Micro-fluidic chip for tilapia lake virus nucleic acid detection, detection method and kit

Through the microfluidic chip combined with qPCR technology, the full process of nucleic acid detection of tilapia lake virus (TiLV) has been automated and rapid, solving the problems of long detection time, high cost and strong equipment dependence in the existing technology, and achieving efficient, convenient and economical detection results.

CN120210428APending Publication Date: 2025-06-27SHENZHEN CUSTOMS ANIMAL & PLANT INSPECTION & QUARANTINE TECH CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510381035.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The existing tilapia lake virus (TiLV) detection technology has antibody specific limitations, time-consuming, high equipment dependence, complex primer design requirements, high cost and lack of commercial kits, which is difficult to meet the needs of fast, accurate and economical on-site testing.

Method used

Using microfluidic chip combined with qPCR technology, the sample preprocessing module, qPCR amplification module and signal detection module are designed to realize the automation and rapid process of TiLV nucleic acid detection.

Benefits of technology

It greatly shortens the detection time, improves the sensitivity and specificity of the detection, reduces the consumption and cost of reagents, is suitable for on-site inspection and large-scale screening, and provides cost-effective detection solutions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210428A_ABST
    Figure CN120210428A_ABST
Patent Text Reader

Abstract

The invention discloses a micro-fluidic chip for tilapia lake virus nucleic acid detection, the micro-fluidic chip comprises a sample pretreatment module, a qPCR amplification module and a signal detection module, the sample pretreatment module comprises a sample splitting cavity for nucleic acid extraction and purification; the qPCR amplification module comprises a reaction cavity, and a T7RNA polymerase, a TiLV specific primer pair and an FAM-BHQ1 marked RNA probe are arranged in the reaction cavity; the signal detection module comprises a transparent detection window, and fluorescent signals or other visual signals are read through the detection window. According to the technical scheme provided by the invention, through deep integration of the micro-fluidic chip and the qPCR technology, full-process automation and rapidness of TiLV nucleic acid detection are realized. According to the chip, the steps of sample treatment, nucleic acid amplification, detection and the like are integrated on a miniaturized platform, so that several hours or even longer time required by traditional detection is greatly shortened, the detection can be completed in a short time, and the timeliness requirement of emergency monitoring is met.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of tilapia lake virus detection, and particularly to a microfluidic chip, a detection method and a kit for tilapia lake virus nucleic acid detection. Background Art

[0002] Tilapia lake virus (TiLV), as a highly pathogenic pathogen of the Orthomyxoviridae family, poses a serious threat to the global tilapia aquaculture industry. This virus has strong infectivity and can cause large-scale fish deaths, not only resulting in huge economic losses but also having a negative impact on the ecological balance. Currently, the detection methods of TiLV mainly rely on traditional methods such as enzyme-linked immunosorbent assay (ELISA), semi-nested reverse transcription polymerase chain reaction (RT-PCR), loop-mediated isothermal amplification technology (LAMP), and droplet digital PCR (ddPCR). However, these technologies face many challenges in practical applications. For example, the antibody specificity limitation of ELISA, the time-consuming and equipment dependence of RT-PCR, the complex primer design requirements of LAMP, and the high cost and lack of commercial kits of ddPCR, making it difficult to meet the requirements of rapid, accurate and economical on-site detection. Therefore, it is urgent to develop an efficient and convenient TiLV detection technology.

[0003] Microfluidic chip technology provides a new idea for solving the existing problems of TiLV detection due to its characteristics of miniaturization, integration and high throughput. The microfluidic chip can integrate multiple steps such as nucleic acid extraction, amplification and detection on a single chip, and through the design of microchannel network and functional units, realize the automatic processing and rapid analysis of samples. Its advantages include: (1) shortening the detection time and reducing manual operation errors; (2) reducing reagent consumption and cost, suitable for large-scale screening; (3) supporting the development of portable devices to meet the on-site detection requirements; (4) through modular design, it can be flexibly adapted to different detection principles (such as PCR, LAMP, etc.) to improve the adaptability to virus mutations. Based on this, developing a TiLV nucleic acid detection method based on a microfluidic chip is expected to break through the bottleneck of traditional technologies and provide efficient and reliable technical support for the rapid diagnosis and prevention and control of TiLV. Summary of the Invention

[0004] The main object of the present invention is to propose a microfluidic chip, a detection method and a kit for tilapia lake virus nucleic acid detection, aiming to combine the microfluidic chip with qPCR technology to be able to complete the nucleic acid detection of tilapia lake virus in a short time, greatly shortening the detection time and improving the sensitivity and specificity of the detection.

