Reagent and kit for detecting Mhm type nucleic acid of feline mycoplasma and application of reagent and kit

By designing a combination of primer probes with high specificity for fluorescence quantitative PCR detection, the problem of low specificity of Mhm-type detection results of cat hemothyroid Mycoplasma cat in the prior art is solved, and the detection effect of high specificity and high sensitivity is achieved.

CN120210394APending Publication Date: 2025-06-27GUANGDONG RUNPENG BIOLOGICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311817827.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-26
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The detection results of Mhm type of cat hemothyroid Mycoplasma in the prior art are low, resulting in false positives in negative samples, and the amplification Ct value is low and the linearity is poor.

Method used

By comparing the whole genome sequence of Mhm-type pathogen of cat hemothyroid, finding its conserved regions, and designing a combination of high specific primer probes for fluorescence quantitative PCR detection.

Benefits of technology

The specificity and sensitivity of Mhm type detection of cat hemothyroid Mycoplasma was improved, the false positive problem of negative samples was solved, and the linear performance was good under different concentration gradient templates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004634917910000061
    Figure BDA0004634917910000061
  • Figure HDA0004634918240000011
    Figure HDA0004634918240000011
  • Figure HDA0004634918240000012
    Figure HDA0004634918240000012
Patent Text Reader

Abstract

The invention provides a reagent and a kit for detecting feline mycoplasma Mhm type nucleic acid and application of the reagent and the kit. The reagent comprises a first region for detecting the Mhm type of the feline mycoplasma, and the first region is selected from any fragment in SEQ ID NO: 1. By applying the reagent or the kit provided by the invention, the Mhm type identification of the feline mycoplasma can be sensitively and accurately realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of detection of Mycoplasma haemofelis Mhm type. Specifically, it relates to a reagent, a kit for detecting Mycoplasma haemofelis Mhm type nucleic acid, and their applications. Background Art

[0002] Veterinarians often encounter cases of feline anemia during clinical treatment. In such cases, feline infectious anemia (FIA), especially regenerative anemia, needs to be considered. Mycoplasma infection is a common cause of anemia in domestic cats. These pathogens parasitize on the surfaces of animal red blood cells, plasma, bone marrow and other parts, and are obligate blood diseases. Mycoplasma haemofelis can infect feline red blood cells and is transmitted through infected cat bites or flea and tick bites. The less common mode of transmission is through blood transfusion. The prognosis of feline infectious anemia depends on the severity of the clinical symptoms. Cats with only mild symptoms generally recover well. The prognosis for more severely infected cases is cautious, and some cats may even die as a result. Although there is no relevant vaccine currently, the disease can be well prevented by regularly de-fleaing and keeping cats indoors.

[0003] Mycoplasma hemofelis belongs to the genus Mycoplasma, and is also called Hemobartonella felis, Mycoplasma haemofelis, and Bartonella felis. Mycoplasma hemofelis, Mycoplasma felis, and Bartonella henselae are different bacteria. Mycoplasma felis is a pathogen of the upper respiratory tract, and Bartonella henselae causes cat scratch fever.

[0004] Mycoplasma haemofelis, also known as Hemobartonella felis, is one of the main pathogens causing feline hemolytic anemia. The latest research shows that there are three types of Mycoplasma that can infect cats: the Ohio strain (Mycoplasma haemofelis, Mhf), the California strain (Mycoplasma haemominutum, Mhm, also called provisional species Mycoplasma haemominutum), and the Swiss Zurich variant (Mycoplasma turicensis, Mtc, also called provisional species Mycoplasma turicensis) are the main strain types of Mycoplasma haemofelis. Among them, the Ohio strain causes the most severe symptoms after infection, has strong pathogenicity, and common characteristics such as fever, anemia, and dehydration. The pathogenicity of the California strain is weak, but the carriage rate in cats is relatively high. The symptoms after infection with the Swiss Zurich variant are relatively mild, and the prevalence is low, mostly seen in mixed infections.

