol., 4: 111 to 116.
[0390] According to one embodiment, when more than one promoter is used in the expression vector, the multiple promoters are the same (e.g., all the same, at least two the same).
[0391] According to one embodiment, when more than one promoter is used in the expression vector, the multiple promoters are different (e.g., at least two different, all different).
[0392] According to one embodiment, the promoter in the expression vector includes but is not limited to CaMV 35S, 2xCaMV 35S, CaMV 19S, ubiquitin, AtU626 or TaU6.
[0393] According to a specific embodiment, the promoter in the expression vector includes a 35S promoter.
[0394] According to a specific embodiment, the promoter in the expression vector includes a U6 promoter.
[0395] The multiple expression vectors may further include multiple transcription and translation initiation sequences, multiple transcription and translation termination sequences, and optionally a polyadenylation signal.
[0396] According to a specific embodiment, the expression vector includes a termination sequence, such as but not limited to, a G7 termination sequence, an AtuNos termination sequence or a CaMV-35S termination sequence.
[0397] Multiple plant cells can be stably or transiently transformed with the multiple nucleic acid constructs of some embodiments of the present invention. In stable transformation, the nucleic acid molecule of some embodiments of the present invention integrates into the plant genome, so it represents a stable and heritable trait. In transient transformation, the nucleic acid molecule is expressed by the transformed cells but not integrated into the genome, so it represents a transient trait.
[0398] There are many methods for introducing multiple foreign genes into monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant Physiol., Plant Mol. Biol., 1991, 42: 205 to 225; Shimamoto et al., Nature, 1989, 338: 274 to 276).
[0399] The main methods for stably integrating exogenous DNA into plant genomic DNA include two main methods:
[0400] (i) Agrobacterium-mediated gene transfer: Klee et al., 1987, Annu. Rev. Plant Physiol., 38: 467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, Schell, J. and Vasil, L.K., eds., Academic Publishers, San Diego, CA, 1989, pp. 2-25; Gatenby in Plant Biotechnology, Kung, S. and Arntzen, C.J., eds., Butterworth Publishers, Boston, MA, 1989, pp. 93-112.
[0401] (ii) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, edited by Schell, J. and Vasil, L. K., Academic Publishers, San Diego, California, 1989, pp. 52-68; contains methods for directly taking up DNA into protoplasts, Toriyama, K. et al., 1988, Bio / Technology, 6: 1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al., Plant Cell Rep., 1988, 7: 379-384. Fromm et al., Nature, 1986, 319: 791-793.DNA can be introduced into plant cells or tissues by particle bombardment (Klein et al., Bio / Technology, 1988, 6:559-563; McCabe et al., Bio / Technology, 1988, 6:923-926; Sanford, Physiol. Plant, 1990, 79:206-209), by using a micropipette system (Neuhaus et al., Theor. Appl. Genet., 1987, 75:30-36; Neuhaus and Spangenberg, Physiol. Plant., 1990, 79:213-217; U.S. Patent No. 5,464,765: glassfibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue), or by direct incubation of DNA with germinating pollen (DeWet et al. in Experimental Manipulation of Ovule Tissue, Chapman, G.P., Mantell, S.H. and Daniels, W., eds., Longman, London, 1985, pp. 197-209; and Ohta, Proc. Natl. Acad. Sci., U.S.A., 1986, 83:715-719).
[0402] The Agrobacterium system involves the use of multiple plasmid vectors that contain multiple defined DNA fragments integrated into the plant genomic DNA. The multiple inoculation methods for the plant tissue vary according to the multiple plant species and the Agrobacterium delivery system. One widely used method is the leaf disc method, which can be performed with any tissue explant and provides a good source for initiating the differentiation of the whole plant (Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht, 1988, pp. 1-9). An auxiliary method is to use the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is particularly effective in creating transgenic dicotyledonous plants.
[0403] According to one embodiment, an Agrobacterium-free expression method is used to introduce multiple foreign genes into multiple plant cells. According to one embodiment, the Agrobacterium-free expression method is transient. According to a specific embodiment, a bombardment method is used to introduce multiple foreign genes into multiple plant cells. According to another specific embodiment, bombardment of a plant root is used to introduce multiple foreign genes into multiple plant cells. An exemplary bombardment method that can be used according to some embodiments of the present invention is discussed in the following Examples section.
[0404] In addition, according to the teachings of some embodiments of the present invention, various cloning kits or gene synthesis can be used.
[0405] According to one embodiment, the nucleic acid construct is a binary vector. Multiple examples of binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol., 25, 989, 1994, and Hellens et al., Trends in Plant Science, 5, 446, 2000).
[0406] Multiple examples of other vectors used in other DNA delivery methods (e.g., transfection, electroporation, biolistic, viral inoculation as described below) are: pGE-sgRNA (Zhang et al., Nat. Comms., 2016, 7:12697), pJIT163-Ubi-Cas9 (Wang et al., Nat. Biotechnol., 2004, 32, 947 to 951), pICH47742:2x35S-5’UTR-hCas9(STOP)-NOST (Belhan et al., Plant Methods, 2013, 11; 9(1):39), pAHC25 (Christensen, A.H. and P.H. Quail, 1996, Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants, Transgenic Research, 5:213 to 218), pHBT-sGFP(S65T)-NOS (Sheen et al., Protein phosphatase activity is required for light-induced gene expression in maize, EMBO J., 12(9), 3497 to 3505, 1993).
[0407] According to one embodiment, the method of some embodiments of the present invention further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0408] According to one embodiment, when the modification is an insertion, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0409] According to one embodiment, when the modification is a deletion, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0410] According to one embodiment, when the modification is a deletion and an insertion (e.g., a swap), the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0411] According to one embodiment, when the modification is a point mutation, the method further comprises introducing a plurality of donor oligonucleotides into the plant cell.
[0412] As used herein, the term "multiple donor oligonucleotides" or "multiple donor oligos" refers to multiple exogenous nucleotides that are introduced from the outside into the plant cell to create a precise change in the genome. According to one embodiment, the multiple donor oligonucleotides are synthetic.
[0413] According to one embodiment, the multiple donor oligonucleotides are multiple RNA oligonucleotides.
[0414] According to one embodiment, the multiple donor oligonucleotides are multiple DNA oligonucleotides.
[0415] According to one embodiment, the multiple donor oligonucleotides are multiple synthetic oligonucleotides.
[0416] According to one embodiment, the multiple donor oligonucleotides include multiple single-stranded donor oligonucleotides (ssODN).
[0417] According to one embodiment, the multiple donor oligonucleotides include multiple double-stranded donor oligonucleotides (dsODN).
[0418] According to one embodiment, the multiple donor oligonucleotides include multiple double-stranded DNAs (dsDNA).
[0419] According to one embodiment, the multiple donor oligonucleotides include multiple double-stranded DNA-RNA duplexes (DNA-RNA duplexes).
[0420] According to one embodiment, the multiple donor oligonucleotides include multiple double-stranded DNA-RNA hybrids.
[0421] According to one embodiment, the multiple donor oligonucleotides include multiple single-stranded DNA-RNA hybrids.
[0422] According to one embodiment, the multiple donor oligonucleotides include multiple single-stranded DNAs (ssDNA).
[0423] According to one embodiment, the multiple donor oligonucleotides include multiple double-stranded RNAs (dsRNA).
[0424] According to one embodiment, the multiple donor oligonucleotides include multiple single-stranded RNAs (ssRNA).
[0425] According to one embodiment, the multiple donor oligonucleotides include the DNA or RNA sequences for exchange (as described above).
[0426] According to one embodiment, the plurality of donor oligonucleotides are provided in a non-expression vector form or as oligonucleotides.
[0427] According to one embodiment, the plurality of donor oligonucleotides include a DNA donor plasmid (e.g., circular or linear plasmid).
[0428] According to one embodiment, the plurality of donor oligonucleotides include from about 50 to 5000, from about 100 to 5000, from about 250 to 5000, from about 500 to 5000, from about 750 to 5000, from about 1000 to 5000, from about 1500 to 5000, from about 2000 to 5000, from about 2500 to 5000, from about 3000 to 5000, from about 4000 to 5000, from about 50 to 4000, from about 100 to 4000, from about 250 to 4000, from about 500 to 4000, from about 750 to 4000, from about 1000 to 4000, from about 1500 to 4000, from about 2000 to 4000, from about 2500 to 4000, from about 3000 to 4000, from about 50 to 3000, from about 100 to 3000, from about 250 to 3000, from about 500 to 3000, from about 750 to 3000, from about 1000 to 3000, from about 1500 to 3000, from about 2000 to 3000, from about 50 to 2000, from about 100 to 2000, from about 250 to 2000, from about 500 to 2000, from about 750 to 2000, from about 1000 to 2000, from about 1500 to 2000, from about 50 to 1000, from about 100 to 1000, from about 250 to 1000, from about 500 to 1000, from about 750 to 1000, from about 50 to 750, from about 150 to 750, from about 250 to 750, from about 500 to 750, from about 50 to 500, from about 150 to 500, from about 200 to 500, from about 250 to 500, from about 350 to 500, from about 50 to 250, from about 150 to 250 or from about 200 to 250 nucleotides.
[0429] According to a specific embodiment, the plurality of donor oligonucleotides comprising the ssODN (e.g., ssDNA or ssRNA) include from about 200 to 500 nucleotides.
[0430] According to a specific embodiment, the plurality of donor oligonucleotides comprising the dsODN (e.g., dsDNA or dsRNA) include from about 250 to 5000 nucleotides.
[0431] According to one embodiment, for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA), the expression vector, ssODN (e.g., ssDNA or ssRNA), or dsODN (e.g., dsDNA or dsRNA) does not need to be expressed in a plant cell and can serve as a non-expressing template. According to a specific embodiment, in this case, if provided in the form of DNA, only the DNA editing agent (e.g., multiple Cas9 / sgRNA modules) needs to be expressed.
[0432] According to some embodiments, for gene editing of an endogenous non-coding RNA molecule (e.g., an RNA silencing molecule) without using a nuclease, the DNA editing agent (e.g., gRNA) can be introduced into the eukaryotic cell with or without, for example, an oligonucleotide donor DNA or RNA (as described herein).
[0433] According to one embodiment, multiple donor oligonucleotides are introduced into the plant cell using any of the above methods (e.g., using the expression vector or RNP transfection).
[0434] According to one embodiment, the gRNA and the multiple DNA donor oligonucleotides are co-introduced into the plant cell (e.g., by bombardment). It should be understood that any other factor (e.g., nuclease) can be co-introduced therewith.
[0435] According to one embodiment, the gRNA is introduced into the plant cell before the multiple DNA donor oligonucleotides (e.g., within minutes or hours). It should be understood that any other factor (e.g., nuclease) can be introduced before, simultaneously with, or after the gRNA or the multiple DNA donor oligonucleotides.
[0436] According to one embodiment, the gRNA is introduced into the plant cell after the multiple DNA donor oligonucleotides (e.g., within minutes or hours). It should be understood that any other factor (e.g., nuclease) can be introduced before, simultaneously with, or after the gRNA or the multiple DNA donor oligonucleotides.
[0437] According to one embodiment, a composition is provided that includes at least one gRNA for genome editing and multiple DNA donor oligonucleotides.
[0438] According to one embodiment, a composition is provided that includes at least one gRNA for genome editing, a nuclease (e.g., an endonuclease), and multiple DNA donor oligonucleotides.
[0439] There are a variety of methods for directly transferring DNA into multiple plant cells, and those skilled in the art will know which method to choose. In electroporation, the multiple protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the multiple cells using a very small micropipette. In particle bombardment, the DNA is adsorbed onto multiple particles, such as multiple magnesium sulfate crystals or multiple gold or tungsten particles, and the multiple particles are physically accelerated into multiple protoplasts, multiple cells, or multiple plant tissues.
[0440] Thus, in various embodiments of the present invention, the delivery of multiple nucleic acids can be introduced into a plant cell by any method known to those skilled in the art, such as including but not limited to: by transformation of multiple protoplasts (e.g., see U.S. Patent No. 5,508,184); by desiccation / inhibition-mediated DNA uptake (e.g., see Potrykus et al., 1985, Mol. Gen. Genet., 199: 183 - 8); by electroporation (e.g., see U.S. Patent No. 5,384,253); by agitation with multiple silicon carbide fibers (e.g., see U.S. Patent Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (e.g., see U.S. Patent Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840, and 6,384,301); by accelerating multiple DNA-coated particles (e.g., see U.S. Patent Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865), and methods for delivering DNA, RNA, multiple peptides and / or multiple proteins or multiple combinations of multiple nucleic acids and multiple peptides into multiple plant cells by multiple nanoparticles, multiple nanocarriers, and multiple cell-penetrating peptides (WO201126644A2; WO2009046384A1; WO2008148223A1).
[0441] Other transfection methods include the use of multiple transfection reagents (e.g., Lipofectin, ThermoFisher), multiple dendrimers (Kukowska-Latallo, J.F. et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 4897 - 1902), multiple cell-penetrating peptides ( et al., 2005, Internalisation of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta, 1669(2): 101 to 7) or multiple polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3): 359 to 366).
[0442] According to a specific embodiment, the method of introducing DNA into a plurality of plant cells (e.g., a plurality of protoplasts) includes polyethylene glycol (PEG)-mediated DNA uptake. For more details, see Karesch et al. (1991, Plant Cell Rep., 9: 575 to 578); Mathur et al. (1995, Plant Cell Rep., 14: 221 to 226); Negrutiu et al. (1987, Plant Cell Mol. Biol., 8: 363 to 373). Then the plurality of plant cells (e.g., a plurality of protoplasts) are cultured under conditions that allow them to grow a plurality of cell walls, start dividing to form a callus, develop a plurality of shoots and a plurality of roots, and regenerate an entire plant.
[0443] After stable transformation, plant propagation is carried out. The most common method of plant propagation is through seeds. However, the disadvantage of regeneration through seed propagation is the lack of uniformity in the crop due to heterozygosity, as multiple seeds are produced by multiple plants through multiple genetic variations governed by Mendelian rules. Basically, each seed is genetically different and each has its own specific traits. Therefore, it is preferred to produce transgenic plants such that the regenerated plants have the same traits and characteristics as the parent transgenic plants. Therefore, it is preferred to regenerate the transgenic plants by micropropagation, which provides a rapid and consistent propagation of genetically identical transgenic plants.
[0444] Micropropagation is a process of growing multiple new generation plants from a single piece of tissue excised from a selected parent plant or variety. This process allows for the mass propagation of multiple plants with desired traits. The multiple newly generated plants are genetically identical to the original plant and possess all the characteristics of the original plant. Micropropagation (or cloning) can produce a large amount of high-quality plant material in a short time and provide rapid propagation of multiple selected varieties while retaining the multiple characteristics of the original transgenic or transformed plant. The advantages of multiple cloned plants are the speed of plant propagation and the quality and uniformity of the multiple plants produced.
[0445] Micropropagation is a multi-stage procedure that requires changing the culture medium or growth conditions between multiple stages. Thus, the micropropagation process includes four basic stages: the first stage, initial tissue culture; the second stage, tissue culture propagation; the third stage, differentiation and plant formation; and the fourth stage, greenhouse cultivation and hardening. During the first stage (initial tissue culture), the tissue culture is established and proven to be contamination-free. During the second stage, the initial tissue culture is propagated until a sufficient number of tissue samples are produced to meet the production target. During the third stage, the multiple tissue samples grown in the second stage are separated and grown into multiple individual plants. During the fourth stage, the multiple transformed plants are transferred to a greenhouse for hardening, where the plants' tolerance to light gradually increases, enabling them to grow in a natural environment.
[0446] Although stable transformation is currently preferred, some embodiments of the present invention also contemplate transient transformation of multiple leaf cells, multiple meristematic cells, or the entire plant.
[0447] Transient transformation can be achieved by any of the direct DNA transfer methods described above or by viral infection using multiple modified plant viruses.
[0448] A number of viruses that have been shown to be useful for the transformation of multiple plant hosts include CaMV, TMV, TRV, and BV. The transformation of plants using multiple plant viruses is described in U.S. Patent No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al. (Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189, 1988). Pseudovirus particles for expressing foreign DNA in many hosts including plants are described in WO 87 / 06261.
[0449] The construction of multiple plant RNA viruses for introducing and expressing multiple non-viral exogenous nucleic acid sequences in multiple plants has been demonstrated by the above references and by Dawson, W.O. et al. (Virology, 1989, 172: 285-292); Takamatsu et al. (EMBO J., 1987, 6: 307-311); French et al. (Science, 1986, 231: 1294-1297); and Takamatsu et al. (FEBS Letters, 1990, 269: 73-76).
[0450] When the virus is a DNA virus, the virus itself can be appropriately modified. Alternatively, the virus can first be cloned into a bacterial plasmid to facilitate the construction of the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA and then replicated through the bacterium. Transcription and translation of this DNA will produce the coat protein, which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is usually cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all the constructs. The RNA virus is then produced by transcribing the viral sequence of the plasmid, and the viral genes are translated to produce the (multiple) coat proteins that encapsidate the viral RNA.