[0005] To achieve the above object, the present invention proposes a microfluidic chip for tilapia lake virus nucleic acid detection, including:

[0006] Sample pretreatment module, including a sample lysis chamber for nucleic acid extraction and purification;

[0007] qPCR amplification module, including a reaction chamber, in which T7 RNA polymerase, a TiLV-specific primer pair and an RNA probe labeled with FAM-BHQ1 are provided; and,

[0008] Signal detection module, including a transparent detection window for reading fluorescence signals or other visual signals through the detection window.

[0009] Preferably, the sequences of the TiLV-specific primer pair are as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0010] Preferably, the sequence of the RNA probe is as shown in SEQ ID NO.3.

[0011] The present invention also provides a method for detecting TiLV based on the microfluidic chip described above, including the following steps:

[0012] S1. Sample processing: Add the sample to be tested into the sample pretreatment module of the microfluidic chip, extract nucleic acid and transfer the nucleic acid to the qPCR amplification module;

[0013] S2. qPCR amplification: In the qPCR amplification module of the chip, use the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2 to perform isothermal amplification on the target nucleic acid sequence to generate an amplification product;

[0014] S3. Signal detection: In the signal detection module, read the fluorescence signal intensity through a fluorescence detection device, and set negative control and positive control at the same time, and determine whether the sample contains TiLV according to the fluorescence signal intensity.

[0015] Preferably, in step S1, the sample to be tested includes fish tissue or aquaculture water sample.

[0016] Preferably, in step S3, the negative control uses RNase-free H2O to replace the amplification product.

[0017] Preferably, in step S3, the positive control is known TiLV-positive nucleic acid.

[0018] The present invention further provides a TiLV detection kit, including the microfluidic chip described above, and further including:

[0019] Sample processing reagents, including buffer and lysis solution, for nucleic acid extraction of samples;

[0020] Detection reagents, including qPCR primer pairs, T7 RNA polymerase and positive quality control products.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] (1) Efficient and convenient detection process and economic practicality: In the technical solution provided by the present invention, through the deep integration of the microfluidic chip and qPCR technology, the full process automation and rapidization of TiLV nucleic acid detection are realized. The chip integrates steps such as sample processing, nucleic acid amplification, and detection on a miniaturized platform, significantly shortening the several hours or even longer time required for traditional detection, enabling the detection to be completed in a short time and meeting the timeliness requirements of emergency monitoring. At the same time, the integrated design of the chip simplifies the operation process, reduces the dependence on complex equipment and professional technicians, and non-professionals can easily complete the detection, lowering the technical threshold. In addition, the miniaturized design of the chip significantly improves its portability. The device is small in size and suitable for use in on-site environments such as farms and ports, enabling timely response to the needs of epidemic monitoring. In terms of cost control, the chip reduces the demand for expensive instruments and reagents through microscale reagent consumption and simplified operation steps, providing an economical and efficient detection solution, especially suitable for grass-roots units with limited resources or large-scale screening scenarios.

[0023] (2) High sensitivity, specificity, and intuitive result interpretation: Relying on the high specific recognition ability of qPCR technology, this detection method can accurately distinguish viral nucleic acids from other interfering substances by designing specific primers and probes targeting the conserved regions of TiLV, effectively avoiding false positive or false negative results, and significantly improving the sensitivity and specificity of the detection. Even when the concentration of viral RNA is extremely low, the signal amplification characteristics of qPCR can still achieve accurate detection, ensuring the effective identification of early infection or low viral load samples. In addition, the chip combines signal amplification and conversion technologies to present the detection results in intuitive forms such as fluorescence signals or visual color development, without relying on complex instrument analysis. Detection personnel can quickly interpret the results, further enhancing the convenience and efficiency of the detection. The combination of this high precision and easy readability provides strong support for the early diagnosis and precise prevention and control of TiLV.