[0005] Among them, the Ohio strain is the rarest and most pathogenic. It is larger and easier to see on blood smears, and may cause moderate to severe anemia, namely the so-called "feline infectious anemia". It is reported that when cats are co-infected with FeLV and / or FIV, the anemia will be more severe. Candidatus Mycoplasma haemominutum (tentative species, blood small mycoplasma) seems to be more common but less pathogenic. It is smaller and more difficult to detect on blood smears. Usually, cats have no clinical symptoms and no anemia after infection. However, if the cat is immunosuppressed or co-infected with FeLV or FIV, anemia may occur. Candidatus Mycoplasma turicensis (tentative species, Zurich mycoplasma) is a newer hemoplasma found in a group of Swiss cats and has also been reported in cats in South Africa, the UK, and Australia. Its prevalence is very low. Similar to Mycoplasma haemofelis, it may cause mild anemia when co-infected with other hemoplasmas or immunosuppressed.

[0006] Haemoplasma disease is a zoonotic infectious disease mainly characterized by anemia, jaundice, fever, etc., caused by different host Haemoplasmas. This disease is widely distributed and has spread to dozens of countries in Europe, Asia, Africa, and the Americas, as well as dozens of animals and humans. In China, since Jin Ximing (1981) first discovered Haemoplasma in rabbits, Haemoplasma has been found in animal and human cases of rabbits, cattle, sheep, pigs, dogs, cats, monkeys, etc. in more than 20 provinces, municipalities, and autonomous regions.

[0007] The anemia experienced by cats may be mild and may not cause any obvious signs. Many cases of feline hemoplasma infection in cats go undetected. Some of these subclinical cats remain long-term carriers of the disease and transmit the disease to other cats. If another disease or condition reduces the cat's immunity, feline hemoplasma may become clinically apparent. The occurrence of this disease has no breed or gender preference, but male cats are more likely to occur in infected populations, which may be related to the different lifestyles of male and female cats. The typical change caused by pathogenic feline hemoplasma is acute and even life-threatening anemia.

[0008] If many red blood cells are destroyed, symptomatic anemia will occur. The mucous membranes, which are easily observed in the inner layer of the conjunctiva of the eyes and gums, will turn pale to white. If jaundice accompanies anemia, the membranes may be yellow. Due to the decreased oxygen-carrying capacity of the blood, cats may quickly become fatigued, weak, and drowsy, and may lose weight. Other signs may include fever, enlargement of the spleen or lymph nodes, and an increase in heart rate and respiratory rate. Summary of the Invention

[0009] The main purpose of the present application is to provide a reagent, a kit and their applications for detecting the nucleic acid of Mycoplasma haemofelis Mhm type, so as to solve the problem of low specificity of the detection results of Mycoplasma haemofelis Mhm type in the prior art.

[0010] To achieve the above object, according to the first aspect of the present application, there is provided a reagent for detecting the first region of the nucleic acid of Mycoplasma haemofelis Mhm type, and the first region is selected from any fragment in SEQ ID NO: 1.

[0011] Further, the first region is selected from any fragment between the (1-13)-(86-112)th bases in SEQ ID NO: 1.

[0012] Further, the above reagent includes a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22-28 consecutive nucleotides between the (1-13)-(86-112)th bases in SEQ ID NO: 1.

[0013] Further, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 5; preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 2 is 5'-CATAATATTTGTGGGAAGGTGCACTA-3', SEQ ID NO: 5 is 5'-AGATCCCAGTGAGCTGAGAATAGATG-3', and SEQ ID NO: 6 is 5'-CATGTTGGCCTCCCGCTCCGC-3'.

[0014] Further, the 5' end and the 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, AlexaFluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; more preferably, the 5' end of the probe is a ROX group and the 3' end is a BHQ group.

[0015] To achieve the above object, according to the second aspect of the present application, there is provided a kit, and the kit includes any of the above reagents for detecting the nucleic acid of Mycoplasma haemofelis Mhm type in a test sample.

[0016] Further, the kit further includes at least one of the following: qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5 U / μL.

[0017] According to the third aspect of the present application, there is provided a method for detecting Mycoplasma haemofelis Mhm type by fluorescence quantitative PCR, and fluorescence quantitative PCR detection is performed using any one of the above reagents or any one of the above kits.

[0018] Further, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30 s-90 s; denaturation treatment at 92-98°C for 2-8 s, annealing at 58-62°C for 20-40 s and collecting fluorescence signal processing, for a total of 40-44 cycles.

[0019] According to one aspect of the present application, there is provided the application of any one of the above reagents or kits in the detection of Mycoplasma haemofelis Mhm type.

