Method for creating high gloss cucumber material and biological material specially used for the same
By inhibiting BEC1 gene expression and utilizing CRISPR/Cas9 technology, a high-gloss cucumber variety was created, solving the problem of low efficiency in traditional breeding and achieving a significant improvement in the gloss of cucumber peel.
Patent Information
- Application Number
- CN202510343157.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2045-03-21
AI Technical Summary
Traditional breeding methods for high gloss quality are inefficient, and there is insufficient research on the genetic laws of cucumber peel gloss traits, making it difficult to directly select high gloss varieties at the molecular level.
By inhibiting BEC1 gene expression and using CRISPR/Cas9 technology for gene editing, a high-gloss cucumber variety was created. This involved an sgRNA expression cassette targeting the BEC1 gene, a recombinant vector, and host cells, and screening out BEC1 gene mutant lines.
A cucumber variety with significantly improved gloss was successfully bred, with an average gloss level of 37L or higher, which is significantly higher than the control variety, providing an efficient breeding method.
Smart Images

Figure CN120210264B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cucumber breeding, and in particular to a method for creating high-gloss cucumber materials and the specific biological materials thereof. Background Technology
[0002] Cucumber (Cucumis sativus L.), a widely cultivated vegetable in my country, not only has significant economic value but is also rich in nutrients, greatly benefiting human health. In the fresh fruit and vegetable market, cucumbers with a glossy sheen are often more favored by consumers, making it an important way to enhance their commercial value and market competitiveness.
[0003] Traditional breeding methods for high-gloss cucumbers primarily rely on hybridization and waiting for the fruit to mature before indirectly selecting genotypes or superior offspring based on phenotype. This approach is relatively inefficient. Therefore, exploring cucumber peel gloss traits at the molecular level is crucial for improving the efficiency of quality breeding and is of significant value for cultivating high-gloss cucumber varieties.
[0004] Although previous researchers have conducted in-depth studies on the related traits of cucumber fruits, research on the genetic laws of cucumber peel gloss traits is still insufficient. Summary of the Invention
[0005] In view of the shortcomings of the prior art, one of the objectives of this invention is to provide an application of a biomaterial that inhibits BEC1 gene expression.
[0006] The second objective of this invention is to provide a method for creating cucumber varieties with high gloss.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The first aspect of this invention provides the application of biological materials that inhibit the expression of the BEC1 gene in the creation of high-gloss cucumber varieties or in improving the gloss of cucumber varieties, wherein the BEC1 gene has the nucleotide sequence described in (1) or (2) below:
[0009] (1) The nucleotide sequence shown in Sequence 1 of the sequence listing;
[0010] (2) A DNA sequence that hybridizes with the nucleotide sequence described in (1) under strict conditions and has the same function as the protein encoded by the nucleotide sequence described in (1).
[0011] The stringent conditions can be: hybridization and washing of the membrane at 65°C using a solution of 0.1X SSPE (or 0.1X SSC) and 0.1% SDS.
[0012] Sequence 1 in the sequence listing is a DNA molecule composed of 2253 nucleotides, representing the genomic sequence of the BEC1 gene. Sequence 1 contains three exons: nucleotides 1-1195 form exon 1, nucleotides 1296-1483 form exon 2, and nucleotides 1993-2253 form exon 3. The nucleotide sequence formed by these three exons constitutes the coding sequence of the gene, encoding the BEC1 protein.
[0013] Research has found that the protein encoded by the BEC1 gene has the function of regulating the gloss of cucumber peel. When the function of this gene is deactivated, the gloss of cucumber peel or epidermis will be significantly increased.
[0014] The biomaterial provided by this invention, which inhibits BEC1 gene expression, can improve the gloss of wild cucumber materials, or in other words, this biomaterial can be used to create high-gloss cucumber varieties. The cucumber varieties created using the biomaterial of this invention have high gloss. High gloss, as described in this invention, refers to a statistically significant increase in gloss compared to control cucumber varieties without inhibited BEC1 gene expression; or high gloss refers to an average gloss value measured using a high-precision colorimeter of 37L or higher (e.g., 38, 40, 42, 44, 46, 48, etc.), preferably an average gloss value of 39L or higher, which is 30% higher than the control variety N62-5 (gloss measured using a high-precision colorimeter), significantly different from the control variety. The average gloss value described in this invention refers to the gloss value of the cucumber obtained by measuring at least three points on the same cucumber and taking the average value.
[0015] The cucumber variety described in this invention can be any existing cucumber variety, including commercially available cucumber varieties or those from other sources.