[0024] (3) Multifunctional integration and high-throughput detection ability: The modular design of the microfluidic chip endows this detection method with powerful multifunctional integration characteristics. The chip can integrate multiple independent detection modules according to needs, supporting parallel detection of multiple samples or multiple virus targets simultaneously, significantly improving the detection throughput and efficiency. In addition, the integrated advantages of the chip are also reflected in its compatibility with multiple detection technologies (such as fluorescence quantification, electrochemical detection, etc.), providing a flexible platform for future expansion of detection functions or upgrading of detection methods. This multifunctionality and high-throughput characteristic give this microfluidic chip detection method significant advantages in dealing with diverse detection needs, further enhancing its value in practical applications. Brief Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0026] Figure 1 It is the detection sensitivity diagram of tilapia lake virus (TiLV) based on a microfluidic chip provided by the present invention;

[0027] Figure 2 It is the detection specificity diagram of tilapia lake virus (TiLV) based on a microfluidic chip provided by the present invention;

[0028] Figure 3 It is the detection repeatability diagram of tilapia lake virus (TiLV) based on a microfluidic chip provided by the present invention.

[0029] The realization, functional characteristics and advantages of the object of the present invention will be further described in conjunction with the embodiments with reference to the drawings. Detailed Embodiments

[0030] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they shall be carried out according to the conventional conditions or the conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer can all be obtained as conventional products through commercial purchase. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the fact that those of ordinary skill in the art can implement it. When the combination of technical solutions conflicts with each other or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0031] The following further details the technical solutions of the present invention in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0032] Embodiment 1 Preparation of a microfluidic chip for tilapia lake virus nucleic acid detection

[0033] First, design a microfluidic chip structure (length × width × height is 55 mm × 35 mm × 5.2 mm), which is assembled by three layers of polycarbonate plates, including the upper chip layer, the middle layer (double-sided adhesive layer), and the lower chip layer. The upper chip layer is provided with a sample loading area for introducing the sample to be detected; the middle layer separates the sample flow channels through the adhesive area and non-adhesive area of the double-sided adhesive, and sequentially constructs a sample pretreatment module, a qPCR amplification module, and a signal detection module. The sample pretreatment module includes a sample lysis chamber for breaking Tilapia lake virus particles and releasing nucleic acids, and further performing nucleic acid extraction and purification; the qPCR amplification module includes a constant temperature reaction chamber, which forms a closed cavity on the middle layer through microfabrication technology, and is pre-loaded with T7 RNA polymerase, Tilapia lake virus (TiLV) specific primer pairs, and FAM-BHQ1-labeled RNA probes to ensure efficient nucleic acid amplification reaction under constant temperature conditions; the signal detection module is located on the lower chip layer, and a transparent detection window is set at the position corresponding to the qPCR reaction chamber for reading fluorescence signals or other visual signals.

[0034] Among them, the sequences of the TiLV specific primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2; the sequence of the RNA probe is shown in SEQ ID NO.3.

[0035] SEQ ID NO.1:

[0036] CGAACTGTTGCCTTTGGAAATT

[0037] SEQ ID NO.2:

[0038] TGAAGAATAAGTGGATTGCCTTTG

[0039] SEQ ID NO.3:

[0040] 5′-FAM-CCGCGGCTGGCCTTCCAG-BHQ1-3′

[0041] During preparation, first spot a mixture of T7 RNA polymerase, TiLV specific primer pairs, and RNA probes (total volume 5 μL, and the concentrations of each component are optimized to the best reaction conditions) in the area of the constant temperature reaction chamber corresponding to the qPCR amplification module on the lower chip layer, and then dry it at 37 °C for 30 minutes. Then, precisely align and bond the upper chip layer, the middle layer, and the lower layer through the double-sided adhesive middle layer to ensure the fluid channels between each module are connected. The assembled chip is cured at 37 °C for 12 hours to enhance the interlayer bonding force, and finally stored in the dark at 4 °C for standby. This preparation method realizes the full-process automation from sample processing to nucleic acid amplification and signal detection through modular integrated design, providing an efficient microfluidic platform for the rapid and sensitive detection of Tilapia lake virus.