[0451] The construction of multiple plant RNA viruses for introducing and expressing multiple non-viral exogenous nucleic acid sequences (e.g., the sequences included in the constructs of some embodiments of the present invention) in multiple plants has been demonstrated by the above references and U.S. Patent No. 5,828,514.
[0452] In one embodiment, a plant viral nucleic acid is provided, in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter (preferably a subgenomic promoter of the non-native viral coat protein coding sequence) have been inserted, which is capable of expressing, packaging the recombinant plant viral nucleic acid in the plant host and ensuring systemic infection of the host by the recombinant plant viral nucleic acid. Alternatively, the coat protein gene can be inactivated by inserting the non-native nucleic acid sequence therein, thereby producing a protein. The recombinant plant viral nucleic acid can contain one or more other non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing multiple adjacent genes or nucleic acid sequences in the plant host and cannot recombine with each other or with multiple native subgenomic promoters. If more than one nucleic acid sequence is included, multiple non-native (exogenous) nucleic acid sequences can be inserted near the native plant viral subgenomic promoter or the native plant viral subgenomic and a non-native plant viral subgenomic promoter. The multiple non-native nucleic acid sequences are transcribed or expressed in the host plant under the control of the subgenomic promoter to produce multiple desired products.
[0453] In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment, except that the native coat protein coding sequence is placed near one of the multiple non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
[0454] In a third embodiment, a recombinant plant viral nucleic acid is provided, in which the native coat protein gene is adjacent to its subgenomic promoter, and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The multiple inserted non-native subgenomic promoters are capable of transcribing or expressing multiple adjacent genes in a plant host and cannot recombine with each other or with multiple native subgenomic promoters. Multiple non-native nucleic acid sequences can be inserted near the multiple non-native subgenomic plant viral promoters such that the multiple sequences are transcribed or expressed in the host plant under the control of the multiple subgenomic promoters to produce multiple desired products.
[0455] In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment, except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
[0456] The multiple viral vectors are encoded by the recombinant plant viral nucleic acid and encapsulated by the multiple coat proteins to produce a recombinant plant virus. The recombinant plant viral nucleic acid or the recombinant plant virus is used to infect a plurality of suitable host plants. The recombinant plant viral nucleic acid is capable of replicating in the host, systemically spreading in the host, and transcribing or expressing (multiple) exogenous genes (isolated nucleic acids) in the host to produce the desired protein.
[0457] In addition to the above, the nucleic acid molecules of some embodiments of the present invention can also be introduced into a chloroplast genome so that the chloroplast can be expressed.
[0458] Techniques for introducing multiple exogenous nucleic acid sequences into the genome of the chloroplast are known. This technique includes the following multiple steps. First, multiple plant cells are chemically treated to reduce the number of chloroplasts in each cell to approximately one. Then, the exogenous nucleic acid is introduced into the multiple cells by particle bombardment with the aim of introducing at least one exogenous nucleic acid molecule into the multiple chloroplasts. The exogenous nucleic acid is selected such that it integrates into the chloroplast genome by homologous recombination, which is susceptible to multiple enzymes inherent in the chloroplast. For this purpose, the exogenous nucleic acid contains, in addition to a gene of interest, at least one nucleic acid stretch derived from the genome of the chloroplast. Additionally, the exogenous nucleic acid contains a selectable marker, which determines by multiple sequential selection steps that all or substantially all copies of the multiple chloroplast genomes will contain the exogenous nucleic acid after such selection. More details related to this technique can be found in U.S. Patent Nos. 4,945,050 and 5,693,507, which are incorporated herein by reference. Thus, a polypeptide can be produced by the protein expression system of the chloroplast and integrated into the inner membrane of the chloroplast.
[0459] Regardless of the transformation / infection method employed, the present teachings further select multiple transformed cells including a genome editing event.
[0460] According to a specific embodiment, the selection is made such that only multiple cells including a successful and accurate modification (e.g., exchange, insertion, deletion, point mutation) at the specific locus are selected. Thus, multiple cells including any event with a modification (e.g., an insertion, deletion, point mutation) at an unintended locus are not selected.
[0461] According to one embodiment, the selection of multiple modified cells can be performed at the phenotypic level by detecting a molecular event, by detecting a fluorescent reporter, or by growing in the presence of a selection agent (e.g., an antibiotic).
[0462] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the biogenesis and occurrence of the newly edited non-coding RNA molecule (e.g., the presence of a new miRNA form, the presence of newly edited siRNA, piRNA, tasiRNA, etc.).
[0463] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., an RNA silencing molecule) against a second target RNA or a target RNA of interest (by verifying at least one phenotype in the plant or organism for encoding the target RNA), such phenotypes being, for example, plant leaf coloring, e.g., partial or complete loss of chlorophyll in leaves and other organs (bleaching), presence / absence of a necrotic pattern, flower color, fruit traits (e.g., shelf life, firmness, and flavor), growth rate, plant size (e.g., dwarfing), crop yield, biotic stress tolerance (e.g., disease resistance, nematode mortality, oviposition rate of beetles, or other resistance phenotypes related to bacteria, viruses, fungi, parasites, insects, weeds, and cultivated or native plants), abiotic stress tolerance (e.g., heat / cold resistance, drought tolerance, salt tolerance, allyl alcohol tolerance, or tolerance to nutrient (e.g., phosphorus (P)) deficiency).
[0464] According to one embodiment, the silencing specificity of the non-coding RNA molecule is genetically determined, e.g., by a gene expression or lack of expression.
[0465] According to one embodiment, the silencing specificity of the non-coding RNA molecule is phenotypically determined.
[0466] According to one embodiment, a phenotype of the plant is determined before a genotype.
[0467] According to one embodiment, a genotype of the plant is determined before a phenotype.
[0468] According to one embodiment, selection of a plurality of modified cells is performed by analyzing the silencing activity and / or specificity of the non-coding RNA molecule (e.g., an RNA silencing molecule) against a second target RNA or a target RNA of interest (by measuring an RNA level of the second target RNA or the target RNA of interest). This can be performed using any method known in the art, e.g., by Northern blotting, nuclease protection assay, in situ hybridization, or quantitative RT-PCR.
[0469] According to one embodiment, the selection of multiple modified cells is performed by analyzing multiple plant cells or multiple clones comprising the DNA editing event, which is also referred to herein as a "mutation" or "edit" depending on the type of edit sought, e.g., insertion, deletion, insertion-deletion (Indel), inversion, substitution, and combinations thereof.
[0470] Methods for detecting sequence alterations are well known in the art and include, but are not limited to, DNA and RNA sequencing (e.g., next generation sequencing), electrophoresis, an enzyme-based mismatch detection assay, and a hybridization assay, e.g., PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blotting, Northern blotting, and dot blot analysis. A variety of methods for detecting single nucleotide polymorphisms (SNPs) can also be used, e.g., PCR-based T7 endonuclease, heteroduplex, and Sanger sequencing, or restriction digest after PCR to detect the presence or absence of unique restriction sites.
[0471] Another method for verifying the presence of a DNA editing event (e.g., an Indel) includes a mismatch cleavage assay that utilizes a structure-selective enzyme (e.g., an endonuclease) that recognizes and cleaves mismatched DNA.
[0472] According to one embodiment, multiple transformed cells are selected by flow cytometry (FACS), which selects multiple transformed cells that exhibit fluorescence (emitted by the fluorescence reporter). After FACS sorting, a population of positively selected multiple transformed plant cells that display the fluorescent label is collected, and an aliquot can be used to test for the DNA editing event as described above.
[0473] In the case of using an antibiotic selection marker, after transformation, multiple plant cell clones are cultured in the presence of the selection (e.g., antibiotic) until they develop into multiple colonies, i.e., multiple clones and multiple micro-calli. As described above, a portion of the cells of the calli are then analyzed (verified) for the DNA editing event.
[0474] Thus, according to one embodiment of the present invention, the method further comprises verifying the complementarity of the endogenous non-coding RNA molecule (e.g., an RNA silencing molecule) to the second target RNA in the plurality of transformed cells.
[0475] As described above, after modifying the gene encoding the non-coding RNA molecule (e.g., an RNA silencing molecule), the non-coding RNA molecule (e.g., an RNA silencing molecule) has at least about 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity to the sequence of the second target RNA or the target RNA of interest.
[0476] The specific binding of the designed non-coding RNA molecule to a target RNA of interest can be determined by any method known in the art, e.g., by computational algorithms (e.g., BLAST), and verified by multiple methods such as including Northern blotting, in situ hybridization, QuantiGene Plex assays, etc.
[0477] It should be understood that for the DNA editing event, the multiple positive clones can be homozygous or heterozygous. In the case of a heterozygous cell, the cell (e.g., when diploid) can include one copy of the modified gene of the non-coding RNA molecule (e.g., an RNA silencing molecule) and one copy of the unmodified gene. Those skilled in the art will select the clones for further culture / regeneration according to the intended use.
[0478] According to one embodiment, when a transient method is desired, in the case of the absence of a DNA editing agent (i.e., loss of multiple DNA sequences encoding the DNA editing agent), multiple clones showing the presence of the desired DNA editing event are further analyzed and selected. For example, this can be done by analyzing the loss of expression of the DNA editing agent (e.g., on the mRNA, protein), e.g., by fluorescence detection of GFP or q-PCR, HPLC.
[0479] According to one embodiment, when a transient method is desired, it can be analyzed whether the plurality of cells lack a nucleic acid construct or a portion thereof as described herein, e.g., a nucleic acid sequence encoding the DNA editing agent. This can be confirmed by fluorescence microscopy, q-PCR, FACS or any other method (e.g., Southern blotting, PCR, sequencing, HPLC).
[0480] According to one embodiment, the plant is hybridized as described below to obtain a plant lacking the DNA editing agent (e.g., endonuclease).
[0481] Multiple positive clones can be preserved (e.g., cryopreserved).
[0482] Alternatively, multiple plant cells (e.g., multiple protoplasts) can first be grown into a group of multiple plant cells that develop into a callus, and then regenerated into multiple whole plants by using multiple plant tissue culture methods to regenerate multiple shoots from the callus (callogenesis). The growth of multiple protoplasts into callus and the regeneration of multiple shoots require an appropriate balance of multiple plant growth regulators in the tissue culture medium, and the medium must be customized for each plant species.
[0483] Using a technique called protoplast fusion, multiple protoplasts can also be used for plant breeding. Multiple protoplasts from different species are induced to fuse by using an electric field or a polyethylene glycol solution. This technique can be used to generate somatic hybrids in tissue culture.
[0484] Methods for protoplast regeneration are well known in the art. Several factors affect protoplast isolation, culture, and regeneration, namely the genotype, the donor tissue and its pretreatment, the enzyme treatment used for protoplast isolation, the protoplast culture method, the culture, the medium, and the physical environment. For a comprehensive review, see Maheshwari et al. (1986, Differentiation of Protoplasts and of Transformed Plant Cells: 3-36, Springer-Verlag, Berlin).
[0485] The multiple regenerated plants can be further bred and selected as deemed appropriate by the person skilled in the art.
[0486] Accordingly, multiple embodiments of the present invention further relate to multiple plants, multiple plant cells, and processed products of multiple plants, which include the non-coding RNA molecules (e.g., RNA silencing molecules) capable of silencing a second target RNA produced according to the present teachings.
[0487] According to one aspect of the present invention, there is provided a method for producing a plant with reduced expression of a target gene, the method comprising: (a) breeding the plant according to some embodiments of the present invention; and (b) selecting a plurality of progeny plants with reduced expression of the target RNA of interest or the second target RNA, or selecting a progeny including a silencing specificity in the non-coding RNA molecule against a target RNA of interest, and the plurality of progeny plants or the progeny do not include the DNA editing agent, thereby producing the plant with reduced expression of a target gene.
[0488] According to one embodiment, breeding includes crossing or selfing.
[0489] As used herein, the term "crossing" refers to the fertilization of multiple female plants (or multiple gametes) by multiple male plants (or multiple gametes). The term "gamete" refers to a haploid reproductive cell (egg or sperm) produced by mitosis in a gametophyte in multiple plants and participating in sexual reproduction, during which two gametes of the opposite sex fuse to form a diploid zygote. The term generally includes referring to a pollen (including the sperm cell) and an ovule (including the egg). Thus, "crossing" generally refers to the fertilization of multiple ovules of an individual by pollen from another individual, while "selfing" refers to the fertilization of multiple ovules of an individual by pollen from the same individual. Crossing is widely used in plant breeding and results in the mixing of genomic information between the two plants, with one chromosome from the mother and one chromosome from the father in the two crossed plants. This will result in a new combination of multiple genetic traits genetically.
[0490] As described above, the plants can be crossed to obtain a plant without multiple unwanted factors, e.g., a DNA editing agent (e.g., an endonuclease).
[0491] According to one embodiment, there is provided a method for producing a plant with enhanced stress tolerance, increased yield, enhanced growth rate or enhanced yield quality, the method comprising: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to the method of some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality, thereby producing the plant.
[0492] As used herein, the phrase "stress tolerance" refers to the ability of a plant to withstand a biotic or abiotic stress without undergoing a substantial change in metabolism, growth, productivity, and / or viability.
[0493] As used herein, the phrase "abiotic stress" refers to a non-living ("abiotic") physical or chemical agent to which a plant, plant cell, etc. is exposed and that has an adverse effect on the metabolism, growth, development, reproduction, or survival (collectively "growth") of the plant. An abiotic stress can be imposed on a plant, for example, due to an environmental factor such as water (e.g., flooding, drought, or dehydration), various anaerobic conditions (e.g., a low level of oxygen or a high level of CO2), various abnormal osmotic conditions (e.g., osmotic stress), salinity, or temperature (e.g., heat / hot, cold, freezing, or frost), exposure to various pollutants (e.g., heavy metal toxicity), anaerobiosis, nutrient deficiency (e.g., nitrogen deficiency or limited nitrogen content), air pollution, or ultraviolet radiation.
[0494] As used herein, the phrase "biotic stress" refers to a living ("biotic") organism to which a plant, plant cell, etc. is exposed and that has an adverse effect on the metabolism, growth, development, reproduction, or survival (collectively "growth") of the plant. Biotic stress can be caused by, for example, bacteria, viruses, fungi, parasites, beneficial and harmful insects, weeds, and cultivated or natural plants.
[0495] As used herein, the phrase "yield" or "plant yield" refers to increased plant growth (growth rate), increased crop growth, increased biomass, and / or increased yield of plant products (including grains, fruits, seeds, etc.).
[0496] According to one embodiment, to generate a plant having enhanced stress tolerance, increased yield, enhanced growth rate, or enhanced yield quality, the non-coding RNA molecule is designed to target an RNA of interest, which is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate, or reduced yield quality.
[0497] According to one embodiment, exemplary susceptible plant genes to be targeted (e.g., knocked out) include, but are not limited to, multiple susceptible S genes, such as those located at a genetic locus called MLO (Mildew Locus O).
[0498] According to one embodiment, the plurality of plants produced by the present method have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% increase in enhanced stress tolerance, increased yield, enhanced yield quality, and enhanced growth rate as compared to a plurality of plants not produced by the present method.
[0499] According to the present invention, any method known in the art for evaluating enhanced stress tolerance can be used. Multiple exemplary methods for evaluating enhanced stress tolerance include, but are not limited to, as described by Yoon, S.K., Bae, E.K., Lee, H., et al., the downregulation of PagSAP1 for increased salt stress tolerance in poplar (Trees, 2018, 32: 823; www.doi(dot)org / 10.1007 / s00468-018-1675-2), and the enhanced drought tolerance by downregulating SlbZIP38 in tomato (Pan Y et al., Genes, 2017, 8, 402; doi: 0.3390 / genes8120402, incorporated herein by reference).
[0500] According to the present invention, any method known in the art for evaluating increased yield can be used. Multiple exemplary methods for evaluating increased yield include, but are not limited to, as described by Ar-Rafi Md. Faisal et al., the reduced expression of DST in rice (AJPS, Vol. 8, No. 9, August 2017, DOI: 10.4236 / ajps.2017.89149); and as described by Wang Y et al., the downregulation of BnFTA in canola resulting in increased yield (MolPlant., January 2009; 2(1): 191-200; doi: 10.1093 / mp / ssn088), both of which are incorporated herein by reference.
[0501] According to the present invention, any method known in the art for evaluating enhanced growth rate can be used. Multiple exemplary methods for evaluating enhanced growth rate include, but are not limited to, as described by Marcelo de Freitas Lima et al., the reduced expression of BIG BROTHER or GA2-oxidase in Arabidopsis resulting in increased growth and biomass (Biotechnology Research and Innovation, 2017, 1, 14-25), incorporated herein by reference.