[0020] By applying the technical solution of the present application, the reagent for detecting Mycoplasma haemofelis Mhm type nucleic acid of the present application has high specificity for Mycoplasma haemofelis Mhm type and also has high sensitivity. Therefore, compared with the existing detection reagents, it has significant advantages of sensitivity and accuracy in the identification of Mycoplasma haemofelis Mhm type. Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application and should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0022] Figure 1 Amplification curves for negative verification of different primer sets synthesized;

[0023] Figure 2 Amplification curves for specificity verification of different primer sets synthesized;

[0024] Figure 3 Amplification curve of the F1R1P1 primer set in the primer combination screening experiment;

[0025] Figure 4 Amplification curve of the F1R1P1 primer set in the primer combination screening experiment;

[0026] Figure 5 Amplification curve of the F1R1P1 primer set in the primer combination screening experiment;

[0027] Figure 6 The amplification curve of the F1R1P1 primer set in the primer combination screening experiment;

[0028] Figure 7 Specificity verification of the optimal primer set;

[0029] Figure 8 Performance comparison between the self-developed reagent and the competitor's reagent. Detailed implementation manners

[0030] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments may be combined with each other. The present application will be described in detail below with reference to the embodiments.

[0031] As mentioned in the background art, in the current prior art, for the specific primer-probe designed for the Mycoplasma haemofelis Mhm type pathogen, directly using the target gene reported in the literature patent is likely to have the situation of false positives in negative samples. At the same time, when using clinical samples for testing, its amplification Ct value is generally low and the linearity is not optimistic. In view of the above situation, the present application selects to compare the whole genome sequence of the Mycoplasma haemofelis Mhm type pathogen, searches for its conserved region, and after comprehensive comparison, finally selects a conserved sequence segment for the design of the primer-probe. After multiple tests and verifications, it solves the problem of false positives in negative samples. At the same time, under different concentration gradients of the template, its linearity is good. Based on the above research results, the applicant proposes a series of technical solutions of the present application.

[0032] In a first typical implementation manner, a reagent for detecting the first region of Mycoplasma haemofelis Mhm type nucleic acid is provided, and the first region is selected from any fragment in SEQ ID NO: 1.

[0033] Applying the technical solution of the present application can accurately detect Mycoplasma haemofelis Mhm type.

[0034] Due to the uniqueness of the above first region, thus selecting any fragment of any length from it for detection can achieve highly specific detection of Mycoplasma haemofelis Mhm type. To further improve the specificity and sensitivity of the detection, in some preferred embodiments, the first region is selected from any fragment between the (1-13)-(86-112)th bases in SEQ ID NO: 1.

[0035] For any fragment of any length in the above two regions, appropriate primers or primer-probe combinations can be designed for detection. In some preferred embodiments, the reagent includes a primer pair for detecting the nucleic acid sequence of SEQ ID NO: 1. The primer pair includes an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22-28 consecutive nucleotides between positions (1-13)-(86-112) in SEQ ID NO: 1.

[0036] In some more preferred embodiments, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 4; preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 2 is 5'-CATAATATTTGTGGGAAGGTGCACTA-3', SEQ ID NO: 5 is 5'-AGATCCCAGTGAGCTGAGAATAGATG-3', and SEQ ID NO: 6 is 5'-CATGTTGGCCTCCCGCTCCGC-3'.

[0037] A set of primer-probe combinations of the present application has the advantages of high specificity, high sensitivity, and high detection accuracy in the detection of Mycoplasma haemofelis Mhm type.

[0038] In the above primer-probe combination, the 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group. Having a fluorescent reporter group and a fluorescent quenching group facilitates accurate detection by fluorescence quantitative PCR. Therefore, any group that can emit fluorescence and absorb fluorescence of the corresponding wavelength is applicable to the present application.

[0039] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7.; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse. When the above fluorescent reporter group and fluorescent quenching group are specifically used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength that can absorb fluorescence.

[0040] Considering the cost, effect, wide range of applications and convenience, in some more preferred embodiments, the 5' end of the above probe is selected with the ROX group, and the 3' end is selected with the BHQ group (specifically, it can be BHQ1, BHQ2 or BHQ3).