[0016] In the application described in the first aspect of the present invention, the biological material for inhibiting BEC1 gene expression can be a biological material for knocking out the BEC1 gene through gene editing technology, or it can be a small molecule RNA of the BEC1 gene silenced through RNA interference technology, such as miRNA, siRNA, dsRNA or shRNA, so as to disable the function of the BEC1 gene.
[0017] Furthermore, the biological material for inhibiting BEC1 gene expression includes any one of the following (a) to (c):
[0018] (a) sgRNA expression cassette, which expresses sgRNA targeting the BEC1 gene;
[0019] (b) A recombinant vector containing the sgRNA expression cassette described in (a);
[0020] (c) A host cell or host bacterium containing the sgRNA expression cassette of (a) or the recombinant vector of (b).
[0021] Furthermore, the target sequence of the sgRNA is the nucleotide sequence shown in Sequence 2 of the sequence listing, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 2 of the sequence listing.
[0022] Furthermore, the recombinant vector is based on a CRISPR / Cas9 vector and includes a Cas9 expression cassette and the aforementioned sgRNA expression cassette, wherein the Cas9 expression cassette expresses Cas9 and the sgRNA expression cassette expresses sgRNA.
[0023] The biological material can also be a transgenic cell line containing the above-mentioned recombinant vector, a host bacterium containing the above-mentioned recombinant vector, or other products that can be used for gene editing, such as Agrobacterium GV3101 containing the above-mentioned recombinant vector. Furthermore, primers used to amplify any fragment of the BEC1 gene in cucumber materials obtained after transformation by the gene editing system to screen for materials exhibiting the expected gene mutation are also within the scope of protection of this invention.
[0024] The second aspect of the present invention provides a method for creating a high-gloss cucumber variety (or a method for improving the gloss of a cucumber variety), the method comprising: using the biological material provided in the first aspect that inhibits the expression of the BEC1 gene to cause the BEC1 gene in the cucumber genome to lose its function, thereby obtaining cucumber material with improved epidermal gloss.
[0025] In the method provided in the second aspect of the present invention, the method specifically includes:
[0026] S1: The recombinant vector provided in the first aspect is introduced into cucumber material, and successfully transformed plants are obtained by screening.
[0027] S2: By identifying the BEC1 gene mutation line obtained from the successfully transformed plant, when the BEC1 gene mutation is a homozygous mutation, the obtained cucumber material is a cucumber material with improved epidermal gloss or a cucumber material with high gloss; when the BEC1 gene mutation is a heterozygous mutation, step S3 is also included.
[0028] S3: Self-pollinate cucumber materials with heterozygous mutations in the BEC1 gene, and then identify cucumber materials with homozygous mutations in the BEC1 gene from the self-pollinated offspring, i.e. cucumber materials with improved epidermal gloss or cucumber materials with high gloss.
[0029] Furthermore, the identification mentioned in step S2 refers to: using the genome of a successfully transformed plant as a template for PCR amplification, and then detecting the mutation of the BEC1 gene by gel electrophoresis or sequencing.
[0030] Furthermore, the identification mentioned in step S3 refers to: using the genome of self-pollinated progeny plants as a template for PCR amplification, and then detecting it by gel electrophoresis or sequencing to obtain lines with homozygous mutations in the BEC1 gene.
[0031] Furthermore, the nucleotide sequences of the primer pairs used for PCR amplification are shown in sequences 5 and 6 of the sequence listing.
[0032] Compared with the prior art, the present invention has the following beneficial effects:
[0033] First, the inventors discovered that the BEC1 gene has the function of regulating the gloss of cucumber skin. Therefore, this invention inhibits the expression of the BEC1 gene in cucumber to disable its function, thereby obtaining a cucumber variety with high gloss. The study of this molecular mechanism has important theoretical and practical significance for cucumber breeding.
[0034] Secondly, the method for creating high-gloss cucumber varieties provided by this invention can create the BEC1 mutant, successfully cultivating a high-gloss cucumber variety. The experiment employed CRISPR / Cas9 technology for gene editing, involving steps such as target design and oligo sequence synthesis, vector construction, obtaining the T0 generation bec1 mutant, and PCR identification to obtain the T1 generation bec1 mutant, ultimately yielding the bec1 mutant with a frameshift mutation. Compared to the control variety, the bec1 mutant fruit exhibited higher gloss, which was also confirmed by measurements using a high-precision colorimeter. The successful application of this technology provides a new breeding strategy for enhancing the commercial value of cucumbers. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of the BEC1 gene editing vector.