[0502] According to the present invention, any method known in the art for evaluating the improved yield quality can be used. Multiple exemplary methods for evaluating the improved yield quality include, but are not limited to, as described by Yeh S_Y et al., downregulation of OsCKX2 in rice results in more tillers, more grains, and heavier grains (Rice, New York, 2015; 8:36); and as described by Verma SR and Dwivedi UN, reducing the OMT level in many plants, thereby altering the accumulation of lignin and increasing the digestibility of industrial materials (South African Journal of Botany, Vol. 91, March 2014, pp. 107-125), both of which are incorporated herein by reference.
[0503] According to one embodiment, the method further enables the production of a plant comprising increased sweetness, increased sugar content, increased flavor, improved ripening control, increased water stress tolerance, increased heat stress tolerance, and increased salt tolerance. Those skilled in the art will know how to utilize the methods described herein to select multiple target RNA sequences for modification.
[0504] According to one embodiment, there is provided a method for producing a pathogen-tolerant or pathogen-resistant plant, the method comprising: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to the methods of some embodiments of the present invention, wherein the target RNA of interest is a gene of the plant that is sensitive to the pathogen, thereby producing the pathogen-tolerant or pathogen-resistant plant.
[0505] According to one embodiment, there is provided a method for producing a pathogen-tolerant or pathogen-resistant plant, the method comprising: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to the methods of some embodiments of the present invention, wherein the target RNA of interest is a gene of the pathogen, thereby producing the pathogen-tolerant or pathogen-resistant plant.
[0506] According to one embodiment, there is provided a method for producing a pest-tolerant or pest-resistant plant, the method comprising: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to the methods of some embodiments of the present invention, wherein the target RNA of interest is a gene of the pest, thereby producing the pest-tolerant or pest-resistant plant.
[0507] As used herein, the term "pathogen" refers to an organism that has a negative impact on a plurality of plants by colonizing, damaging, attacking, or infecting the plurality of plants. Thus, a pathogen can affect the growth, development, reproduction, harvest, or yield of a plant. This includes organisms that spread disease and / or damage the host and / or compete for the host's nutrients. A variety of plant pathogens include, but are not limited to, fungi, oomycetes, bacteria, viruses, viroids, virus-like organisms, phytoplasmas, protozoa, nematodes, insects, and parasitic plants.
[0508] Multiple non-limiting examples of pathogens include, but are not limited to, Roundheaded Borer (e.g., long horned borer); psyllid (e.g., red gum lerppsyllid (Glycaspis brimblecombei), blue gum psyllid, spotted gum lerppsyllid, lemon gum lep psyllid); tortoise beetle; snout beetle; leaf beetle; honey fungus; Thaumastocoris peregrinus; sessile gall wasps (Cynipidae) (e.g., Leptocybe invasa, Ophelimus maskelli, and Selitrichodes globules); Foliage-feeding caterpillar (e.g., Omnivorous looper and Orange tortrix); Glassy-winged sharpshooter; and Whitefly (e.g., Giant whitefly). Other non-limiting examples of pathogens include Aphid (e.g., Chaitophorus spp., Cloudywinged cottonwood, and Periphyllus spp.)); Armored scale (e.g., Oystershell scale and San Jose scale); Carpenterworm; Clearwing moth borer (e.g., American hornet moth and Western poplar clearwing); Flatheaded borer (e.g., Bronze birch borer and Bronze poplar borer); Foliage-feeding caterpillar (e.g., Fall webworm, Fruit-tree leafroller, Redhumped caterpillar, Satin moth caterpillar, Spiny elm caterpillar, Tent caterpillar, Tussock moths, and Western tiger swallowtail); Foliage miner (e.g., Poplar shield bearer); Gall and blister mites (e.g., Cottonwood gall mite); Gall aphid (e.g., Poplar petiolegall aphid); Glassy-winged sharpshooter; Leaf beetle and flea beetle; Mealybug; Poplar and willow borer; Roundheaded borer; Sawfly; Soft scale (e.g., Black scale, Brown soft scale, Cottony maple scale, and European fruitlecanium); Treehoppers (e.g., buffalo treehopper); and Truebug (e.g., Lace bug and Lygus bug).
[0509] Other non-limiting examples of viral plant pathogens include, but are not limited to, the species: Pea early-browning virus (PEBV), genus: Tobravirus; the species: Pepper ringspot viurs (PepRSV), genus: Tobravirus; the species: Watermelon mosaic virus (WMV), genus: Potyvirus and other viruses from the genus Potyvirus; the species: Tobacco mosaic virus (TMV), genus: Tobamovirus and other viruses from the genus Tobamovirus; the species: Potato virus X (PVX), genus: Potexvirus and other viruses from the genus Potexvirus. Thus, the present teachings contemplate targeting RNA as well as DNA viruses (e.g., Gemini virus or Bigeminivirus). Viruses of the family Geminiviridae that may be targeted include, but are not limited to, Abutilon mosaic bigeminivirus, Ageratum yellow vein bigeminivirus, Bean calicomosaic bigeminivirus, Bean golden mosaic bigeminivirus, Bhendi yellow vein mosaic bigeminivirus, Cassava African mosaic bigeminivirus, Cassava Indian mosaic bigeminivirus, Chino del tomaté bigeminivirus, Cotton leaf crumple bigeminivirus, Cotton leaf curl bigeminivirus, Croton yellow vein mosaic bigeminivirus, Dolichos yellow mosaic bigeminivirus, Euphorbiamosaicbigeminivirus), Horsegram yellow mosaic bigeminivirus, Jatropha mosaic bigeminivirus, Lima bean golden mosaic bigeminivirus, Melon leaf curlbigeminivirus, Mung bean yellow mosaic bigeminivirus, Okra leaf-curl bigeminivirus, Pepperhausteco bigeminivirus, Pepper Texas bigeminivirus, Potato yellow mosaic bigeminivirus, Rhynchosia mosaic bigeminivirus, Serranogolden mosaic bigeminivirus, Squash leaf curlbigeminivirus, Tobacco leaf curl bigeminivirus, Tomato Australian leafcurl bigeminivirus, Tomato golden mosaic bigeminivirus, Tomato Indianleafcurl bigeminivirus, Tomato leaf crumplebigeminivirus, Tomato mottle bigeminivirus, Tomato yellow leaf curl bigeminivirus, Tomatoyellow mosaic bigeminivirus, Watermelon chloroticstunt bigeminivirus) and Watermelon curly mottle bigeminivirus.
[0510] As used herein, the term "pest" refers to an organism that directly or indirectly harms the plant. A direct action includes, for example, feeding on the leaves of the plant. An indirect action includes, for example, the transmission of a disease agent (e.g., a virus, bacterium, etc.) to the plant. In the latter case, the pest is a vector for pathogen transmission. Exemplary pests include, but are not limited to, beetles, psyllids, insects, nematodes, snails.
[0511] According to one embodiment, the pathogen is a nematode. Exemplary nematodes include, but are not limited to, the burrowing nematode (Radopholus similis), Caenorhabditis elegans, Radopholus arabocoffeae, Pratylenchus coffeae, the root-knot nematode (Meloidogyne spp.), the cyst nematode (Heterodera spp. and Globodera spp.), the root lesion nematode (Pratylenchus spp.), the stem nematode (Ditylenchus dipsaci), the pine wilt nematode (Bursaphelenchus xylophilus), the reniform nematode (Rotylenchulus reniformis), Xiphinema index, Nacobbus aberrans, and Aphelenchoides besseyi.
[0512] According to one embodiment, the pathogen is a fungus. Exemplary fungi include, but are not limited to, Fusarium oxysporum, Leptosphaeria maculans (and Phoma lingam), Sclerotinia sclerotiorum, Pyricularia grisea, Gibberella fujikuroi, Fusarium moniliforme, Magnaporthe oryzae, Botrytis cinerea, Puccinia spp., Fusarium graminearum, Blumeria graminis, Mycosphaerella graminicola, Colletotrichum spp., Ustilago maydis, Melampsora lini, Phakopsora pachyrhizi, and Rhizoctonia solani.
[0513] According to one embodiment, to generate a plant that is resistant or tolerant to a pathogen, the non-coding RNA molecule is designed to target an RNA of interest, which is a plant gene that confers sensitivity to the pathogen.
[0514] According to one embodiment, an exemplary plant gene to be targeted includes, but is not limited to, the gene eIF4E that confers sensitivity to viral infection in cucumbers.
[0515] According to one embodiment, to generate a plant that is resistant or tolerant to a pathogen, the non-coding RNA molecule is designed to target an RNA of interest, which is a gene of the pathogen.
[0516] Any method known in the art (e.g., by conventional bioinformatics analysis) can be used to determine the multiple plant or pathogen target genes.
[0517] According to one embodiment, the nematode pathogen genes include the Radopholus similis gene Calreticulin13 (CRT) or collagen 5 (col-5).
[0518] According to one embodiment, the fungal pathogen genes include the Fusarium oxysporum genes FOW2, FRP1, and OPR.
[0519] According to one embodiment, the pathogen genes include, for example, vacuolar ATPase (vATPase), dvssj1 and dvssj2, α-tubulin, and snf7.
[0520] According to a specific embodiment, when the plant is Brassica napus (rapeseed), the target RNA of interest includes, but is not limited to, a gene of Leptosphaeria maculans (and Phoma lingam) (for example, causing stem canker of spring rapeseed) (for example, as described in GenBank accession number: AM933613.1); a gene of Flea beetle (Phyllotreta vittula or Chrysomelidae) (for example, as described in GenBank accession number: KT959245.1); or a gene of Sclerotinia sclerotiorum (for example, causing sclerotinia stem rot) (for example, as described in GenBank accession number: NW_001820833.1).
[0521] According to a specific embodiment, when the plant is Citrus x sinensis (orange tree), the target RNA of interest includes, but is not limited to, a gene of Citrus Canker (CCK) (for example, as described in GenBank accession number: AE008925); a gene of Candidatus Liberibacter spp. (for example, causing Citrus greening disease) (for example, as described in GenBank accession number: CP001677.5); or a gene of Armillaria root rot (for example, as described in GenBank accession number: KY389267.1).
[0522] According to a specific embodiment, when the plant is an African oil palm (Elaeis guineensis) (Oil palm), the target RNA of interest includes, but is not limited to, a gene of the genus Ganoderma spp. (for example, causing basal stem rot (BSR), also known as Ganoderma butt rot (for example, as described in GenBank accession number: U56128.1)); a gene of the nettle caterpillar; or a gene of any one of the genus Fusarium spp., Phytophthora infestans, Rhizoctonia solani (for example, causing root rot).
[0523] According to a specific embodiment, when the plant is a woodland strawberry (Fragaria vesca) (Wild strawberry), the target RNA of interest includes, but is not limited to, a gene of Verticillium dahlia (for example, causing Verticillium wilt) (for example, as described in GenBank accession number: DS572713.1); a gene of Fusarium oxysporum f.sp. fragariae (for example, causing Fusarium wilt) (for example, as described in GenBank accession number: KR855868.1).
[0524] According to a specific embodiment, when the plant is a Glycine max (Soybean), the target RNA of interest includes, but is not limited to, a gene of P. pachyrhizi (for example, causing soybean rust, also known as Asian rust) (for example, as described in GenBank accession number: DQ026061.1); a gene of the soybean aphid (for example, as described in GenBank accession number: KJ451424.1); a gene of the soybean dwarf virus (SbDV) (for example, as described in GenBank accession number: NC_003056.1); or a gene of the green stink bug (Acrosternum hilare) (for example, as described in GenBank accession number: NW_020110722.1).
[0525] According to a specific embodiment, when the plant is a Gossypium raimondii (cotton), the target RNA of interest includes, but is not limited to, a gene of Fusarium oxysporum f. sp. vasinfectum (e.g., causing Fusarium wilt) (e.g., as described in GenBank accession number: JN416614.1); a gene of Soybean Aphid (e.g., as described in GenBank accession number: KJ451424.1); or a gene of Pink bollworm (Pectinophora gossypiella) (e.g., as described in GenBank accession number: KU550964.1).
[0526] According to a specific embodiment, when the plant is an Oryza sativa (rice), the target RNA of interest includes, but is not limited to, a gene of Pyricularia grisea (e.g., causing Rice Blast) (e.g., as described in GenBank accession number: AF027979.1); a gene of Gibberella fujikuroi (Fusarium moniliforme) (e.g., causing Bakanae Disease) (e.g., as described in GenBank accession number: AY862192.1); or a gene of Stemborer: e.g., Scirpophaga incertulas Walker – Yellow Stem Borer, S. innota Walker – White Stem Borer, Chilo suppressalis Walker – Striped Stem Borer, Sesamia inferens Walker – Pink Stem Borer (e.g., as described in GenBank accession number: KF290773.1).
[0527] According to a specific embodiment, when the plant is a tomato (Solanum lycopersicum), the target RNA of interest includes, but is not limited to, a gene of Phytophthora infestans (e.g., causing late blight) (e.g., as described in GenBank accession number: AY855210.1); a gene of the whitefly Bemisia tabaci (e.g., Bemisia tabaci (Gennadius), e.g., as described in GenBank accession number: KX390870.1); or a gene of Tomato yellow leafcurl geminivirus (TYLCV) (e.g., as described in GenBank accession number LN846610.1).
[0528] According to a specific embodiment, when the plant is a potato (Solanum tuberosum), the target RNA of interest includes, but is not limited to, a gene of Phytophthora infestans (e.g., causing late blight) (e.g., as described in GenBank accession number AY050538.3); a gene of Erwinia spp. (e.g., causing blackleg and soft rot) (e.g., as described in GenBank accession number CP001654.1); or a gene of cyst nematodes (e.g., Globodera Pallida and G. rostochiensis) (e.g., as described in GenBank accession number KF963519.1).
[0529] According to a specific embodiment, when the plant is a cacao tree (Theobroma cacao) (cacao bean (Cacao)), the target RNA of interest includes, but is not limited to, a gene of a basidiomycete (Moniliophthora roreri) (e.g., causing Frosty Pod Rot) (e.g., as described in GenBank accession number LATX01001521.1); a gene of Moniliophthora perniciosa (e.g., a gene causing Witches' Broom disease); or a gene of mirids, such as Distantiella theobroma and Sahlbergella singularis, Helopeltis spp., Monalonion specie.
[0530] According to a specific embodiment, when the plant is a wine grape (Vitis vinifera) (grape (Grape) or grapevine (Grapevine)), the target RNA of interest includes, but is not limited to, a gene of closterovirus GVA (e.g., causing Rugose wood disease) (e.g., as described in GenBank accession number AF007415.2); a gene of Grapevine leafroll virus (e.g., as described in GenBank accession number FJ436234.1); a gene of Grapevine fanleaf degeneration disease virus (GFLV) (e.g., as described in GenBank accession number NC_003203.1); or a gene of Grapevine fleck disease (GFkV) (e.g., as described in GenBank accession number NC_003347.1).
[0531] According to a specific embodiment, when the plant is a maize (Zea mays) (maize, also known as corn), the target RNA of interest includes, but is not limited to, a gene of the fall armyworm (e.g., Spodoptera frugiperda) (e.g., as described in GenBank accession number AJ488181.3); a gene of the European corn borer (e.g., as described in GenBank accession number GU329524.1); or a gene of the northern and western corn rootworms (e.g., as described in GenBank accession number NM_001039403.1).
[0532] According to a specific embodiment, when the plant is a sugarcane, the target RNA of interest includes, but is not limited to, a gene of the internode borer (e.g., Chilo Saccharifagus Indicus), a gene of Xanthomonas albileneans (e.g., causing leaf scald), or a gene of the sugarcane yellow leaf virus (SCYLV).
[0533] According to a specific embodiment, when the plant is a wheat, the target RNA of interest includes, but is not limited to, a gene of Puccinia striiformis (e.g., causing stripe rust), or a gene of an aphid.
[0534] According to a specific embodiment, when the plant is a barley, the target RNA of interest includes, but is not limited to, a gene of Puccinia hordei (e.g., causing leaf rust), a gene of Puccinia striiformis f.sp. hordei (e.g., causing stripe rust), or a gene of an aphid.
[0535] According to a specific embodiment, when the plant is a sunflower, the target RNA of interest includes, but is not limited to, a gene of Puccinia helianthi (e.g., causing Rust disease); a gene of Boerema macdonaldii (e.g., causing Phoma black stem); a gene of Seed weevil (e.g., red and grey), such as Smicronyx fulvus (red), Smicronyx sordidus (grey); or a gene of Sclerotinia sclerotiorum (e.g., causing Sclerotinia stalk and head rot disease).
[0536] According to a specific embodiment, when the plant is a rubber plant, the target RNA of interest includes, but is not limited to, a gene of Microcyclus ulei (e.g., causing South American leaf blight, SALB); a gene of Rigidoporus microporus (e.g., causing White root disease); a gene of Ganoderma pseudoferreum (e.g., causing Red root disease).