[0041] In the second typical embodiment of the present application, a kit is provided, and the kit includes any one of the above reagents. Using this kit for the detection of Mycoplasma haemofelis Mhm type has the advantages of strong specificity, high sensitivity, low cost, and simple operation.

[0042] To further improve the convenience of the detection of this kit, in some preferred embodiments, the above kit further includes at least one of the following: qPCR premix, and the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase. Preferably, the concentration of AK Taq DNA polymerase is 5 U / μL. A specific qPCR buffer can be selected from existing known products for application. Details are not described here. It should be noted that the DNA polymerase used in this qPCR premix is AK Taq DNA polymerase produced by PhyNexus, and the use of other DNA polymerases with similar effects is not excluded here.

[0043] The positive control product in the kit is usually a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the above positive control product is a gene fragment containing 89 bp of Mycoplasma haemofelis Mhm type, and this gene fragment is as shown in SEQ ID NO: 1.

[0044] SEQ ID NO: 1:

[0045] CATAATATTTGTGGGAAGGTGCACTATTCTAACTGCAGATTCTGTTTTATTTACATGTTGGCC TCCCGCTCCGCTTGCCCTATAAACATCTATTCTCAGCTCACTGGGATCT;

[0046] The negative control product in the kit is a plasmid without the target gene fragment and is a control that will not amplify the target fragment. Preferably, the negative control product is deionized water.

[0047] In the third typical embodiment, a method for fluorescence quantitative PCR detection of Mycoplasma haemofelis Mhm type is provided, and this method includes performing fluorescence quantitative PCR detection using the above primer-probe composition or the above kit.

[0048] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92 - 98 °C (preferably 95 - 98 °C) for 30 s - 90 s (preferably 30 s - 60 s); denaturation treatment at 95 - 98 °C for 2 - 8 s (preferably 2 - 5 s), annealing or fluorescence signal collection and processing at 58 - 62 °C (preferably 59 - 61 °C) for 20 - 40 s (preferably 25 - 35 s), and a total of 40 - 44 cycles are performed.

[0049] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are as follows: pre-denaturation at 95°C for 1 min; denaturation treatment at 95°C for 5 s, annealing at 60°C for 30 s or collecting fluorescence signal for processing, and a total of 42 cycles are carried out.

[0050] In the fourth typical embodiment, the application of the above reagent or the above kit in the detection of Mycoplasma haemofelis Mhm type is provided. By applying the primer or primer-probe combination capable of identifying Mycoplasma haemofelis Mhm type, the present application can amplify the target fragment in clinical samples, and can quickly, efficiently, sensitively and accurately identify Mycoplasma haemofelis Mhm type.

[0051] The beneficial effects of the present application will be further explained in detail below in conjunction with specific embodiments. It should be noted that the primers in the following embodiments are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all from commercially available products.

[0052] Example 1 Primer and Probe Design

[0053] In the present application, the whole genome sequences of Mycoplasma haemofelis Mhm type pathogens are selected for comparison, and their conserved regions are searched, and primers and probes are designed using these regions. During the primer design process, Primer Express 3.0.1 software is used for the design and evaluation of primers and probes. The evaluation criteria mainly include: length, Tm value, GC content, hairpin structure, internal dimer of primers, dimer between primers, and formation of mismatches. After the design of primers and probes is completed, a comparison analysis is carried out on the NCBI online Blast database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogenic bacteria. The primer and probe information is shown in Table 1.

[0054] Table 1 Primer and Probe Sequence Information for Real-time Fluorescent Quantitative PCR Detection of Mycoplasma haemofelis Mhm Type

[0055] Serial number Name Sequence SEQ ID NO: 2 Mhm-F1 CATAATATTTGTGGGAAGGTGCACTA SEQ ID NO: 3 Mhm-F2 GGGAAGGTGCACTATTCTAACTGC SEQ ID NO: 4 Mhm-R1 CCCAGTGAGCTGAGAATAGATGTTT SEQ ID NO: 5 Mhm-R2 AGATCCCAGTGAGCTGAGAATAGATG SEQ ID NO: 6 Mhm-P1 CATGTTGGCCTCCCGCTCCGC

[0056] Example 2 Negative and Specificity Verification of Primers and Probes

[0057] DEPC water is used as a template for negative verification, and at least 20 replicates are set to verify whether there is amplification. If there is no amplification, it initially indicates good specificity.