[0036] Figure 2 Sequencing results for the bec1 mutant.
[0037] Figure 3 The results show the fruit peel phenotype and gloss detection results for the bec1 mutant and the control N62-5. (a) is a photograph of the fruit peel phenotype; (b) is a bar chart of gloss data measured by a high-precision colorimeter, with the vertical axis representing the gloss of the fruit. Detailed Implementation
[0038] The present invention will be described and explained in detail below through specific embodiments. These embodiments are only used to explain the technical features or solutions of the present invention and do not constitute a limitation on the technical solutions of the present invention. Simple modifications made by those skilled in the art based on the present invention also fall within the protection scope of the present invention.
[0039] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (2nd Edition, by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or as recommended by the manufacturer.
[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0041] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.
[0042] Experimental materials
[0043] The cucumber variety used in this experiment was N62-5, a low-gloss cucumber variety with an average epidermal gloss of 32L, supplied by the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences. The CRISPR / Cas9 vector used was from Hangzhou Baige Biotechnology Co., Ltd., product number BGK03.
[0044] The culture medium formula is as follows:
[0045] (1) MS medium (solution): contains 4.43 g / L MS powder, 30 g / L sucrose, and 2.5 g / L plant gel (MS culture medium does not contain this component), and the pH value is maintained between 5.7 and 5.8.
[0046] (2) MS differentiation medium: 0.5 mg / L of 6-BA and 1 mg / L of ABA were added to the MS medium.
[0047] (3) MS resistance differentiation medium: The composition is the same as MS differentiation medium.
[0048] (4) MS rooting medium: The composition is the same as that of MS medium.
[0049] (5) 1 / 2MS liquid medium: containing 2.2 g / L MS powder, 30 g / L sucrose, and pH maintained at 5.7 to 5.8.
[0050] In addition, the TPS buffer consists of 100 mM Tris-HCl at pH 8.0, 10 mM EDTA at pH 8.0, and 1 M KCl.
[0051] This invention, through functional analysis, discovered that the protein BEC1, obtained after transcription and translation of the BEC1 gene shown in Sequence 1, can regulate the gloss of cucumber skin. When the expression of the BEC1 gene is inhibited or the gene is knocked out, the gloss of cucumber skin is significantly improved compared to the wild type. For details, please refer to [link to relevant documentation]. Figure 3 .
[0052] Example 1: Obtaining the sequence of the BEC1 gene
[0053] The BEC1 gene sequence can be obtained from http: / / www.cucumberdb.com / # / home. The genomic sequence of the BEC1 gene is shown in Sequence 1 of the sequence listing.
[0054] Example 2 Construction of recombinant vector
[0055] 1. Target design and oligo sequence synthesis
[0056] Using the DNA sequence in Sequence 1, target design was performed on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html), and the target sequence CATTCTGCAGAATTAAGGGATGG (Sequence 2) was obtained.
[0057] Subsequently, following the instructions of the CRISPR / CAS9 vector construction kit (BGK03), two Oligo sequences were successfully synthesized, as follows:
[0058] Oligo-1:5'-TGTGTGCATTCTGCAGAATTAAGGGATGG-3' (sequence 3);
[0059] Oligo-2: 5'-AAACCCATCCCTTAATTCTGCAGAATGCA-3' (sequence 4).
[0060] 2. Construction of recombinant vector for cucumber gene editing BEC1
[0061] (1) Preparation of oligo dimer: Take 1 μL of each of 10 μM oligo-1 and Oligo-2 solutions, add 18 μL of Buffer Aneal, mix well, heat at 95 °C for 3 min, and then cool down to 20 °C at a rate of 0.2 °C / s.
[0062] (2) Construction of recombinant vector: Take 1 μL oligo dimer, 2 μL CRISPR / Cas Vector, 1 μL BsaIEnzyme Mix, add ddH2O to 10 μL, and react at 20℃ for 1 h.
[0063] (3) Transformation: Add 5 μL of the reaction solution from step (2) to Trans1-T1 Escherichia coli competent cells, incubate on ice for 30 min, then heat shock at 42°C for 45 s, and immediately incubate on ice for 2 min. Add 700 μL of antibiotic-free LB medium and revive at 37°C and 200 rpm for 1 h.
[0064] (4) Screening: The clones were plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Single clones were selected for sequencing verification, successfully constructing the BEC1 gene editing vector. Partial structure of the vector is shown below. Figure 1 As shown.