[0537] According to a specific embodiment, when the plant is an apple plant, the target RNA of interest includes, but is not limited to, a gene of Neonectria ditissima (e.g., causing Apple Canker); a gene of Podosphaera leucotricha (e.g., causing Apple Powdery Mildew); or a gene of Venturia inaequalis (e.g., causing Apple Scab).
[0538] Provided in Table 1B below are a plurality of exemplary endogenous non-coding RNA molecules that can be modified to target the RNA of interest (e.g., a gene of a pathogen), a plurality of exemplary gRNA sequences (i.e., a DNA editing agent) that can be used to modify the plurality of endogenous non-coding RNA molecules, and a plurality of exemplary nucleotide sequences for redirecting the silencing specificity of the endogenous non-coding RNA molecules to the target RNA of interest.
[0539]
[0540]
[0541]
[0542]
[0543]
[0544]
[0545]
[0546]
[0547]
[0548]
[0549]
[0550]
[0551]
[0552]
[0553]
[0554]
[0555]
[0556]
[0557]
[0558]
[0559]
[0560] According to one embodiment, the plurality of plants produced by the present method have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% increased resistance or tolerance to a plurality of pathogens compared to a plurality of plants not produced by the present method (i.e., compared to a plurality of wild-type plants).
[0561] In accordance with the present invention, any method known in the art for assessing the tolerance or resistance of a plant to a pathogen can be used. A plurality of exemplary methods include, but are not limited to, as described by Ramírez V1, García-Andrade J, Vera P., reducing the expression of MYB46 in Arabidopsis results in enhanced resistance to Botrytis cinerea (Plant Signal Behav., June 2011; 6(6): 911-3, Epub: June 1, 2011); or as described by Gallego-Giraldo L. et al., downregulation of HCT in alfalfa promotes the activation of defense responses in plants (New Phytologist, 2011, 190: 627-639, doi: 10.1111 / j.1469-8137.2010.03621.x), both of which are incorporated herein by reference.
[0562] According to one embodiment, a method for producing a herbicide-resistant plant is provided, the method comprising, for example: according to the method of some embodiments of the present invention, modifying a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule in a plant cell, wherein the target RNA of interest is a gene of the plant that is sensitive to the herbicide, thereby producing the herbicide-resistant plant.
[0563] According to one embodiment, the plurality of pathways targeted by the plurality of herbicides are located within a plurality of plastids (e.g., within the chlorophyll).
[0564] Thus, in order to produce a plurality of herbicide-resistant plants, the non-coding RNA molecule is designed to target an RNA of interest, including but not limited to, the chlorophyll gene psbA (which encodes the photosynthetic quinone-binding membrane protein Q B, the target of the herbicide atrazine and the gene of EPSP synthase (a nuclear protein, however, its overexpression or accumulation in the chlorophyll confers resistance to the herbicide glyphosate to the plant because it increases the transcription rate of EPSPs and reduces the turnover rate of the enzyme).
[0565] According to one embodiment, the plurality of plants produced by this method have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% higher resistance to herbicides compared to the plurality of plants not produced by this method.
[0566] According to one embodiment, a plant produced by the method according to some embodiments of the present invention is provided.
[0567] According to one embodiment, the plant is non-genetically modified (non-GMO).
[0568] According to one embodiment, a seed of the plant produced by the method according to some embodiments of the present invention is provided.
[0569] Designing GEiGS (with minimal nucleotide modification / editing in the endogenous non-coding RNA) can be achieved using bioinformatics (in silico) methods based on bioinformatics tools well-known to those skilled in the art.
[0570] According to one embodiment, the achievement of this method is as follows:
[0571] The following information should be provided: (a) the target sequence ("target") silenced by Gene Editing induced Gene Silencing (GEiGS); (b) whether the selected GEiGS (i.e., the non-coding RNA with modified silencing activity and / or specificity) is ubiquitously expressed (e.g., constitutively expressed) or specifically expressed (e.g., expressed in a specific tissue, developmental stage, stress, heat / cold shock, etc.).
[0572] Submit this information to publicly available or in-house miRNA datasets (e.g., small RNA sequencing, multiple genomic sequences, multiple microarrays, etc.) in order to screen (i.e., select) multiple relevant miRNAs that meet the input criteria: multiple miRNAs expressed according to the above (multiple) requirements, e.g., miRbase (Kozommara and Griffiths-Jones, 2014), tasRNAdb (Zhang Changqing et al., 2013), and mirEx 2.0 (Zielezinski, Andrzej et al., “mirEX 2.0 – an Integrated Environment for Expression Profiling of Plant microRNAs”, BMC Plant Biology, 15, 2015:144, PMC.Web. September 15, 2018).
[0573] Using publicly available tools, a list of effective multiple target-specific siRNA sequences can be generated. The multiple miRNAs can be aligned with the effective multiple siRNA sequences, and the most homologous multiple miRNAs can be selected. The multiple screened miRNAs may have a similar sequence in the same direction as the effective multiple siRNAs.
[0574] Modify the natural mature multiple miRNA sequences to have a high homology with the multiple target-specific effective siRNAs, so as to be completely complementary to the sequence of the target. This modification can occur in one of the mature miRNA strands with the highest target homology (e.g., it can be the original miRNA guide strand or passenger strand). This 100% complementarity with the target can convert the miRNA sequence into an siRNA.
[0575] The minimum GE can be achieved by screening multiple miRNA sequences (naturally highly homologous (reverse complementary) to the target).
[0576] Based on the multiple genomic DNA sequences flanking the modified miRNA precursor sequence (pre-miRNA), use the multiple primary modified miRNA genes to generate multiple ssDNA oligonucleotides (e.g., 200 to 500 nt ssDNA long) and multiple dsDNA fragments (e.g., only 250 to 5000 nt dsDNA fragments or cloned in multiple plasmids). The guide strand (silencing strand) sequence of the modified miRNA can be designed to be 100% complementary to the target.
[0577] Modify the sequence of the other miRNA gene regions to preserve the original (unmodified) miRNA precursor and mature structure by maintaining the same base-pairing conformation.
[0578] Design multiple sgRNAs to specifically target the original unmodified miRNA gene (specific to the genomic miRNA locus), rather than the modified form (i.e., the multiple oligonucleotide / fragment sequences).
[0579] Analyze the comparative restriction enzyme sites between the modified miRNA and the original miRNA gene, and summarize multiple differential restriction sites. This detection system is based on PCR, followed by restriction enzyme digestion and gel electrophoresis.
[0580] Verify as discussed in detail above.
[0581] When the endogenous non-coding RNA (e.g., miRNA) has a natural high homology (e.g., 60 to 90%) with the target, use bioinformatics methods to examine the targeting (e.g., "off target effect") of the non-coding RNA against multiple other targets to obtain specific silencing of the target of interest.
[0582] Minimally modify the endogenous non-coding RNA (e.g., miRNA) to enhance its potency to silence the target of interest.
[0583] Verify the GEiGS results of multiple primary minimally edited miRNA genes to generate multiple candidate refined minimally edited miRNAs. An experimentally valid primary GEiGS result (the multiple primary minimally edited miRNA genes) is considered to be a (multiple) miRNA with a guide strand or passenger strand modified to match the target 100%.
[0584] Generate multiple guide strand or passenger strand sequences that gradually revert back to the original sequence (as Figure 11 shown).
[0585] Maintain the seed sequence such that there are at least 5 matches in the seven seed nucleotides (positions 2 to 8 from the 5'-end nucleotide).
[0586] Test the target silencing efficiency of various candidate "refined minimally edited miRNA genes". Select the gene GE-mediated knock-in that provides the highest silencing with the least miRNA sequence modification.
[0587] Test the potential "off-target effects" of multiple refined minimally edited miRNA candidates. An important prediction of the "off-target effects" affects the final evaluation of the multiple refined minimally edited miRNA genes.
[0588] Based on experimental verification, test multiple less refined minimally edited miRNA gene candidates.
[0589] As used herein, the term "about" means ± 10%.
[0590] The terms "comprises", "comprising", "includes", "including", "having" and their inflected forms mean "including but not limited to".
[0591] The term "consisting of" means "including and limited to".
[0592] The term "consisting essentially of" means that a composition, method or structure may include other ingredients, steps and / or parts, provided that the other ingredients, steps and / or parts do not materially alter the basic and novel features of the claimed composition, method or structure.
[0593] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include multiple compounds, including mixtures thereof.
[0594] Throughout this application, different embodiments of the invention may be presented in range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as the individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered to have specifically disclosed sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as the individual numbers within that range, for example 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.
[0595] Whenever a numerical range is specified herein, it is meant to include any recited numerical value (fractional or integral) within the specified range. The phrases “range between” the first identified number and the second identified number and “ranging from” the first identified number “to” the second identified number are used interchangeably herein, and are meant to include the first and second identified numbers and all fractional and integral values therebetween.
[0596] As used herein, the term “method” refers to a manner, means, technique and procedure for accomplishing a given task, including but not limited to manners, means, techniques and procedures known to or readily developed by practitioners in the chemical, pharmacological, biological, biochemical, and medical arts from known manners, means, techniques and procedures.
[0597] As used herein, the term “treatment” includes eliminating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating the clinical and aesthetic symptoms of a condition or substantially preventing the appearance of the clinical or aesthetic symptoms of a condition.
[0598] It should be understood that certain features of the invention described in the context of each example may also be provided in combination in a single example. Conversely, for the sake of brevity, the various features of the invention described in the context of a single example may also be provided separately or in any suitable sub-combination or applied to any other described example of the invention. Certain features described in the context of different examples are not to be considered essential features of those examples, unless the example is inoperative without that element.
[0599] In the following examples, experimental support is provided for different examples and aspects of the invention described above and claimed in part in the appended claims.
[0600] It should be understood that any sequence identification number (SEQ ID NO) disclosed in this application may refer to a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO is mentioned, even if the SEQ ID NO is expressed only in a DNA sequence format or an RNA sequence format. For example, SEQ ID NOs: 1 to 4 are expressed in a DNA sequence format (e.g., using T for thymine), but it may refer to a DNA sequence corresponding to a gRNA nucleic acid sequence, or to the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, although some sequences are expressed in an RNA sequence format (e.g., using U for uracil), depending on the actual type of the molecule, it may refer to the sequence of an RNA molecule including a dsRNA, or to the sequence of a DNA molecule corresponding to the indicated RNA sequence. In any case, DNA and RNA molecules having the sequences disclosed with any substituents are contemplated
[0601] Examples
[0602] Reference is now made to the following examples, which, together with the foregoing description, illustrate the invention in a non - limiting manner.
[0603] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, "Molecular Cloning: A Laboratory Manual", Sambrook et al., 1989; "Current Protocols in Molecular Biology", Volumes I - III, Ausubel, R.M. ed., 1994; Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland, 1989; Perbal, "A Practical Guide to Molecular Cloning", John Wiley and Sons, New York, 1988; Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds.) "Genome Analysis: A Laboratory Manual Series", Volumes 1 - 4, Cold Spring Harbor Laboratory Press, New York, 1998,; such as U.S. Patent Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659, and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I - III, Cellis, J.E. ed., 1994; "Culture of Animal Cells – A Manual of Basic Technique" Freshney, Wiley - Liss, New York, 1994, Third Edition; "Current Protocols in Immunology", Volumes I - III, Coligan J.E. ed., 1994; Stites et al. (eds.), "Basic and Clinical Immunology" (8th Edition), Appleton and Lange, Norwalk, CT, 1994; Mishell and Shiigi (eds.), "Selected Methods in Cellular Immunology", W.H. Freeman and Co., New York, the method shown in mid - 1980; numerous immunoassays are described in the patent and scientific literature, see, for example, U.S. Patent Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771, and 5,281,521, “Oligonucleotide Synthesis”, Gait, M.J. editor, 1984; “Nucleic Acid Hybridization”, Hames, B.D. and Higgins S.J. editors, 1985; “Transcription and Translation”, Hames, B.D. and Higgins S.J. editors, 1984; “Animal Cell Culture”, Freshney, R.I. editor, 1986; “Immobilized Cells and Enzymes”, IRL Press, 1986; “A Practical Guide to Molecular Cloning”, Perbal, B., 1984, and “Methods in Enzymology”, volumes 1 to 317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, California, 1990; Marshak et al., “Strategies for Protein Purification and Characterization - A Laboratory Course Manual”, CSHL Press, 1996; all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout the document. The procedures therein are considered to be well - known in the art and are provided for the convenience of the reader. All information contained therein is incorporated by reference into this text.
[0604] General Materials and Experimental Procedures
[0605] Arabidopsis Cell Culture
[0606] Arabidopsis thaliana (ecotype Landsberg-erecta) cell cultures were maintained in 100 mL of liquid growth medium (4.4 g / L serum-free medium (Murashige and Skoog, MS) salts, with vitamins (Duchefa, Haarlem, Netherlands), 30 g / L sucrose, 0.5 mg / L 1-naphthaleneacetic acid (NAA), and 0.5 mg / L 6-benzylaminoipurine (BAP)) at 25 °C, with a 16-hour photoperiod, and gentle stirring (100 rpm). Every week, 6 mL of the culture was transferred to fresh medium.
[0607] Plant growth
[0608] Multiple Arabidopsis (ecotype Colombia-0) seedlings were surface-sterilized and grown on plates containing MS medium (supplemented with 0.8 g / L agar) at 20 °C with a 16-hour photoperiod.
[0609] Stable transformation of Arabidopsis cell cultures
[0610] Agrobacterium carrying the pK7WGF2 plasmid was grown in LB medium (supplemented with 100 mg / L spectinomycin) at 28 °C to an OD of 0.8. The bacteria were collected by centrifugation and resuspended in an equal volume of plant cell medium. Four days after transfer to fresh medium, 4 mL of Arabidopsis cells were cultured with 0.1 mL of the Agrobacterium suspension in a covered Petri dish at 20 °C in the dark with gentle stirring (130 rpm). After 48 hours, the cells were collected by centrifugation and washed 5 times with cell medium to remove most of the bacteria. Finally, the cells were resuspended in 2 mL of cell medium and plated onto a covered Petri dish containing cell medium supplemented with 0.4% Phytagel, 500 mg / L timenten, and 50 mg / L kanamycin. The dishes were stored in the dark at 25 °C until callus formation was observed, usually after 2 or 3 weeks.
[0611] Banana embryogenic calli:
[0612] Banana embryogenic calli are developed from an initial explant (e.g., immature male flower or shoot tip) as described by Ma (Ma S.S., Proceedings of Symposium on Tissue culture of horticultural crops, Taipei, Taiwan, China, March 8 - 9, 1988, pp. 181 - 188) and Schoofs (Schoofs H., The origin of embryogenic cells in Musa, Ph.D. thesis, University of Leuven, Belgium, 1997). Embryogenic cell suspensions are induced from newly developed highly embryogenic calli in liquid medium. Eighty percent of the medium is renewed every 12 to 14 days until the induced cell suspension is completely established (6 to 9 months).
[0613] Coffee embryonic calli:
[0614] Coffee embryonic calli are obtained as previously described (Etienne, H., Protocol for somatic embryogenesis in woody plants, Springer, 2005, pp. 167 - 1795). Briefly, multiple young leaves are surface - sterilized, cut into pieces of 1 cm 2 and placed in half - strength semi - solid MS medium (supplemented with 2.26 μM 2,4 - dichlorophenoxyacetic acid (2,4 - D), 4.92 μM indole - 3 - butyric acid (IBA), and 9.84 μM isopentenyladenine (iP)) for 1 month. Then multiple explants are transferred to half - strength semi - solid MS medium (containing 4.52 μM 2,4 - D and 17.76 μM 6 - benzylaminopurin (6 - BAP)) for 6 to 8 months until regenerated embryogenic calli are obtained. The embryogenic calli are maintained on MS medium (supplemented with 5 μM 6 - BAP).
[0615] As previously described (Acuna, J.R. and M. de Pena, Plant Cell Reports, 1991, 10(6): pp. 345 - 348), cell suspension cultures were generated from embryogenic callus. The embryogenic callus (30 g / l) was placed in liquid MS medium (supplemented with 13.32 μM 6 - BAP). The flasks were placed in an orbital shaker (110 rpm) at 28 °C. The cell suspension was subcultured / passaged every 2 - 4 weeks until fully established. The cell suspension cultures were maintained in liquid MS medium containing 4.44 μM 6 - BAP.
[0616] Computational pipeline to generate GEiGS templates
[0617] The computational GEiGS pipeline applied biological metadata and was able to automatically generate multiple GEiGS DNA templates for minimally editing multiple non - coding RNA genes (e.g., multiple miRNA genes) to obtain a new function, namely redirecting their silencing ability to a target sequence of interest.