[0058] At the same time, clinical samples containing multiple determined pathogens such as Bartonella henselae, feline leukemia virus, feline immunodeficiency virus, and Bordetella bronchiseptica are used as templates for specificity verification to detect whether only Mycoplasma haemofelis Mhm type can be amplified. If only Mycoplasma haemofelis Mhm type has amplification, it indicates that the primer and probe have good specificity.

[0059] Use the nucleic acid extraction reagent produced by Feipeng to extract nucleic acid, and prepare the qPCR amplification system according to Table 2. Among them, the amplification system is 25 μL, and the 2×Mix and Taq enzyme in the configuration table are self-produced raw materials developed by Feipeng Biology. Perform qPCR amplification using the procedure in Table 3, and the instrument is the ABI 7500 instrument.

[0060] Table 2 qPCR Amplification System for Mycoplasma haemofelis Mhm Type

[0061] Serial number Name Concentration Volume (μL) 1 2× Mix 2× 12.5 2 AK-Taq (without glycerol) 25 U / μL 0.1 3 Forward primer F 50 μM 0.125 4 Reverse primer R 50 μM 0.125 5 Probe P 50 μM 0.0625 6 Template / 5 7 Water / 7.0875

[0062] Table 3 Real time PCR Amplification Procedure

[0063]

[0064] The results are as Figure 1 shown. After freely combining 2 upstream primers and 2 downstream primers respectively, 4 primer-probe combinations are obtained. Using DEPC water as the template, there is no amplification in the negative control. At the same time, using a variety of determined samples as templates, only Mycoplasma haemofelis Mhm type is detected, indicating that the 4 primer-probe combinations designed for the conserved region have good specificity ( Figure 2 ).

[0065] Example 3 Screening of the Optimal Primer Combinations

[0066] To further verify the effectiveness of different combinations of primers designed based on the conserved regions found by whole-genome alignment, use the synthetic plasmid of Mycoplasma haemofelis Mhm type as the template and dilute it in 6 concentration gradients at a 10-fold gradient. Amplify according to the system in Table 2 and the procedure in Table 3 on the ABI 7500 instrument.

[0067] The results are as Figures 3 - 6 shown in Table 4. There are 4 combinations of primers and probes for Mycoplasma haemofelis Mhm type, namely F1R1P1, F1R2P1, F2R1P1, and F2R2P1. When using the plasmid for amplification, these 4 combinations can all detect the plasmid of Mycoplasma haemofelis Mhm type at least in 5 concentration gradients. Among them, except for F1R1P1, the other combinations can detect templates in 6 concentration gradients and their Ct values are basically the same at the same concentration gradient template; at the same time, from the perspective of linearity, the combination F1R2P1 is the best, followed by the F2R1P1 and F2R2P1 combinations, and finally the F1R1P1 combination.

[0068] Table 4 Ct Values of Amplification for Screening of the Optimal Primer Combinations

[0069] Dilution factor F1R1P1 F1R2P1 F2R1P1 F2R2P1 <![CDATA[1×10 5 > 23.65 23.48 23.96 23.93 <![CDATA[1×10 6 > 27.95 27.43 27.98 27.74 <![CDATA[1×10 7 > 30.61 30.75 30.97 30.88 <![CDATA[1×10 8 > 33.87 33.76 33.97 34.05 <![CDATA[1×10 9 > 36.96 36.67 37.76 37.56 <![CDATA[1×10 10 > Un 37.25 36.70 38.97

[0070] Example 4 Verification of the Negative Samples of the Optimal Primer Set

[0071] To avoid detecting Mycoplasma haemofelis - like species, using Mycoplasma haemocanis clinical samples as templates, nucleic acids of Mycoplasma haemofelis Mhm type and Mycoplasma haemocanis clinical samples were simultaneously extracted. A qPCR amplification system was prepared according to the system in Table 2 above, and amplification was performed on the same instrument according to the procedure in Table 3. The results are as follows Figure 7 shown. Using nucleic acids of Mycoplasma haemofelis Mhm type and Mycoplasma haemocanis clinical samples simultaneously, only Mycoplasma haemofelis Mhm type was detected, while Mycoplasma haemocanis was not detected, and the Ct value of the detected Mycoplasma haemofelis Mhm type was 23.65. The above indicates that this optimal combination will not detect Mycoplasma haemofelis - like species, that is, there is no problem of non - specific amplification, and it further shows that the primer set has good specificity.