[0042] Example 2 Preparation of a TiLV Detection Kit Based on a Microfluidic Chip

[0043] (1) Preparation of Pre-loaded Dry Powder Detection Reagents

[0044] Prepare a detection reagent solution containing a TiLV-specific primer pair (concentration 10 uM), an RNA probe (concentration 10 uM), Taq DNA polymerase (5 U / ul), a PCR amplification buffer, dNTPs (10 mM), MMLV reverse transcriptase (5 U / ul), and T7 RNA polymerase (5 U / ul).

[0045] Dispense the reagent solution into PCR tubes on a per-person basis and store at -80 °C for more than 8 hours. Use a vacuum freeze-drying process and set the freeze-drying program as follows: pre-freeze at -50 °C for 1 hour, and then dry successively under the conditions of -40 °C (5 hours, <10 Pa), -10 °C (2 hours, <10 Pa), 0 °C (2 hours, <10 Pa), and 30 °C (5 hours, <10 Pa) to finally form dry powder reagents.

[0046] Pre-load the freeze-dried dry powder reagents into the constant-temperature reaction chamber of the microfluidic chip and store them sealed.

[0047] (2) Integration of Supporting Reagents

[0048] Sample processing reagents: Prepare a buffer and a lysis solution for nucleic acid extraction from fish tissue or aquaculture water samples. The buffer contains components such as Tris-HCl and EDTA, and the lysis solution contains protease K, surfactants, etc., to ensure the efficient release of viral nucleic acids in the samples.

[0049] Detection reagents: Prepare a TiLV-specific primer pair, T7 RNA polymerase, and a positive control product. The positive control product is a plasmid containing the TiLV amplification gene sequence, which is used to verify the effectiveness of the detection process.

[0050] Integrate and package the microfluidic chip, sample processing reagents, detection reagents, and positive control product to form a complete kit, and label the storage conditions (such as storing in the dark at 4 °C) and usage instructions.

[0051] This preparation method realizes the automation, rapidity, and high sensitivity of TiLV detection through the integrated design of the microfluidic chip and the optimization of the stability of dry powder reagents, providing a reliable technical tool for the on-site detection and prevention and control of TiLV in aquaculture.

[0052] Example 3 Operation and Result Judgment of the Kit

[0053] (1) Add 200 μL of the co-extracted template of sample DNA / RNA (extracted from tilapia tissue samples) into the sample loading well of the microfluidic nucleic acid detection chip, cover the lid of the sample loading well, and place it in the microfluidic chip detector for detection;

[0054] (2) The conditions for the PCR amplification reaction are as follows:

[0055] Pre-denaturation at 95 °C for 2 min;

[0056] Denaturation at 95 °C for 10 s, annealing and extension at 58 °C for 30 s, for 40 cycles.

[0057] (3) Validity determination:

[0058] The negative control well does not contain exogenous target nucleic acid sequence fragments and is used as a single sample and added to a microfluidic cartridge. The test result should be negative; the positive control well contains nucleic acid extracted from a traceable reference material, or nucleic acid extracted from a positive sample with a known sequence, or artificially synthesized nucleic acid containing the target nucleic acid sequence fragment. It is used as a single sample and added to a microfluidic cartridge. The test result should be positive. Otherwise, the experiment is considered invalid;

[0059] (4) Result interpretation: The data in the reaction chamber corresponds to tilapia lake virus, and directly judge the positive or negative result of tilapia lake virus.

[0060] Use the kit for detecting tilapia lake virus based on the microfluidic chip of the present invention to detect the sample to be tested, which contains pathogen nucleic acid. Sample 1 contains tilapia lake virus nucleic acid, and sample 2 only contains RNase-free H2O and does not contain tilapia lake virus. Detection operations are carried out according to the above method, and the detection results are shown in Table 1.