[0618] As Figure 9 shown, the pipeline starts with filling in and submitting the inputs: (a) silencing the target sequence via GEiGS; (b) gene - editing the host organism and expressing the GEiGS; (c) optionally, whether to express the GEiGS ubiquitously. If specific GEiGS expression is required, it can be selected from several options (expression specific to a particular tissue, developmental stage, stress, heat / cold shock, etc.).
[0619] When all the necessary inputs are submitted, the computational process starts by searching between multiple miRNA datasets (e.g., small RNA sequencing, microarrays, etc.) and only screening multiple relevant miRNAs that meet the input criteria. Next, the selected multiple mature miRNA sequences are aligned with the target sequence, and the miRNAs with the highest complementarity level are screened. Then, these natural target - complementary mature miRNA sequences are modified to be fully complementary to the target sequence. Then, the modified multiple mature miRNA sequences are run through an algorithm that predicts siRNA efficacy, and the top 20 with the highest silencing scores are screened. Then, these final modified miRNA genes are used to generate 200 - 500 nt ssDNA or 250 - 5000 nt dsDNA sequences as follows.
[0620] Design 200 to 500 nt ssDNA oligonucleotides and 250 to 5000 nt dsDNA fragments based on the genomic DNA sequences flanking the modified miRNA. The pre-miRNA sequence is located in the center of the oligonucleotide. The guide (silencing) sequence of the modified miRNA is 100% complementary to the target. However, the sequence of the modified passenger miRNA strand is further modified to retain the original (unmodified) miRNA structure, maintaining the same base pairing profile.
[0621] Next, multiple differential sgRNAs are designed to specifically target the original unmodified miRNA gene, rather than the modified exchange form. Finally, comparative restriction site analysis is performed between the modified miRNA gene and the original miRNA gene, and multiple differential restriction sites are summarized.
[0622] Thus, the pipeline output contains:
[0623] (a) The sequence of a 200 to 500 nt ssDNA oligonucleotide or 250 to 5000 nt dsDNA fragment with a minimally modified miRNA.
[0624] (b) Two to three differential sgRNAs that specifically target the original miRNA gene rather than the modified miRNA gene.
[0625] (c) A list of multiple differential restriction sites between the modified miRNA gene and the original miRNA gene.
[0626] Target gene
[0627] Phytoene desaturase gene (PDS)
[0628] Rationale:
[0629] PDS is an essential gene in the chlorophyll biosynthesis pathway, and the loss of PDS function in plants leads to an albino phenotype (Fan et al., Sci Rep, 2015, 5: 12217). When used as a target gene for genome editing (GE) strategies or RNAi, corrected plants are easily identified by partial or complete loss (bleaching) of chlorophyll in leaves or other organs.
[0630] Method:
[0631] Select multiple miRNAs with a general expression profile (depending on the application, multiple miRNAs with an expression profile specific to a particular tissue, developmental stage, temperature, stress, etc. can be selected).
[0632] Modify the multiple miRNAs into siRNAs targeting the PDS gene from Arabidopsis thaliana (see Table 1A below). After transfection and FACS sorting (RFP / GFP is used to identify positive Cas9 / sgRNA transfection events), transfer multiple primary colonies (or calli) to solid regeneration medium (half-strength MS + B5 vitamins, 20 g / l sucrose, 0.8% agar) until shoot regeneration. The loss of pigmentation in these shoots indicates the loss of function of the PDS gene and correct GE. No albino phenotype was observed in control plants transfected with an oligonucleotide carrying a random sequence.
[0633] Green fluorescent protein (GFP) gene
[0634] Principle
[0635] GFP is a protein composed of 238 amino acid residues (26.9 kDa) that exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. Although many other marine organisms also have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish Aequorea victoria. The GFP from Aequorea victoria has a major excitation peak at 395 nm and a minor excitation peak at 475 nm. Its emission peak is at 509 nm, which is in the lower green part of the visible spectrum. The fluorescence quantum yield (QY) of GFP is 0.79. The GFP from the sea pansy (Renilla reniformis) has a single major excitation peak at 498 nm. GFP is an excellent tool in many biological fields because it can form an internal chromophore without any additional cofactors, gene products, or enzymes / substrates other than molecular oxygen.
[0636] Method:
[0637] Select multiple miRNAs with a general expression profile (depending on the application, multiple miRNAs with an expression profile specific to a particular tissue, developmental stage, temperature, stress, etc. can be selected).
[0638] Multiple miRNAs were modified into siRNAs targeting the GFP gene (see Table 1A below). After transfection, FACS sorting was performed to isolate multiple mCherry-expressing protoplasts with no or low GFP signal (mCherry is used to identify positive Cas9 / sgRNA transfection events). In the control group (oligonucleotides with non-target siRNA sequences), all protoplasts expressed mCherry and GFP. Next, the candidate successful GE protoplasts (mCherry positive and GFP negative) were regenerated into multiple plants for further analysis. Multiple protoplasts were also qualitatively recorded under the microscope. For quantitative analysis and ratio analysis, FACS analysis was used.
[0639] Table 1A: Target gene ID
[0640]
[0641] siRNA design
[0642] Multiple target-specific siRNAs were designed using publicly available siRNA designers, e.g., "BLOCK-iT TM RNAi Designer (BLOCK-iT TM RNAi Designer)" from ThermoFisher Scientific and "Find siRNA sequences" from Invivogen.
[0643] sgRNA design
[0644] As previously described by Park et al. (Bioinformatics, 2015, 31(24): 4014 to 4016), multiple sgRNAs were designed using the publicly available sgRNA designer to target the multiple endogenous miRNA genes. Two sgRNAs were designed for each cassette, but only a single sgRNA was expressed per cell to initiate gene exchange. The sgRNA corresponded to the modified pre-miRNA sequence after exchange.
[0645] To maximize the chance of effectively selecting sgRNAs, two different publicly available algorithms (CRISPER design: www(dot)crispr(dot)mit(dot)edu:8079 / and CHOPCHOP: www(dot)chopchop(dot)cbu(dot)uib(dot)no / ) were used, and the sgRNA with the highest score was selected from each algorithm.
[0646] Exchange ssDNA oligonucleotide design
[0647] A 400b ssDNA oligonucleotide was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence is located in the center of the oligonucleotide. Next, the multiple double-stranded siRNA sequences were exchanged with the multiple mature miRNA sequences so that the guide (silencing) siRNA strand is 100% complementary to the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure, maintaining the same base pairing profile.
[0648] Exchange plasmid DNA design
[0649] A 4000bp dsDNA fragment was designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence is located in the center of the dsDNA fragment. Next, the multiple double-stranded siRNA sequences were exchanged with the multiple mature miRNA sequences so that the guide (silencing) siRNA strand is 100% complementary to the target. The sequence of the passenger siRNA strand was modified to retain the original miRNA structure, maintaining the same base pairing profile. Finally, the fragment was cloned into a standard vector (e.g., pBluescript).
[0650] Long plasmids for exchange:
[0651] Plasmid-1: GEiGS_mir173_si-GFP_1 (SEQ ID NO:31)
[0652] Plasmid-2: GEiGS_mir173_si-GFP_2 (SEQ ID NO:32)
[0653] Plasmid-3: GEiGS_mir173_si-PDS_1 (SEQ ID NO:33)
[0654] Plasmid-4: GEiGS_mir173_si-PDS_2 (SEQ ID NO:34)
[0655] Plasmid-5: GEiGS_mir390a_si-GFP_1 (SEQ ID NO:35)
[0656] Plasmid-6: GEiGS_mir390a_si-GFP_2 (SEQ ID NO:36)
[0657] Plasmid-7: GEiGS_mir390a_si-PDS_1 (SEQ ID NO:37)
[0658] Plasmid - 8: GEiGS_mir390a_si - PDS_2 (SEQ ID NO:38)
[0659] sgRNA sequence:
[0660] Arabidopsis thaliana mir - 390A:
[0661] 1. CTATCCATCCTGAGTTTCATTGG (SEQ ID NO:1);
[0662] 2. AAGAATCTGTAAAGCTCAGGAGG (SEQ ID NO:2);
[0663] Arabidopsis thaliana mir - 173:
[0664] 1. CTTGCAGAGAGAAATCACAGTGG (SEQ ID NO:3);
[0665] 2. GCTTACACAGAGAATCACAGAGG (SEQ ID NO:4);
[0666] List of swapped endogenous miRNAs:
[0667] 1. Arabidopsis thaliana mir - 390A
[0668] 2. Arabidopsis thaliana mir - 173
[0669] ssDNA oligonucleotides for gene swapping:
[0670] Oligonucleotide - 1: GEiGS_mir173_si - GFP_1 (5’→3’) (SEQ ID NO:5)
[0671] Oligonucleotide - 2: GEiGS_mir173_si - GFP_2 (5’→3’) (SEQ ID NO:6)
[0672] Oligonucleotide - 3: GEiGS_mir173_si - PDS_1 (5’→3’) (SEQ ID NO:7)
[0673] Oligonucleotide - 4: GEiGS_mir173_si - PDS_2 (5’→3’) (SEQ ID NO:8)
[0674] Oligonucleotide - 5: GEiGS_mir390a_si - GFP_1 (5’→3’) (SEQ ID NO:9)
[0675] Oligonucleotide-6: GEiGS_mir390a_si-GFP_2 (5’→3’) (SEQ ID NO:10)
[0676] Oligonucleotide-7: GEiGS_mir390a_si-PDS_1 (5’→3’) (SEQ ID NO:11)
[0677] Oligonucleotide-8: GEiGS_mir390a_si-PDS_2 (5’→3’) (SEQ ID NO:12)
[0678] sgRNA Cloning
[0679] The transfection plasmid used consists of 4 modules, including:
[0680] (1) mCherry driven by the CsVMV promoter (terminated by a G7 termination sequence);
[0681] (2) 2x 35S::hCas9-35S-ter, i.e., hCas9 driven by the 35S promoter (terminated by the AtuNos termination sequence)
[0682] (3) The AtU6-26 and / or U6 synthetic promoter driving the sgRNA of Guide 1;
[0683] Plasmid Design
[0684] For transient expression, a plasmid containing 3 transcription units was used. The first transcription unit contains the CsVMV promoter driving the expression of mCherry and the G7 terminator. The next transcription unit consists of the 2x-35S promoter driving the expression of Cas9 and the 35S terminator. The third contains the Arabidopsis U6 promoter expressing the sgRNA to target multiple miRNA genes (each vector includes a single sgRNA).
[0685] Design and clone CRISPR / CAS9 to target miR-173 and miR-390 and introduce SWAP to target GFP, AtPDS3, and AtADH1
[0686] The inventors have designed alterations in the mature miR-173 and miR-390 sequences that, in their genomic context, target GFP, AtPDS3, or AtADH1 by generating small RNAs that are reverse complementary to the multiple target genes, as Figures 12A to 12G and Figures 13A to 13G shown. In addition, to maintain the secondary structure of the miRNA precursor transcript, further alterations were made to the pri-miRNA, as Figures 12A to 12G, 13A to 13G, 14A to 14D, and 15A to 15D, as well as those shown in Table 2 (see below). These fragments were cloned into multiple PUC plasmids and named as DONORs, and the multiple DNA fragments are called SWAP. For the sequences modifying miR-173 - SWAP1 and SWAP2 target GFP, SWAP3 and SWAP4 target AtPDS3, and SWAP9 and SWAP10 target AtADH1 (see Table 2 below). For the sequences modifying miR-390 - SWAP5 and SWAP6 target GFP, SWAP7 and SWAP8 target AtPDS3, and SWAP11 and SWAP12 target AtADH1 (see Table 2 below).
[0687] Multiple guide RNAs targeting miR-173 and miR-390 were introduced into the CRISPR / CAS9 vector system to generate a DNA cleavage at the desired miRNA locus. They were co-introduced into the multiple plants together with the multiple DONOR vectors by a gene bombardment protocol to introduce the desired multiple modifications through Homologous DNA Repair (HDR). These guide RNAs are detailed in Table 2 below and are shown in Figure 12A and 13A as shown.
[0688] Table 2: Sequences and oligonucleotides used in the experiment
[0689]
[0690]
[0691]
[0692]
[0693]
[0694] Protoplast isolation
[0695] Protoplasts were isolated by culturing plant materials (e.g., leaves, callus, cell suspension) in a digestion solution (1% cellulase, 0.5% macerozyme, 0.5% driselase, 0.4 M mannitol, 154 mM NaCl, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaCl2) (gently shaken at room temperature for 4 to 24 hours). After digestion, the remaining plant materials were washed with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES pH 5.6), and the protoplast suspension was filtered through a 40-μm filter. After centrifugation at 80 g for 3 minutes at room temperature, the protoplasts were resuspended in 2 ml of W5 buffer and sedimented by gravity on ice. The final protoplast pellet was resuspended in 2 ml of MMg (0.4 M mannitol, 15 mM MgCl2, 4 mM MES pH 5.6), and the protoplast concentration was determined using a hemocytometer. Protoplast viability was estimated using trypan blue staining.
[0696] Polyethylene glycol (PEG)-mediated plasmid transfection
[0697] PEG transfection of protoplasts was achieved using a modified form of the strategy reported by Wang (Wang et al., Scientia Horticulturae, 2015, 191: pp. 82 - 89). The protoplasts were resuspended in MMg solution (at a density of 2×10 6 to 5×10 6 protoplasts / ml). 100 to 200 μl of the protoplast suspension was added to a test tube containing the plasmid. The plasmid:protoplast ratio has a great impact on the transformation efficiency, so the range of plasmid concentration in the protoplast suspension (5 to 300 μg / μl) was determined. PEG solution (100 to 200 μl) was added to the mixture, and it was cultured at 23 °C for various time lengths from 10 to 60 minutes. The concentration of PEG4000 was optimized, and the range of 20 to 80% PEG4000 in 200 to 400 mM mannitol, 100 to 500 mM CaCl2 solution was determined. Then the protoplasts were washed in W5 and centrifuged at 80 g for 3 minutes, then resuspended in 1 ml of W5 and cultured in the dark at 23 °C. After culturing for 24 to 72 hours, fluorescence was detected by microscopy.
[0698] FACS sorting of fluorescent protein-expressing cells
[0699] At 24 to 72 hours after plasmid / RNA delivery, cells were collected using a flow cytometer and sorted for fluorescent protein expression to enrich for multiple cells expressing mCherry / editing agent as previously described (Chiang et al., Sci Rep, 2016, 6:24356). This enrichment step allows bypassing antibiotic selection and collecting only cells transiently expressing the fluorescent protein, Cas9, and the sgRNA. These cells can be further tested for editing of the target gene for successful exchange events and corresponding loss of gene expression via HR.
[0700] Bombardment and plant regeneration
[0701] Arabidopsis root preparation:
[0702] Multiple Arabidopsis (cv. Col-0) seeds sterilized with chlorine gas were sown on MS minus sucrose plates, vernalized in the dark at 4 °C for 3 days, and then germinated vertically under constant light at 25 °C. After 2 weeks, the roots were cut into 1-cm root segments and placed on callus induction media (CIM: 1 / 2 MS (with B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 2 mg / l IAA, 0.5 mg / l 2,4-D, 0.05 mg / l kinetin) plates. After culturing in the dark at 25 °C for 6 days, the multiple root segments were transferred to multiple filter paper discs and placed on multiple CIMM plates (1 / 2 MS (without vitamins), 2% glucose, 0.4 M mannitol, pH 5.7, and 0.8% agar) for 4 to 6 hours in preparation for bombardment.
[0703] Bombardment
[0704] Multiple plasmid constructs were introduced into the root tissue by PDS-1000 / He particle delivery (Bio-Rad; PDS-1000 / He system #1652257), and this procedure requires several preparation steps outlined below.
[0705] Gold stock preparation
[0706] Forty milligrams of 0.6-μm gold (Bio-Rad; Cat: 1652262) was mixed with 1 ml of 100% ethanol, pulsed centrifuged into pellets, and the ethanol was removed. This washing procedure was repeated two more times.
[0707] After washing, the pellets were resuspended in 1 ml of sterile distilled water and aliquoted into 1.5-ml tubes (50-μl working volume per aliquot).
[0708] Magnetic bead preparation
[0709] Briefly, the following steps are carried out:
[0710] One single tube has enough gold to bombard 2 plates of Arabidopsis roots (2 shots per plate), so each tube is divided among 4 (1,100 psi) Biolistic Rupture disks (Bio-Rad; Cat: 1652329).
[0711] Bombardment requires multiple plates of the same sample. To maintain sample consistency and minimize overall preparation work, the tubes are combined and the volumes of DNA and CaCl2 / spermidine mixture are adjusted accordingly.
[0712] The following protocol summarizes the process of preparing gold for one tube and should be adjusted according to the amount of gold used per tube.
[0713] All subsequent procedures are carried out in an Eppendorf thermomixer at 4°C.
[0714] Prepare multiple plasmid DNA samples, with each tube containing 11 μg of DNA added at a concentration of 1000 ng / μl.