[0072] Example 5 Performance Comparison between Self - developed Kit and Competing Products

[0073] To further verify the specificity and sensitivity of the optimal primer - probe combination, one high - concentration clinical sample of Mycoplasma haemofelis Mhm type was selected respectively. An optimal primer - probe combination screened in Example 2 was used to prepare a qPCR amplification system according to Table 3, and it was freeze - dried in all components. The competing product was the Phyllostachys bambusoides Cat Anemia Four - item Fluorescent PCR Detection Kit (Dry Type) (Product Number: GZP055).

[0074] Results Figure 8 shown. Using the Mycoplasma haemofelis Mhm type sample as a template, the self - developed freeze - dried reagent could detect its positivity well, with a Ct value of 17.65. Under the same amplification conditions, the Ct value of the Mycoplasma haemofelis Mhm type clinical sample detected by using the competing product's freeze - dried reagent was 18.96, lagging behind the self - developed Mycoplasma haemofelis Mhm type freeze - dried reagent by about 1 Ct. At the same time, the fluorescence intensity of the self - developed reagent was significantly better than that of the competing product. Therefore, the performance of the self - developed Mycoplasma haemofelis Mhm type amplification reagent is good and superior to the competing product detection reagent.

[0075] In summary, the performance of the self - developed Mycoplasma haemofelis Mhm type amplification reagent is good and superior to the competing product detection reagent. From the above description, it can be seen that the above - mentioned embodiments of the present application have achieved the following technical effects: Using the primer - probe composition of the present application, not only is the specificity high, but also the sensitivity is greatly improved, so that Mycoplasma haemofelis Mhm type can be accurately and sensitively identified.

[0076] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A reagent for detecting the nucleic acid of Mycoplasma haemofelis Mhm type, characterized in that, The reagent includes: a reagent for detecting the first region of Mycoplasma haemofelis Mhm type, wherein the first region is selected from any fragment in SEQ ID NO:

1.

2. The reagent according to claim 1, characterized in that, The first region is selected from any fragment between the bases at positions (1-13)-(86-112) in SEQ ID NO:

1.

3. The reagent according to claim 2, wherein The reagent includes a primer pair, and the nucleotide sequence of the primer pair has a nucleotide sequence complementary or identical to 22-28 consecutive nucleotides between the bases at positions (1-13)-(86-112) in SEQ ID NO:

1.

4. The reagent according to claim 3, characterized in that, The primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 2 and 5; Preferably, the reagent further includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 6; Wherein, SEQ ID NO: 2 is 5'-CATAATATTTGTGGGAAGGTGCACTA-3', SEQ ID NO: 5 is 5'-AGATCCCAGTGAGCTGAGAATAGATG-3', SEQ ID NO: 6 is 5'-CATGTTGGCCTCCCGCTCCGC-3'.

5. The reagent according to claim 4, wherein The 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quenching group; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quenching group is selected from BHQ, TAMRA, Dabcyl or Eclipse; More preferably, the 5' end of the probe is a ROX group and the 3' end is a BHQ group.

6. A kit, characterized in that, The kit includes the reagent for detecting the nucleic acid of Mycoplasma haemofelis Mhm type in a test sample according to any one of claims 1 to 5.

7. The kit according to claim 6, wherein The kit further includes at least one of the following: a qPCR premix, the qPCR premix includes a qPCR buffer and AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 5U / μL.

8. A method for detecting Mycoplasma haemofelis Mhm type by fluorescence quantitative PCR, characterized in that, The fluorescence quantitative PCR detection is carried out using the reagent for detecting the nucleic acid of Mycoplasma haemofelis Mhm type in a test sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, characterized in that, The conditions for the fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30s-90s; denaturation treatment at 92-98°C for 2-8s, annealing at 58-62°C for 20-40s and collecting fluorescence signal processing, for a total of 40-44 cycles.

10. Use of the reagent for detecting the nucleic acid of Mycoplasma haemofelis Mhm type in a test sample according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in the detection of Mycoplasma haemofelis Mhm type.