[0061] Table 1 Statistical table of detection results

[0062] Sample Number Result (+ / -) No. 1 + No. 2 -

[0063] Example 4 Study on the detection sensitivity of tilapia lake virus (TiLV) based on the microfluidic chip

[0064] The plasmid of the original target gene of tilapia lake virus (TiLV) is dissolved into a concentration of 10 10 copies / μL, and then serially diluted 10-fold. Select plasmid solutions with concentrations of approximately 10 4 copies / μL - 10 0 copies / μL as the test solutions, with 4 replicates for each concentration, to test the sensitivity of the microfluidic chip method. The experimental results are as Figure 1As shown, where the abscissa in the figures is the threshold cycle number (cycle-threshold value), and the ordinate is the fluorescence value graph. In Figure (A), the plasmid concentration is 10 4 copies / μL, in Figure (B), the plasmid concentration is 10 3 copies / μL, in Figure (C), the plasmid concentration is 10 2 copies / μL, in Figure (D), the plasmid concentration is 10 1 copies / μL, in Figure (E), the plasmid concentration is 10 0 copies / μL. It can be seen from Figure 1 that the detection sensitivity of this microfluidic chip is ≥ 10 0 copies / μL, and the detection sensitivity is high.

[0065] Example 5 Specificity Study of Tilapia Lake Virus (TiLV) Detection Based on Microfluidic Chip

[0066] Nucleic acid was extracted from fish tissue samples containing Tilapia Lake Virus (TiLV) for testing, with 4 replicates. The experimental results are as Figure 2 shown. Among them, the abscissa in the figures is the threshold cycle number (cycle-threshold value), and the ordinate is the fluorescence value graph. Figure (A) is the amplification curve graph of non-specific pathogen samples, and Figure (B) is the amplification curve graph of positive samples. It can be seen from Figure 2 that this microfluidic chip did not amplify non-specific pathogen samples, and samples containing Tilapia Lake Virus were amplified, indicating that this detection method is specific.

[0067] Example 6 Reproducibility Study of Tilapia Lake Virus (TiLV) Detection Based on Microfluidic Chip

[0068] Plasmids of the original target gene of Tilapia Lake Virus (TiLV) were dissolved to a concentration of 10 10 copies / μL, and then serially diluted 10-fold. Positive plasmid solutions with concentrations of approximately 10 0 copies / μL and 10 1 copies / μL were taken as test solutions, with 4 replicates for each concentration. They were taken out for performance testing in the 1st, 2nd, 3rd, 4th, and 6th months of storage. The experimental results are as Figure 3 shown. Among them, the abscissa in the figures is the threshold cycle number (cycle-threshold value), and the ordinate is the fluorescence value graph. Figure (A) is the amplification test graph of the positive plasmid with a concentration of 10 0 copies / μL in the 1st month of storage; Figure (B) is the amplification test graph of the positive plasmid with a concentration of 10 1Amplification test chart for the first month of storage of positive plasmid at copies / μL; Figure (C) shows a concentration of 10 0 Amplification test chart for the second month of storage of positive plasmid at copies / μL; Figure (D) shows a concentration of 10 1 Amplification test chart for the second month of storage of positive plasmid at copies / μL; Figure (E) shows a concentration of 10 0 Amplification test chart for the third month of storage of positive plasmid at copies / μL; Figure (F) shows a concentration of 10 1 Amplification test chart for the third month of storage of positive plasmid at copies / μL; Figure (G) shows a concentration of 10 0 Amplification test chart for the fourth month of storage of positive plasmid at copies / μL; Figure (H) shows a concentration of 10 1 Amplification test chart for the fourth month of storage of positive plasmid at copies / μL; Figure (I) shows a concentration of 10 0 Amplification test chart for the sixth month of storage of positive plasmid at copies / μL; Figure (J) shows a concentration of 10 1 Amplification test chart for the sixth month of storage of positive plasmid at copies / μL. It can be Figure 3 seen that the microfluidic chip still has good amplification characteristics after six months of storage, and the detection repeatability is good.

[0069] Example 7 Detection of tilapia and some diseased fish samples using a microfluidic chip

[0070] 1. Sample addition

[0071] Place the microfluidic cartridge on a horizontal tabletop, push open the cover plate of the sample loading hole of the microfluidic cartridge, use a pipette gun with a volume range of 10 - 100 μL to aspirate 50 μL of the pretreated sample, pierce the aluminum foil at the sample loading hole of the microfluidic cartridge with the pipette tip with appropriate force, insert the tip into the sample loading hole, and then slowly eject the sample in the tip. Close the cover plate of the sample loading hole of the microfluidic cartridge.