[0715] (1) Add 493 μl of ddH2O to 1 aliquot (7 μl) of spermidine (Sigma-Aldrich; S0266) to a final concentration of 0.1 M spermidine. Add 1250 μl of 2.5 M CaCl2 to the spermidine mixture, vortex and place on ice.
[0716] (2) Place a pre-prepared tube of gold in the thermomixer and spin at 1400 rpm.
[0717] (3) Add 11 μl of DNA to the tube, vortex and return to the spinning thermomixer.
[0718] (4) To bind the DNA / gold particles, add 70 μl of the spermidine CaCl2 mixture to each tube (in the thermomixer).
[0719] (5) Vortex the multiple tubes vigorously for 15 to 30 seconds and place on ice for about 70 to 80 seconds.
[0720] (6) Centrifuge the mixture at 7000 rpm for 1 minute, remove the supernatant and place on ice.
[0721] (7) Add 500 μl of 100% ethanol to each tube and resuspend the pellets by pipetting and vortexing.
[0722] (8) Centrifuge the multiple tubes at 7000 rpm for 1 minute.
[0723] (9) Remove the supernatant, resuspend the pellets in 50 μl of 100% ethanol, and store on ice.
[0724] Macro carrier preparation
[0725] The following operations are carried out in a laminar flow cabinet:
[0726] (1) Sterilize and dry multiple macro carriers (Bio-Rad; 1652335), multiple stopping screens (Bio-Rad; 1652336), and multiple macro carrier disk holders.
[0727] (2) Place the multiple macro carriers flat in the multiple macro carrier disk holders.
[0728] (3) Vortex the multiple DNA-coated gold mixtures and disperse (5 μl) onto the center of each gene gun rupture disk.
[0729] Allow the ethanol to evaporate.
[0730] PDS-1000 (helium particle delivery system)
[0731] Briefly, the following operations are carried out:
[0732] Adjust the regulating valve of the helium gas cylinder to an incoming pressure of at least 1300 psi. Generate a vacuum by pressing the vac / vent / hold switch and holding the fire switch for 3 seconds. This ensures the discharge of helium into the pipeline system.
[0733] Place multiple 1100 psi rupture disks in isopropanol and mix to remove static electricity.
[0734] (1) Place 1 rupture disk in the disk retaining cap.
[0735] (2) Construct a microcarrier launch assembly (with a stopping screen and a gold-coated microcarrier).
[0736] (3) Place the covered Petri dish with Arabidopsis root callus 6 cm below the emission assembly.
[0737] (4) Set the vacuum pressure to 27 inches of mercury (mercury) and open the helium valve (about 1100 psi).
[0738] (5) Release the vacuum; remove the microcarrier emission assembly and the rupture disk fixing cover.
[0739] (6) Bombard the same tissue (i.e., bombard each plate 2 times).
[0740] (7) Subsequently, place the multiple bombarded roots on multiple CIM plates in the dark at 25 °C for another 24 hours.
[0741] Co-bombardment
[0742] When bombarding multiple combinations of multiple GEiGS plasmids, mix 5 μg (1000 ng / μl) of the sgRNA plasmid with 8.5 μg (1000 ng / μl) of the exchange plasmid and add 11 μl of this mixture to the sample. If bombarding more GEiGS plasmids simultaneously, the concentration ratio of the multiple sgRNA plasmids to the multiple exchange plasmids used is 1:1.7, and add 11 μg (1000 ng / μl) of this mixture to the sample. If co-bombarding with multiple plasmids not related to GEiGS exchange, mix in equal proportions and add 11 μg (1000 ng / μl) of the mixture to each sample.
[0743] Plant regeneration
[0744] For shoot regeneration, perform the modified protocol from Valvekens et al. (Valvekens, D. et al., Proc Natl Acad Sci, USA, 1988, 85(15): 5536 - 5540). Place the multiple bombarded roots on multiple Shoot Induction Media (SIM) plates containing 1 / 2 MS (with B5 vitamins), 2% glucose, pH 5.7, 0.8% agar, 5 mg / l 2iP, 0.15 mg / l IAA. Leave the multiple plates in a cycle of 16 hours in the light at 25 °C - 8 hours in the dark at 23 °C. After 10 days, transfer the multiple plates to multiple MS plates (containing 3% sucrose, 0.8% agar) for 1 week, and then transfer to multiple fresh similar plates. Once multiple plants are regenerated, excise them from the multiple roots and place them on multiple MS plates (containing 3% sucrose, 0.8% agar) until analysis.
[0745] Colony formation and plant regeneration
[0746] Partially sample the multiple fluorescent protein-positive cells and use them for DNA extraction and genome editing (GE) testing. Partially plate them at high dilutions in liquid medium to allow colony formation for 28 to 35 days. Pick multiple colonies, let them grow, and divide them into two aliquots. One aliquot is used for DNA extraction and genome editing (GE) testing and CRISPR DNA-free testing (see below), while the other aliquot is kept in culture until its status is verified. Only those that clearly show GE and are CRISPR DNA-free are screened forward. Multiple colonies grow in the medium for about 6 to 10 weeks. Subculture multiple original colonies (or calli) into regeneration medium (e.g., half-strength MS + B5 vitamins, 20 g / l sucrose). Place the regenerated multiple plants on solidification medium (0.8% agar) under a low light intensity at 28 °C. After 2 months, transfer the multiple plants to soil and place them in a greenhouse with 80 to 100% humidity.
[0747] Virus inoculation and DNA delivery to Arabidopsis seedlings
[0748] Juice from Arabidopsis leaves infected with the TuMV infectious clone p35S::TuMV-GFP (0.1 mg / ml) is used for mechanical inoculation.
[0749] Plant propagation
[0750] Sequenced and predicted to lose the expression of the multiple target genes and found to have no CRISPR system DNA / RNA, multiple clones are propagated in large numbers and in parallel to differentiate into multiple seedlings, and functional assays are performed on them to test the desired traits.
[0751] Phenotype analysis
[0752] As described above, for example, by observing the pigmentation, florescence, or morphology depending on the target gene.
[0753] Allyl alcohol selection
[0754] To select multiple plants containing allyl alcohol, 10 days after bombardment, place the multiple roots on SIM medium. Immerse the multiple roots in 30 mM allyl alcohol (Sigma-Aldrich, USA) for 2 hours. Then wash the multiple roots 3 times with MS medium and place them on multiple MS plates (containing 3% sucrose, 0.8% agar). Perform the regeneration process as described above.
[0755] Genotyping
[0756] Process multiple tissue samples and amplify multiple amplicons according to the manufacturer's recommendations. The MyTaq Plant - PCR Kit (BioLine BIO 25056) is used for shorter internal amplification, while the Phire Plant Direct PCR Kit (Thermo Scientific; F - 130WH) is used for longer external amplification. The multiple oligonucleotides used for these amplifications are detailed in Table 2 above. Different modifications in the miRNA locus are determined by different digestion patterns of the multiple amplicons as follows:
[0757] For the modification of miR - 390 - the length of the internal amplicon is 978 base pairs, while for external amplification, its length is 2629 base pairs. To identify swap 7, digestion with NlaIII yields a fragment of 636 base pairs in size, while in the wt form, it is cut into fragments of 420 and 216 bases in length. To identify swap 8, digestion with Hpy188I yields fragments of 293 and 339 base pairs in size, while in the wt form, this site is absent and a 632 - base fragment is obtained. To identify swaps 11 and 12, digestion with BccI yields a fragment of 662 base pairs in size, while in the wt form, it is cut into fragments of 147 and 417 bases in length.
[0758] For the modification of miR-173, the length of the internal amplicon is 574 base pairs, while for the nested external amplification, its length is 466 base pairs. To identify swap 3, digestion with BslI yields fragments of 217 and 249 base pair sizes in the external amplicon, and fragments of 317 and 149 base pair sizes in the internal amplicon. In the wt form, this site is absent, and a 466-base long fragment is obtained in the external amplicon, and a 574-base long fragment in the internal reaction. To identify swap 4, digestion with BtsαI yields fragments of 212 and 254 base pair sizes in the external amplicon, and fragments of 212 and 362 base pair sizes in the internal amplicon. In the wt form, this site is absent, and a 466-base long fragment is obtained in the external amplicon, and a 574-base long fragment in the internal reaction. To identify swap 9, digestion with NlaIII yields fragments of 317 and 149 base pair sizes in the external amplicon, and fragments of 317 and 244 base pair sizes in the internal amplicon. In the wt form, this site is absent, and a 466-base long fragment is obtained in the external amplicon, and a 561-base long fragment in the internal reaction. To identify swap 10, digestion with NlaIII yields fragments of 375 and 91 base pair sizes in the external amplicon, and fragments of 375 and 186 base pair sizes in the internal amplicon. In the wt form, this site is absent, and a 466-base long fragment is obtained in the external amplicon, and a 561-base long fragment in the internal reaction.
[0759] DNA and RNA Isolation
[0760] Multiple samples were collected into liquid nitrogen and stored at -80 °C until processing. Tissue grinding was performed in multiple tubes placed in dry ice using a plastic tissue grinder pestle (Axygen, USA). DNA and total RNA were isolated from the ground tissue using an RNA / DNA purification kit (cat. 48700; Norgen Biotek Corp., Canada) according to the manufacturer's instructions. In cases where the RNA fraction had a low 260 / 230 ratio (<1.6), the isolated RNA was precipitated overnight at -20 °C with 1 μl glycogen (cat. 10814010; Invitrogen, USA), 10% V / V sodium acetate, 3 M pH 5.5 (cat. AM9740, Invitrogen, USA), and 3 volumes of ethanol. The solution was centrifuged at maximum speed for 30 minutes at 4 °C. Subsequently, it was washed twice with 70% ethanol, air-dried for 15 minutes, and resuspended in nuclease-free water (cat. 10977035; Invitrogen, USA).
[0761] Reverse transcription (RT) and quantitative real-time PCR (qRT-PCR)
[0762] One microgram of isolated total RNA was treated with DNase I according to the manufacturer's manual (AMPD1; Sigma-Aldrich, USA). The samples were reverse-transcribed according to the instructions of the High-Capacity cDNA Reverse Transcription Kit (cat. 4368814; Applied Biosystems, USA).
[0763] For gene expression, according to the manufacturer's protocol, on a CFX96 Touch TM Real-Time PCR Detection System (BioRad, USA) and JumpStart TM Taq ReadyMix TM (S4438, Sigma-Aldrich, USA), quantitative real-time PCR (qRT-PCR) analysis was performed and analyzed using the Bio-Rad CFX manager program (version 3.1). For the analysis of AtADH1 (AT1G77120), the following primer sets were used: forward GTTGAGAGTGTTGGAGAAGGAG (SEQ ID NO: 367) and reverse CTCGGTGTTGATCCTGAGAAG (SEQ ID NO: 368); for the analysis of AtPDS3 (AT4G14210), the following primer sets were used: forward GTACTGCTGGTCCTTTGCAG (SEQ ID NO: 369) and reverse AGGAGCACTACGGAAGGATG (SEQ ID NO: 370); for the endogenous calibration gene, the 18S ribosomal RNA gene (NC_037304) was used - forward ACACCCTGGGAATTGGTTT (SEQ ID NO: 371) and reverse GTATGCGCCAATAAGACCAC (SEQ ID NO: 372).
[0764] Example 1A
[0765] Genome editing-induced gene silencing (GEiGS)
[0766] To design multiple GEiGS oligonucleotides, multiple template non-coding RNA molecules (multiple precursors) are processed and give rise to multiple small interfering RNA molecules (multiple mature). Two sources of the multiple precursors and their corresponding mature sequences are used to generate multiple GEiGS oligonucleotides. For multiple miRNAs, the multiple sequences are obtained from the miRBase database (Kozomara, A. and Griffiths-Jones, S., Nucleic Acids Res, 2014, 42: D68, ). Multiple tasiRNA precursors and multiple mature are obtained from the tasiRNAdb database (Zhang, C. et al., Bioinformatics, 2014, 30: 1045, ).
[0767] Multiple silencing targets are selected in multiple host organisms (see Table 1B above). Multiple siRNAs targeting these targets are designed using the siRNArules software (Holen, T., RNA, 2006, 12: 1620, ). Each of these siRNA molecules is used to replace the multiple mature sequences present in each precursor, thereby generating multiple "naive" GEiGS oligonucleotides. The structures of these naive sequences are adjusted to be as close as possible to the structure of the wild-type precursor using the ViennaRNA Package v2.6 (Lorenz, R. et al., ViennaRNAPackage 2.0, Algorithms for Molecular Biology, 2011, 6: 26). After adjusting the structure, the number of multiple sequences and the changes in secondary structure between the oligonucleotides of the wild-type and the modified oligonucleotides are calculated. These calculations are crucial for identifying multiple potentially functional GEiGS oligonucleotides, which require a minimum degree of sequence change relative to the wild-type.
[0768] Multiple CRISPR / cas9 small guide RNAs (sgRNAs) targeting the multiple wild-type precursors are generated using the CasOT software (Xiao, A. et al., Bioinformatics, 2014, 30: 1180, ). Multiple sgRNAs are selected, where the modification used to generate the GEiGS oligonucleotide affects the PAM region of the sgRNA, rendering it ineffective for the modified oligonucleotide.
[0769] Example 1B
[0770] Gene Silencing of Endogenous Plant Genes – PDS
[0771] To establish a high-throughput screen for quantitatively assessing endogenous gene silencing using genome editing-induced gene silencing (GEiGS), the inventors considered several potential visual markers. The inventors chose to focus on multiple genes involved in pigment accumulation, for example, the gene encoding phytoene desaturase (PDS). PDS silencing results in photobleaching ( Figure 2B ), which allows its use as a reliable seedling screen as a proof-of-concept (POC) after gene editing. Figures 2A to 2C A representative experiment of PDS silencing in Nicotiana benthamiana and Arabidopsis plants is shown. Multiple plants show the characteristic photobleaching phenotype observed in multiple plants with low levels of carotenoids.
[0772] In the POC experiment, the steps for selecting multiple siRNAs are as follows:
[0773] To initiate the RNAi mechanism against the PDS gene in Arabidopsis or Nicotiana benthamiana using GEiGS applications, effective 21- to 24-bp siRNAs targeting PDS need to be identified. To find multiple active siRNA sequences, two methods were used: (1) Screening the literature: Since PDS silencing is a well-known assay in many plants, the inventors were identifying multiple well-characterized short siRNA sequences in different plants that might match the gene in Arabidopsis or Nicotiana benthamiana 100%. (2) There are many publicly available algorithms being used to predict which siRNAs will initiate gene silencing against a specific gene. Since the multiple predictions of these algorithms are not 100%, the inventors only used the sequences that were the results of at least two different algorithms.
[0774] To use multiple siRNA sequences that silence the PDS gene, the inventors are using the CRISPR / Cas9 system to exchange them with a known endogenous non-coding RNA gene sequence (e.g., altering an miRNA sequence, altering a long dsRNA sequence, generating antisense RNA, altering tRNA, etc.). There are databases of many characterized non-coding RNAs, e.g., miRNAs; the inventors are selecting several known endogenous non-coding RNAs of Arabidopsis thaliana or Nicotiana benthamiana, e.g., multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, to exchange the endogenous miRNA sequence with an siRNA targeting the PDS gene, the inventors are using the HR method (Homologous Recombination). Using HR, two options can be considered: using a donor ssDNA oligonucleotide sequence of approximately 250 to 500 nt, which contains, for example, the modified miRNA sequence in the middle, or using multiple plasmids carrying inserts of 1 Kb to 4 Kb, which are almost 100% identical to the miRNA near it in the plant genome, except that the 2x 21 bp miRNA and *miRNA are changed to the siRNA of the PDS (500 to 2000 bp upstream and downstream of the siRNA, as Figure 1 shown). The transfection includes the following constructs: a CRISPR:Cas9 / GFP sensor for tracking and enriching multiple positive transformed cells, multiple gRNAs that direct the Cas9 to generate a double-strand break (DSB) (to be repaired by HR depending on the insert vector / oligonucleotide). The insert vector / oligonucleotide contains two consecutive homology regions flanking the targeted locus, which are replaced (i.e., the miRNA) and modified to carry the mutation of interest (i.e., the siRNA). If using a plasmid, the targeted construct includes or does not include multiple restriction enzymes-recognition sites and serves as a template for homologous recombination to end with the selected siRNA replacing the miRNA. After transfection into multiple protoplasts, FACS is used to enrich Cas9 / sgRNA transfection events, multiple protoplasts are regenerated into multiple plants, and multiple bleached seedlings are screened and scored (see Figure 1)). As a control group, multiple protoplasts were transfected with an oligonucleotide carrying a random non-PDS targeting sequence. The multiple positively edited plants are expected to produce multiple siRNA sequences targeting PDS. Therefore, compared with the control group without gRNA, the PDS gene is silenced and the seedlings are regarded as white. It should be noted that after the exchange, the edited miRNA will still be processed as miRNA because the original base pairing profile is retained. However, the newly edited processed miRNA has a high complementarity with the target (e.g., 100%), so in fact the newly edited small RNA will act as siRNA.