[0065] Example 3: Obtaining T0 generation regenerated plants
[0066] 1. Seed disinfection and sowing
[0067] Select plump cucumber N62-5 seeds, disinfect them with 70% alcohol for 30 seconds, and then soak them in 2.0% sodium hypochlorite solution for 15 minutes for sterilization. Afterward, rinse thoroughly with sterile water and sow on MS medium. Wait 2 to 3 days until the cotyledons emerge before proceeding to the next step.
[0068] 2. Preparation of Agrobacterium
[0069] Take 1 μg of the recombinant vector prepared in Example 2 and place it in 100 μL of GV3101 competent cells. Quick-freeze in liquid nitrogen for 3 minutes, then incubate at 37°C for 5 minutes. Pick a single colony of Agrobacterium carrying the recombinant plasmid and inoculate it into YEB medium containing 50 mg / L kanamycin and 70 mg / L rifampin. Incubate overnight at 28°C and 200 rpm with shaking. Then, add 2 mL of the bacterial culture to 50 mL of YEB medium containing the same antibiotic concentration and continue incubating with shaking for approximately 14 hours until late logarithmic growth is achieved, with an OD600 value between 0.6 and 0.8. Next, collect the bacterial cells by centrifugation at 5000 rpm for 5 minutes. Wash the bacterial cells once with 1 / 2 MS liquid medium and dilute to 5 times the original bacterial volume, ensuring an OD600 value of approximately 0.2, for subsequent infection.
[0070] 3. Infection Operation
[0071] Select cucumber seeds that have grown for 2 days, remove the growing point and hypocotyl, and simultaneously remove the upper half (approximately 1 / 2 to 1 / 3) of both cotyledons, retaining the lower half. Infect the cotyledons with the diluted bacterial solution from the previous step for 15 minutes. After infection, gently blot away excess bacterial solution with sterile filter paper, and place the cotyledon pieces face down on differentiation medium. Incubate in the dark at 28°C for 2 days.
[0072] 4. Resistance screening and cultivation
[0073] After two days of co-culture, the explants were transferred to MS differentiation medium containing 25 mg / L kanamycin and 500 mg / L carbenicillin and placed in a tissue culture room for further culture. After approximately 15 to 20 days, when the resistant shoots grew to 1 to 1.5 cm in length, they were cut off and transferred to MS rooting medium containing 100 mg / L kanamycin to induce rooting, thereby obtaining resistant plants.
[0074] 5. Transplanting and Management
[0075] Once the root system of the transgenic cucumbers was fully developed (with 5 to 6 leaves), they were transplanted into pots filled with sterile soil. They were covered with plastic wrap to retain moisture and cultured in a climate chamber for one week. Afterward, the plants were moved to a greenhouse for a 3-5 day acclimatization period, and finally managed according to standard methods. Ultimately, two transgenic seedlings were obtained.
[0076] Example 4: PCR identification of T1 generation bec1 mutant
[0077] 1. Obtain the T1 generation bec1 mutant
[0078] The T0 generation transgenic seedlings obtained in Example 3 were self-pollinated, and T1 generation seeds were successfully harvested. After germination treatment, these seeds were cultivated in 32-cell trays with dimensions of 540*280mm to grow T1 generation plants.
[0079] 2. Extracting DNA from T1 generation plants
[0080] Approximately 0.5 g of sample was taken from the T1 generation plants and N62-5 leaves and placed into a 2 mL centrifuge tube. TPS was added as the DNA extraction buffer. To improve extraction efficiency, two 4 mm diameter steel beads were added to the centrifuge tube, and the DNA was extracted using an ultra-high throughput grinder. The mixture was then centrifuged at 10,000 rpm for 2 minutes. 20 μL of the supernatant was transferred to a new centrifuge tube, and 180 μL of deionized water was added, ensuring thorough mixing.
[0081] 3. PCR identification yielded the bec1 mutant.
[0082] Using the extracted DNA as a template, PCR amplification was performed using BEC1-specific primers. The selected primer sequences are as follows:
[0083] Forward primer F: 5'-TAGGCTCAATTGCCTTCGCA-3' (sequence 5);
[0084] Reverse primer R: 5'-GGAAAGCAAGCAACAGTAAGAGG-3' (sequence 6).
[0085] PCR reaction program: 94℃ pre-denaturation for 5 min; 35 cycles of 94℃ for 30 s, 55℃ for 15 s, and 72℃ for 30 s; final extension at 72℃ for 7 min. PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing.
[0086] Sequencing results showed that... Figure 2 As shown:
[0087] bec1-1 mutant: BEC1 coding region +730 CT deletion, resulting in a frameshift mutation, and is a homozygous mutant.