[0775] Example 2
[0776] Gene silencing of "endogenous" transgene - GFP
[0777] Another quick and reliable method to check the efficiency of GEiGS is by silencing a transgene, which is also a marker gene, e.g., GFP (green fluorescent protein). There are several simple methods to evaluate the effectiveness of GFP silencing in the cells, such as FACS analysis, PCR, and microscopy. To show the proof of concept (POC) of GFP silencing using GEiGS, the present inventors are using a transgenic Arabidopsis or tobacco line stably expressing GFP. Multiple protoplasts from multiple GFP-expressing plants are used with the GEiGS method to modify endogenous non-coding RNAs, e.g., miRNA as siRNA, to effectively initiate the RNA silencing mechanism targeting the GFP gene. As shown in Figure 3, the multiple positively edited plants are expected to silence GFP expression. In addition, the GFP silencing in multiple plants is well characterized and there are many available short RNA sequences (siRNA) that can be used to initiate GFP silencing. Therefore, for gene exchange, the present inventors are using multiple publicly available tools to generate siRNAs specific to GFP, or are using multiple known siRNA molecules available from the literature.
[0778] To use multiple siRNA sequences that will silence the GFP gene, the inventors used the CRISPR / Cas9 system to exchange them with a known endogenous non-coding RNA (e.g., miRNA gene sequence), (e.g., altering an miRNA sequence, altering a long dsRNA sequence, generating antisense RNA, altering tRNA, etc.). There are databases of many characterized non-coding RNAs, e.g., multiple miRNAs, and the inventors are selecting several known Arabidopsis thaliana or Nicotiana benthamiana non-coding RNAs, e.g., multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, to exchange the endogenous miRNA sequence with siRNA, the inventors are using the HR method. In HR, two options can be considered: using a donor oligonucleotide sequence of about 250 to 500 nt, which contains, for example, the siRNA sequence in the middle, or using multiple plasmids expressing 1 Kb to 4 Kb inserts that are almost 100% identical to the miRNA near the plant genome, except that the 2x 21 bp of the miRNA and the *miRNA are changed to the siRNA of GFP (500 to 2000 bp upstream and downstream of the siRNA, see Figure 1 ). The transfection contains the following constructs: a CRISPR:Cas9 / RFP sensor for tracking and enriching multiple positive transformed cells (e.g., using FACS analysis), multiple gRNAs that direct Cas9 to generate a DSB (repaired by HR depending on the insertion vector / oligonucleotide). The insertion vector contains two consecutive homology regions around the targeted locus, and the multiple regions are replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). The targeted construct includes or does not include multiple restriction enzyme recognition sites and serves as a template for homologous recombination to replace the miRNA with the selected siRNA. After transfection into multiple protoplasts, FACS is used to enrich positive transfection events (using the red fluorescent protein (RFP) label), and the GFP silencing of the enriched protoplasts is scored under a microscope ( Figure 4 ). The multiple positively edited protoplasts are expected to produce multiple siRNA sequences targeting GFP, and thus, compared to control protoplasts, the transgenic GFP expression is expected to be silenced. GFP is a faster method than PDS because the last two steps of recovery and regeneration are not required and can be scored at the multiple protoplast / cell level.
[0779] Example 3
[0780] Exogenous Transgene Gene Silencing – GFP in Arabidopsis
[0781] In addition to the previous examples of GFP silencing, another way to demonstrate the efficiency of GEiGS is to silence a GFP (green fluorescent protein)-like marker gene in a transient GFP transformation assay. In this example, multiple first plant cells (e.g., Arabidopsis) are treated with GEiGS to express multiple small siRNA molecules targeting GFP (the method using siGFP was discussed in Example 2 above). Then, control protoplasts (e.g., GEiGS-PDS) and protoplasts edited with GEiGS (expressing siGFP) are transfected with a plasmid expressing two markers (sensors) GFP+RFP, respectively. Multiple protoplasts that express only RFP but not GFP in the GEiGS treatment are the result of GFP silencing due to siGFP expression (as Figure 5 shown).
[0782] Example 4
[0783] Silencing of exogenous viral genes in plants immune to viral infection (using GFP as a marker)
[0784] To demonstrate that GEiGS is a reliable method for plant immunity with the ability to knock out multiple exogenous genes, the inventors provided an example of silencing a viral gene. There are multiple viruses that can infect different plant species and can be used in the current POC: TuMV, CMV, TMV, etc.
[0785] Turnip mosaic virus (TuMV) is transmitted non - persistently by aphids and causes epidemic diseases of cruciferous crops in many parts of the world. The TuMV genome is a single - stranded, positive - sense RNA molecule of approximately 10,000 nt (accession number: NC_002509). TuMV has the same typical potyvirus gene organization as previously discussed by Urcuqui - Inchima et al. (Urcuqui - Inchima et al., Virus Res., 2001, 74: 157 - 175). The symptoms of TuMV are spots of extensive, yellow, round, and irregular areas. The oldest leaves usually turn bright yellow everywhere. The lamina often necroses. TuMV - GFP and suppressor - defective TuMV - AS9 - GFP are widely used to expose antiviral silencing activity in Arabidopsis thaliana. Multiple wild - type plants are immune to TuMV - AS9 - GFP, but this immunity is effectively suppressed by the loss of DCL2 and DCL4, indicating that TuMV usually masks the role of a siRNA - dependent antiviral response (Hernan Garcia - Ruiz et al., The Plant Cell, 2010, 22: 481 - 496).
[0786] Cucumber mosaic virus (CMV) is a plant pathogenic virus of the Bromoviridae family. It is the type member of the genus Cucumovirus in the plant virus family. This virus is distributed worldwide and has a very wide host range. In fact, it is famous for having the widest host range among any known plant virus. It can be mechanically transmitted between plants through sap and by aphids in a stylet - borne manner. This virus was first discovered in 1934 in cucumbers (Cucumis sativus) showing symptoms of mosaic disease, and thus was named cucumber mosaic disease. An expression vector based on CMV expression was developed, which uses the mutant 3a MP for CP - independent intercellular movement. This new vector (Fujiki et al., Virology, 2008, 381(1): 136 - 142) was integrated into an Agrobacterium binary vector and delivered to multiple plants by agroinfiltration. The results showed that this novel CMV - based expression vector has broad application prospects for recombinant protein production.
[0787] Tobacco mosaic virus (TMV) is a single-stranded RNA virus that typically infects solanaceous plants, a plant family that includes many species such as petunias, tomatoes, and tobacco. The virus forms a mosaic pattern of multiple brown spots on the surface of multiple leaves. The virus typically does not kill the plant but can severely impede its growth. In hot and dry weather, the lower leaves may suffer from "mosaic burn" and large areas of leaves will die. This virus cannot enter multiple plants on its own. Multiple plants are usually infected through multiple plant wounds after human handling or through contaminated equipment. Once inside the plant, the virus releases its genetic code (RNA). Through this code, the plant is confused into thinking it is its own and begins to produce multiple viral proteins. The virus-based expression system in plants is particularly attractive compared to alternative transient expression systems because of its high level of gene proliferation and the ability to reach high expression levels simultaneously in a short period of time while minimizing damage to host activities. TMV is one of the most widely studied plant viruses and has thus become a natural choice for vector development. Multiple TMV-based vectors have been shown to produce recombinant proteins at levels up to 80% of total soluble protein. Agroinfection is a cheap and reproducible method, making it a preferred method for delivering multiple viral expression vectors as part of the T-DNA of a binary vector carried by Agrobacterium tumefaciens to multiple plant tissues.
[0788] The inventors used TuMV-GFP for Arabidopsis infection or TMV-GFP for multiple tobacco plants. To generate multiple plants resistant to viral infection, the inventors used an engineered virus that expresses GFP after plant infection. Using this virus will enable the use of the same constructs as described in Example 3 above. The difference is that now the GFP is expressed by the viral infection. Control plants infected with viral GFP (CMV or TMV) showed GFP expression under the microscope ( Figure 6 ), however, multiple GEiGS plants engineered to express siRNA GFP are expected to show reduced levels of GFP ( Figure 6)。Therefore, generating multiple GEiGS plants that do not express GFP after infection with virus-GFP would demonstrate the achievement of RNAi silencing of the exogenous gene, and GEiGS is an effective method for rendering multiple plants immune to viruses and other potential pathogens. There are several simple methods to evaluate the effectiveness of GFP silencing in the cells, such as using FACS analysis, PCR, and microscopy. GFP silencing in multiple plants is well characterized, and there are many available short RNA sequences (siRNAs) that are active in initiating GFP silencing. Therefore, for gene swapping, the inventors used several known siRNA molecules available from the literature.
[0789] To use multiple siRNA sequences that would silence the GFP gene, the inventors used the CRISPR / Cas9 system to swap them with a known endogenous non-coding RNA (e.g., miRNA gene sequence) (as mentioned above, there are many other options for introducing these siRNA sequences, such as altering multiple long dsRNA sequences, generating antisense RNA, altering tRNA, etc.). There are many databases of characterized endogenous non-coding RNAs, such as multiple miRNAs, and the inventors are selecting several known Arabidopsis thaliana or Nicotiana benthamiana non-coding RNAs, such as multiple miRNAs with different expression patterns (e.g., low constitutive expression, high expression, stress-induced, etc.). For example, to swap the endogenous miRNA sequence with the siRNA, the inventors are using the HR method. In HR, two options can be considered: using a donor oligonucleotide sequence of approximately 250 to 500 nt, which contains, for example, the siRNA sequence in the middle, or using multiple plasmids that express 1 Kb to 4 Kb inserts, which are almost 100% identical to the miRNA near the plant genome, except that the 2x21 bp miRNA and the *miRNA are changed to the siRNA of GFP (500 to 2000 bp upstream and downstream of the siRNA, see Figure 1)except. The transfection comprises the following constructs: a CRISPR:Cas9 / RFP sensor for tracking and enriching multiple positive transformed cells (e.g., using FACS analysis), multiple gRNAs that direct the Cas9 to generate a DSB (repaired by HR depending on the insertion vector / oligonucleotide). The insertion vector contains two consecutive homology regions flanking the targeted locus, which are replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). The targeted construct includes or does not include multiple restriction enzyme recognition sites and serves as a template for homologous recombination to replace the miRNA with the selected siRNA. After transfection into multiple protoplasts, FACS is used to enrich positive transfection events, multiple protoplasts are regenerated into multiple plants, and multiple plants are infected with the virus by mechanical inoculation. The GFP silencing of multiple plants is scored under a microscope (as Figure 6 shown). The multiple positively edited protoplasts with GEiGS are expected to generate multiple siRNA sequences targeting GFP, and thus, the viral GFP gene expression is expected to be silenced compared to unedited plants in the control group.
[0790] Example 5
[0791] Nematode-resistant banana plants
[0792] The damage caused by nematodes to banana productivity is huge, up to 50% of yield loss in untreated soil. In traditional banana plantations, mono cropping is a common practice, and this problem is more prominent. The ban on nematicides such as methyl bromide around the world has exacerbated this problem and left farmers with inappropriate and unreliable alternatives. Radopholus similis (the burrowing nematode) is the most economically important nematode parasite in bananas worldwide. The infection of burrowing nematodes can cause toppling disease in bananas, yellowing disease in peppers, and spreading decline in citrus. These diseases are the result of the destruction of root tissues by burrowing nematode infection, causing multiple plants to have little ability to support or absorb water and transport nutrients. Because of its damage to citrus, ornamentals, and other agricultural industries around the world, the burrowing nematode is one of the most regulated nematode plant pests ( Figure 7 ).
[0793] RNA interference (RNAi) has become an extremely useful gene-silencing tool for functional analysis in a variety of organisms, especially the free-living nematode Caenorhabditis elegans. An increasing number of studies have described its application in plant-parasitic nematodes. When multiple nematodes take up multiple double-stranded RNAs (dsRNAs) or short interfering RNAs (siRNAs) that trigger a systemic RNAi response, genes expressed in multiple cell types are silenced. Extensive siRNA studies in C. elegans have shown that the successful blocking of nematodes from completing their life cycle is due to multiple silenced genes expressed early in embryonic development. In Radopholus similis, these candidate genes may be calreticulin13 (CRT) or the gene collagen 5 (col-5). CRT is a Ca2 + -binding multifunctional protein that plays a key role in the parasitism, immune evasion, reproduction, and pathogenesis of many animal parasites and plant nematodes. Therefore, CRT is a promising target for controlling R. similis. Col-5 belongs to the multiple collagen genes of nematodes and is used to encode proteins with multiple functions. Their most abundant products are cuticular collagens, which comprise approximately 80% of the proteins in the nematode cuticle. To date, the structures of these collagens have been found to be extremely similar in free-living and parasitic nematode species, and the multiple genes used to encode them appear to form a large multigene family whose expression is developmentally regulated.
[0794] By using GEiGS, the inventors created multiple banana plants that express multiple siRNA molecules that are transferred from their roots to multiple nematodes during feeding and subsequently induce multiple nematode gene silencing. The silencing of multiple genes that are continuously essential during the life cycle inhibits nematode reproduction and eliminates the damage caused by multiple nematodes. The inventors are modifying some banana endogenous non-coding RNAs, for example, multiple miRNA sequences with multiple short sequences from the CRT or the col-5 gene. GEiGS is used for multiple banana protoplasts, which are regenerated into multiple plants and then screened for resistance with different nematodes.
[0795] Example 6
[0796] Resistance of banana plants to Fusarium oxysporum
[0797] The genus Fusarium contains several fungal species that are widely distributed in soils and organic substrates throughout the world. Fusarium oxysporum is one of the most relevant species in this genus and is the causal pathogen of root rot, damping-off, and wilt disease in more than 100 plant species, including many economically important horticultural crops, flowers, trees, and some field crops (e.g., cabbage, banana, and cotton). Fusarium oxysporum is a devastating pathogen that causes significant yield losses in a variety of crops, so it is crucial to develop sustainable, environmentally friendly methods to improve crop resistance. Fusarium oxysporum is composed of more than 120 special forms of pathogenic strains that are determined by their primary host plants. All Fusarium oxysporum strains are saprophytic, capable of growing and surviving on organic matter in the soil for a long time, so they are difficult to control. Its pathogenic life cycle begins with spore germination after recognition of a suitable host. Once hyphae are formed, the pathogen enters its host by directly penetrating the roots and colonizes within the xylem by producing microconidia that lead to the formation of mycelia. The colonization and toxin production by the pathogen cause blockage of the host vascular system, resulting in multiple characteristic disease symptoms, including yellowing of the vascular system in veins and leaves, vein clearing, chlorosis, and necrosis, leaf shedding, and wilting. After the death of the plant, the fungus sporulates on the surface of the decaying leaves. Fusarium oxysporum is most prevalent in tropical and subtropical regions, and its geographical range is expected to expand due to climate change. Due to its large host range and persistence in the soil, current control methods for Fusarium wilt are very limited, and crop rotation is ineffective. Management of Fusarium wilt is mainly carried out through cultural practices and farm sanitation, which can only reduce the spread of inoculum, and soil sterilization can only be carried out in greenhouses. Soil fumigation with broad-spectrum biocides (e.g., methyl bromide) is expensive and has many environmental hazards.
[0798] Hu Z. has used host-delivered RNA interference technology to partially silence three different genes (FOW2, FRP1, and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. Conglutinans (Hu et al., Front Chem., 20(3):1, 2015). Expression of multiple double-stranded RNA (dsRNA) molecules targeting multiple fungal pathogen genes has been achieved in many transgenic Arabidopsis lines. Fusarium oxysporum infecting the multiple transgenic lines showed significantly reduced mRNA levels in all three targeted genes, with an average reduction of 75%, 83%, and 72% for FOW2, FRP1, and OPR, respectively. Silencing of multiple pathogen genes had a significant positive effect on the ability of the transgenic lines to resist infection. All transgenic lines showed enhanced resistance to Fusarium oxysporum and delayed the development of disease symptoms, especially the FRP1 and OPR lines. After fungal infection, the survival rate of the multiple transgenic lines was higher than that of the control wild-type line plants, which consistently showed a 10% survival rate, while the FOW2 line showed a 25% survival rate; the survival rate of the FRP1 line was between 30% and 50%, and that of OPR was between 45% and 70%. The downregulation was specific to the multiple targeted genes and had no unintended effects on multiple related genes (Hu Z., 2015, ibid.). The results suggest that in fungi, both long and short dsRNAs are internalized and induce RNAi to silence multiple target genes.
[0799] The inventors are using GEiGS to generate banana plants resistant to Fusarium oxysporum by altering a small number of endogenous non-coding RNAs (e.g., multiple miRNA sequences) to specifically target the multiple fungal genes, e.g., FOW2, FRP1, and OPR. Multiple edited protoplasts are regenerated into multiple plants and attacked with Fusarium oxysporum in a controlled environment to verify that the resistant plants express the relevant siRNAs.
[0800] Example 7
[0801] Resistance of coffee plants to nematodes
[0802] Coffee is a type of flowering plant, and its seeds, known as coffee beans, are used to make various coffee beverages and products. It is a member of the Rubiaceae family. They are shrubs or small trees native to tropical and southern Africa as well as tropical Asia. Coffee is considered one of the most valuable and widely traded commodity crops in the world and is an important export product in many countries including Central and South America, South America, the Caribbean, and Africa. The continuous decline in coffee production is attributed to biological and socio-economic constraints. Among the less studied biological constraints are nematodes.
[0803] Worldwide, especially in Vietnam, plant-parasitic nematodes are considered a serious constraint to coffee production ( Figure 8 ). The dominant and most important species are Radopholus arabocoffeae and Pratylenchus coffeae. These two species are the cause of death of plants less than 5 years old. Traditionally, the main method of controlling Pratylenchus coffeae has been by chemical means, but there is no specific control strategy for Radopholus arabocoffeae.
[0804] The present inventors are using the GEiGS strategy (as described in Example 5 above) to create multiple Coffea canephora (Robusta) trees expressing multiple siRNA molecules that are delivered from their multiple roots to multiple nematodes during feeding, subsequently inducing multiple nematode gene silencing. The silencing of multiple genes that are continuously essential during the life cycle inhibits nematode reproduction and eliminates the damage caused by multiple nematodes. Thus, the present inventors are altering some endogenous non-coding RNAs, for example, multiple miRNA sequence RNAs having multiple short sequences from the multiple nematode genes. GEiGS is used for multiple coffee protoplasts, which are regenerated into multiple plants and then screened for resistance with different nematodes.
[0805] Example 8
[0806] Generating plants with modified endogenous miRNAs to target different genes
[0807] The lowest degree of modification (in its recognition sequence) in the genomic locus of a miRNA that will mature into a miRNA can lead to a new system for regulating multiple new genes in a non-transgenic manner. Thus, an Agrobacterium-free transient expression method was used to introduce these modifications by bombarding multiple Arabidopsis roots and further analyze their regeneration. The present inventors have selected two genes, PDS3 and ADH1, in Arabidopsis plants to target.
[0808] Carotenoids play important roles in many physiological processes in multiple plants, and the phytoene desaturase gene (PDS3) encodes one of several important enzymes in the carotenoid biosynthesis pathway, the silencing of which produces a white / bleached phenotype. Thus, multiple plants with reduced PDS3 expression exhibit reduced chlorophyll levels, up to complete albinism and dwarfism.
[0809] Alcohol dehydrogenase (ADH1) includes a group of dehydrogenases that catalyze the interconversion of multiple alcohols with multiple aldehydes or multiple ketones while reducing NAD+ or NADP+. The main metabolic purpose of this enzyme is to break down alcoholic toxic substances within multiple tissues. Multiple plants with reduced ADH1 expression exhibit increased tolerance to allyl alcohol. Thus, plants with reduced ADH1 are resistant to the toxic effects of allyl alcohol, and thus their regeneration is carried out by allyl alcohol selection.
[0810] Two mature miRNAs were selected for modification, namely miR-173 and miR-390, which have previously been shown to be expressed throughout plant development (Zielezinski A et al., BMC Plant Biology, 2015, 15:144). To introduce the modifications, a two-component system was used. First, the CRISPR / CAS9 system was used to create a cleavage in the miR-173 and miR-390 loci by designed multiple specific guide RNAs ( Figure 12A and 13A ; and Table 2 above) to facilitate homologous DNA repair (HDR) at the site. Second, a donor sequence (with the modifications required for the miRNA sequence) was introduced as a template for the HDR to target newly assigned multiple genes ( Figures 12A to 12G 、13A to 13G、14A to 14D and 15A to 15D; Table 2 above). In addition, since the secondary structure of the primary transcript (pri-miRNA) of the miRNA is important for the correct biogenesis and activity of the mature miRNA, further modifications were introduced into the complementary strand in the pri-miRNA and analyzed in mFOLD (www(dot)unafold(dot)rna(dot)Albany(dot)edu) for structural protection ( Figures 12A to 12G and 13A to 13G). A total of two guides were designed for each miRNA locus, and two different donor sequences (modified miRNA sequences) were designed for each gene ( Figures 14A to 14D and 15A to 15D, and Table 2 above).
[0811] Example 9
[0812] Bombardment and plant regeneration
[0813] Multiple GEiGS constructs were bombarded into multiple pre-prepared roots (as discussed in detail in the Materials and Experimental Procedures section above) and regenerated. Multiple plants were screened by the bleaching phenotype of multiple PDS3 transformants and the survival rate of multiple ADH1 transformants under allyl alcohol treatment. To verify the exchange compared to no exchange (i.e., retaining the wild type), these plants were subsequently screened by the insertion of multiple specific primers spanning the modified region, followed by restriction enzyme digestion ( Figure 16 ).
[0814] Example 10
[0815] Genotype verification of phenotypic selection
[0816] As described above, using well-known phenotypic traits, phytoene desaturase (PDS3), and alcohol dehydrogenase (ADH1) as multiple targets, a proof-of-concept (POC) of the gene editing system was established.
[0817] As described above, multiple plants with reduced ADH1 expression showed increased tolerance to allyl alcohol. Therefore, bombarded plants (modified miRNA targeting ADH1) were regenerated in a medium containing 30 mM allyl alcohol and their regeneration rate was compared with that of control plants. Compared with 51 control plants on allyl alcohol medium, 118 GEiGS#3+SWAP11 allyl alcohol-selected plants survived (data not shown). Among the selected GEiGS#3+SWAP11, 5 showed the inclusion of the donor (data not shown). The regeneration of a large number of plants among the plants treated with the multiple donors may also be due to transient expression during the bombardment process.
[0818] Therefore, PDS3 and ADH1 selection were carried out respectively by the bleaching phenotype ( Figure 16 ) and allyl alcohol selection ( Figure 17 ), providing an ideal method for the genotyping selection of transformed plants.
[0819] A 4-kb exchange region was evaluated mainly by the differentiation of multiple internal primers and specific amplicons of the original wild type (by the insertion of restriction enzyme digestion variations).
[0820] ADH1 ( Figure 17 ) showed that, when compared with restrictive and non-restrictive donor plasmids, allyl alcohol-selected plants had a comparative genotype with the expected donor presence restriction pattern. PDS3 ( Figure 16) shows a comparison of the phenotypes of multiple bombarded samples with and without a donor and their respective differential restriction enzyme digestion patterns when compared to restricted and non-restricted donor plasmids. These results provide a clear association between the PDS3 albino / bleached phenotype and the expected restriction pattern. Subsequently, external PCR was performed, binding specific internal and external primers (outside and specific to the genomic region) within the exchange region for exchange (data not shown). To assess the presence of heterozygotes, homozygotes, or donor exchanges, further validation of the exchanges was obtained by Sanger sequencing of the multiple PCR amplicons (data not shown).
[0821] Example 11
[0822] The modified miRNA reduces the expression of its novel target gene
[0823] To verify the potential of the multiple modified miRNAs in the GEiGS system to downregulate the expression of their newly designated multiple targets, gene expression analysis was performed using qRT-PCR (quantitative real-time PCR). RNA was extracted from the multiple positively identified regenerated plants and reverse transcribed, and compared with multiple regenerated plants, processed in parallel but without introducing the relevant multiple modified constructs. In the case of miR-173 modified to target PDS3 (GEiGS#4 + SWAP4), an average reduction of 83% in the gene expression level was observed ( Figure 18 ). In plants where miR-390 was modified to target ADH1 (GEiGS#3 + SWAP11), similar gene expression changes were observed, accounting for 82% of the control plant level ( Figure 19 ). Collectively, these results confirm the multiple gene editing method of modifying multiple endogenous miRNAs to successfully target multiple new genes and reduce their expression by replacing the target recognition sequence in the miRNA transcript at the endogenous locus.
[0824] Although the present invention has been described in connection with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the spirit and broad scope of the appended claims.
[0825] All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Additionally, the citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.
Claims
1. A method for modifying a gene encoding or being processed into a non-coding RNA molecule that does not have RNA silencing activity in a plant cell, characterized in that: The method includes: introducing a DNA editing agent into the plant cell, the DNA editing agent conferring a silencing specificity of the non-coding RNA molecule against a target RNA of interest, thereby modifying the gene encoding or being processed into the non-coding RNA molecule.
2. A method for modifying a gene encoding or to be processed into an RNA silencing molecule against a target RNA in a plant cell, characterized in that: The method includes: introducing a DNA editing agent into the plant cell, the DNA editing agent redirecting a silencing specificity of the RNA silencing molecule against a second target RNA, the target RNA and the second target RNA being different, thereby modifying the gene encoding the RNA silencing molecule.
3. The method according to claim 1, characterized in that: The gene encoding or being processed into the non-coding RNA molecule is endogenous to the plant cell.
4. The method according to claim 2, characterized in that: The gene encoding the RNA silencing molecule is endogenous to the plant cell.
5. The method according to any one of claims 1 or 3, characterized in that: The modification of the gene encoding or being processed into the non-coding RNA molecule includes: conferring the non-coding RNA molecule with at least 45% complementarity to the target RNA of interest.
6. The method according to any one of claims 2 or 4, characterized in that: The modification of the gene encoding the RNA silencing molecule includes: conferring the RNA silencing molecule with at least 45% complementarity to the second target RNA.
7. The method according to any one of claims 1, 3 or 5, characterized in that: The silencing specificity of the non-coding RNA molecule is determined by measuring an RNA or protein level of the target RNA of interest.
8. The method according to any one of claims 2, 4 or 6, characterized in that: The silencing specificity of the RNA silencing molecule is determined by measuring an RNA level of the second target RNA.
9. The method according to any one of claims 1 to 8, characterized in that: The silencing specificity of the non-coding RNA molecule or the RNA silencing molecule is determined phenotypically.
10. The method according to claim 9, wherein: The determination phenotypically is achieved by determining at least one plant phenotype selected from the group consisting of a leaf color, a flower color, a growth rate, a plant size, a crop yield, a fruit trait, a biotic stress tolerance, and an abiotic stress tolerance of the plant.
11. The method according to any one of claims 1 to 10, characterized in that: The silencing specificity of the non-coding RNA molecule is determined genotypically.
12. The method according to claim 11, characterized in that: A plant phenotype is determined before a plant genotype.
13. The method according to claim 11, wherein: A plant genotype is determined before a plant phenotype.
14. The method according to any one of claims 1 to 13, characterized in that: The non-coding RNA molecule or the RNA silencing molecule is processed from a precursor.
15. The method according to claim 14, characterized in that: The non-coding RNA molecule or the RNA silencing molecule is an RNA interference (RNAi) molecule selected from the group consisting of a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), a Piwi-interacting RNA (piRNA), and a trans-acting siRNA (tasiRNA).
16. The method according to any one of claims 1, 3, 5, 7 or 9 to 14, characterized in that: The non-coding RNA molecule is selected from the group consisting of a small nuclear RNA (snRNA), a small nucleolar RNA (snoRNA), a long non-coding RNA (lncRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a repeat-derived RNA, and a transposable element RNA.
17. The method according to claim 15, characterized in that: The RNAi molecule is designed such that a sequence of the RNAi molecule is modified to retain structural originality and to be recognized by multiple cellular RNAi factors.
18. The method according to any one of claims 1 to 17, characterized in that: The modification of the gene is achieved by a modification selected from the group consisting of a deletion, an insertion, a point mutation, and combinations thereof.
19. The method according to claim 18, wherein: The modification is in a stem region of the non-coding RNA molecule or the RNA silencing molecule.
20. The method according to claim 18, wherein: The modification is in a loop region of the non-coding RNA molecule or the RNA silencing molecule.
21. The method according to claim 18, wherein: The modification is in an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
22. The method according to claim 18, wherein: The modification is in a stem region and a loop region of the non-coding RNA molecule or the RNA silencing molecule.
23. The method according to claim 18, wherein: The modification is in a stem region, a loop region, and an unstructured region of the non-coding RNA molecule or the RNA silencing molecule.
24. The method according to any one of claims 18 to 23, characterized in that: The modification comprises a modification of up to 200 nucleotides.
25. The method according to any one of claims 18 to 24, characterized in that: The method further comprises: introducing a plurality of donor oligonucleotides into the plant cell.
26. The method according to any one of claims 1 to 25, characterized in that: The DNA editing agent comprises at least one gRNA operably linked to a plant-expressible promoter.
27. The method according to any one of claims 1 to 26, characterized in that: The DNA editing agent does not comprise an endonuclease.
28. The method according to any one of claims 1 to 26, characterized in that: The DNA editing agent comprises an endonuclease.
29. The method according to any one of claims 1 to 28, characterized in that: The DNA editing agent is a DNA editing system selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), and CRISPR.
30. The method according to any one of claims 28 or 29, characterized in that: The endonuclease comprises Cas9.
31. The method according to any one of claims 1 to 30, characterized in that: The DNA editing agent is applied to the cell in the form of DNA, RNA, or RNP.
32. The method according to any one of claims 1 to 31, characterized in that: The DNA editing agent is linked to a reporter for monitoring expression in a plant cell.
33. The method according to claim 32, characterized in that: The reporter is a fluorescent protein.
34. The method according to any one of claims 1 to 33, characterized in that: The target RNA of interest or the second target RNA is endogenous to the plant cell.
35. The method according to any one of claims 1 to 33, characterized in that: The target RNA of interest or the second target RNA is exogenous to the plant cell.
36. The method according to any one of claims 1 to 35, characterized in that: The plant cell is a protoplast.
37. A plant cell, characterized in that: The plant cell is produced by the method according to any one of claims 1 to 36.
38. A plant, characterized in that: The plant comprises the plant cell according to claim 37.
39. A method for generating a plant with reduced expression of a target gene, characterized in that: The method comprises: (a) breeding a plant according to claim 38; and (b) selecting a plurality of progeny plants having reduced expression of the target RNA of interest or the second target RNA, or selecting a progeny comprising a silencing specificity in the non-coding RNA molecule for a target RNA of interest, and the plurality of progeny plants or the progeny do not comprise the DNA editing agent, thereby producing a plant having reduced expression of a target gene.
40. The method according to claim 39, wherein: The breeding comprises hybridization or selfing.
41. A method for generating a plant having enhanced stress tolerance, increased yield, enhanced growth rate or enhanced yield quality, characterized in that: The method comprises: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the plant that is sensitive to stress, has reduced yield, reduced growth rate or reduced yield quality, thereby producing the plant.
42. A method for producing a pathogen-resistant or pathogen-tolerant plant, characterized in that: The method comprises: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the plant that is sensitive to the pathogen, thereby producing the pathogen-tolerant or pathogen-resistant plant.
43. A method for producing a pathogen-tolerant or pathogen-resistant plant, characterized in that: The method comprises: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the pathogen, thereby producing the pathogen-tolerant or pathogen-resistant plant.
44. A method for producing a pest-resistant or pest-tolerant plant, characterized in that: The method comprises: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the pest, thereby producing the pest-tolerant or pest-resistant plant.
45. A method for producing a pest-resistant or insect-resistant plant, characterized in that: The method comprises: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the plant that is sensitive to the pest, thereby producing the pest-tolerant or pest-resistant plant.
46. A method for generating a herbicide-resistant plant, characterized in that: The method comprises, for example: modifying, in a plant cell, a gene encoding or being processed into a non-coding RNA molecule or being processed into an RNA silencing molecule according to any one of claims 1 to 40, wherein the target RNA of interest is a gene of the plant that is sensitive to the herbicide, thereby producing the herbicide-resistant plant.
47. A plant, characterized in that: The plant is produced by the method according to any one of claims 39 to 46.
48. A plant according to any one of claims 38 or 47, or a method according to any one of claims 39 to 46, characterized in that: The plant is non-genetically modified (non-GMO).
49. A seed, characterized in that: The seed is from a plant according to any one of claims 38 or 47 to 48.
50. The method according to any one of claims 1 to 36, 39 to 46 or 48, the plant cell according to claim 37, the plant according to any one of claims 38 or 47 to 48, or the seed according to claim 49, characterized in that: The plant is selected from the group consisting of a crop, a flowering plant and a tree.
Citation Information
Patent Citations
Device on firing systems for heating the combustion air with the fuel gases and for the simultaneous precipitation of the fly ash
CH47742A
Semiconductor structure including monocrystalline film
CN1481578A
An RNA plant virus vector or portion thereof, a method of construction thereof, and a method of producing a gene derived product therefrom
EP0067553A2
Plant virus RNA vector
JP1988014693A
Plant genome modification using guide RNA / CAS endonuclease systems and methods of use
US20150082478A1