[0088] bec1-2 mutant: The BEC1 coding region at position +733 lacks AATT, resulting in a frameshift mutation, and it is a homozygous mutant.
[0089] Phenotypic observation and brightness measurement of the two bec1 mutants mentioned above
[0090] The aforementioned bec1-1 and bec1-2 mutants were cultured in 32-cell trays until they developed four true leaves, and then transplanted to the greenhouse of the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences for observation and recording of plant phenotypic characteristics. Visual observation revealed that the fruits of the two bec1 mutants exhibited a higher gloss compared to the control variety N62-5. Specific results are as follows... Figure 3 As shown in (a).
[0091] To more accurately quantify the brightness of the fruit peel, we used a high-precision colorimeter (NR-200, manufactured by Guangdong Sanenshi Technology Co., Ltd.) for measurement. A relatively flat area was selected on the fruit surface, and the colorimeter automatically compared the difference between the standard sample and the measured object, directly outputting the L, a, and b parameter values in the "CIELAB" color space. These values were then used to determine the color and brightness. To ensure data accuracy, we measured each fruit at three different locations, repeating the experiment three times. The results showed that the brightness of the bec1 mutant was significantly higher than that of the control variety N62-5. Figure 3 As shown in (b).
Claims
1. Inhibition BEC1 The application of gene-expressing biological materials in creating high-gloss cucumber varieties or in improving the gloss of cucumber varieties, the aforementioned BEC1 The nucleotide sequence of the gene is shown in Sequence 1 of the sequence listing; The inhibition BEC1 Gene expression in biological materials is knocked out using gene editing technology. BEC1 Genes, so that the BEC1 Gene function failure.
2. The application according to claim 1, characterized in that, The inhibition BEC1 Biological materials for gene expression include any one of the following (a) to (c): (a) sgRNA expression cassette, which targets BEC1 sgRNA of a gene; (b) A recombinant vector containing the sgRNA expression cassette described in (a); (c) A host cell or host bacterium containing the sgRNA expression cassette of (a) or the recombinant vector of (b).
3. The application according to claim 2, characterized in that, The target sequence of the sgRNA is the nucleotide sequence shown in Sequence 2 of the sequence listing, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 2 of the sequence listing.
4. The application according to claim 2, characterized in that, The recombinant vector includes a Cas9 expression cassette and the sgRNA expression cassette of claim 2 or 3, wherein the Cas9 expression cassette expresses Cas9.
5. The application according to claim 2, characterized in that, The term "high gloss" refers to the gloss level relative to unsuppressed gloss. BEC1 For control cucumber varieties with high gloss, the gloss level is statistically significantly improved; or high gloss level refers to an average gloss level of 37 L or higher as measured by a high-precision colorimeter.
6. The application according to claim 5, characterized in that, The high gloss refers to an average gloss value of 39 L or higher, measured using a high-precision colorimeter.
7. A method for creating a high-gloss cucumber variety, characterized in that, The method includes: using the biological material described in any one of claims 1-6 to induce the cucumber genome... BEC1 By losing gene function, cucumber materials with improved skin gloss were obtained.
8. The method according to claim 7, characterized in that, The method specifically includes: S1: Introduce the recombinant vector described in any one of claims 2-4 into cucumber material, and obtain successfully transformed plants by screening; S2: Obtained by identifying the successfully transformed plants BEC1 When a gene mutation occurs in a strain, BEC1 When the gene mutation is homozygous, the resulting cucumber material is either cucumber material with improved skin gloss or cucumber material with high gloss; when BEC1 When the gene mutation is a heterozygous mutation, step S3 is also included; S3: Will BEC1 Cucumber materials with heterozygous mutations were self-crossed, and then the offspring were identified. BEC1 Cucumber materials with homozygous gene mutations are cucumber materials with improved skin gloss or cucumber materials with high gloss.
9. The method according to claim 8, characterized in that, The identification mentioned in step S2 refers to: using the genome of a successfully transformed plant as a template for PCR amplification, and then detecting it by gel electrophoresis or sequencing to obtain... BEC1 A strain with a gene mutation.
10. The method according to claim 9, characterized in that, The nucleotide sequences of the primer pairs used for PCR amplification are shown in sequences 5 and 6 of the sequence listing.
Citation Information
Patent Citations
Cucumber CsLsi2 gene, protein coded by same and application of cucumber CsLsi2 gene
CN110669771A
Method for creating cold-resistant cucumber germplasm through site-directed mutagenesis
CN118006669A