[0072] 2. Loading the microfluidic cartridge

[0073] Open the flip cover of the fully automatic nucleic acid detection analyzer to be tested, put the microfluidic cartridge after sample addition into the instrument to be tested, and close the flip cover.

[0074] 3. PCR amplification and experimental operation

[0075] PCR amplification is carried out in the microfluidic cartridge, and the fully automatic nucleic acid detection analyzer will automatically obtain information such as the PCR program.

[0076] After the microfluidic cartridge is loaded, close the flip cover of the instrument to be tested, click the "Run" icon, and the experiment will immediately enter the running state.

[0077] 4. Setting of the control group

[0078] Negative control: Without exogenous target nucleic acid sequence fragments, used as a single sample and added into a microfluidic cartridge; Positive control: Nucleic acid extracted from a traceable reference material, or nucleic acid extracted from a positive sample with a known sequence, or artificially synthesized nucleic acid containing the target nucleic acid sequence fragment, used as a single sample and added into a microfluidic cartridge. Internal reference control: Primers for amplifying the internal reference gene fragment are present in the reaction wells of the microfluidic chip, and the internal reference plasmid is present in the reaction solution, used to quality control whether the amplification reaction can proceed normally.

[0079] 5. Judgment of microfluidic results

[0080] Perform the amplification of the microfluidic chip on a microfluidic chip detector. The instrument will perform real-time fluorescence detection and make a judgment based on the effective amplification curve of the fluorescence detection. The judgment criteria are as follows:

[0081] Ct value of the positive control ≤ 35, with a typical amplification curve; The negative control and the blank control have no Ct value or Ct > 35, without an amplification curve, and the result is valid.

[0082] Ct of the sample to be tested ≤ 35, and the amplification curve has an obvious logarithmic growth phase, judged as positive for the fluorescence PCR result.

[0083] The sample to be tested shows no Ct value, no amplification curve, or no obvious logarithmic growth phase in the reaction curve, judged as negative for the fluorescence PCR result.

[0084] For samples with 35 < Ct < 40.0, the template concentration should be readjusted and the experiment repeated. If the repeated detection of the sample shows Ct ≤ 35 and the amplification curve has an obvious logarithmic growth phase, it is judged as positive for the fluorescence PCR result. Otherwise, it is judged as a negative reaction for the fluorescence PCR. The test results are shown in Table 1 below.

[0085] Table 1 Ct values of samples

[0086]

[0087]

[0088] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the patent protection scope of the present invention.

Claims

1. A microfluidic chip for detecting Tilapia lake virus nucleic acid, characterized in that, Comprising: A sample pretreatment module, including a sample lysis chamber for nucleic acid extraction and purification; A qPCR amplification module, including a reaction chamber, in which T7 RNA polymerase, a TiLV-specific primer pair, and an RNA probe labeled with FAM-BHQ1 are provided; and, A signal detection module, including a transparent detection window for reading fluorescence signals or other visual signals through the detection window.

2. The microfluidic chip according to claim 1, wherein The sequences of the TiLV-specific primer pair are shown as SEQ ID NO.1 and SEQ ID NO.

2.

3. The microfluidic chip according to claim 1, characterized in that, The sequence of the RNA probe is shown as SEQ ID NO.

3.

4. A method for detecting TiLV based on the microfluidic chip as described in claim 1, characterized in that, Including the following steps: S1. Sample processing: Add the sample to be tested into the sample pretreatment module of the microfluidic chip, extract nucleic acid and transfer the nucleic acid to the qPCR amplification module; S2. qPCR amplification: In the qPCR amplification module of the chip, use the primer pair shown as SEQ ID NO.1 and SEQ ID NO.2 to perform isothermal amplification on the target nucleic acid sequence to generate an amplification product; S3. Signal detection: In the signal detection module, read the fluorescence signal intensity through a fluorescence detection device, and at the same time set a negative control and a positive control, and determine whether the sample contains TiLV according to the fluorescence signal intensity.

5. The method according to claim 4, characterized in that, In step S1, the sample to be tested includes fish tissue or aquaculture water sample.

6. The method according to claim 4, wherein In step S3, the negative control uses RNase-free H2O to replace the amplification product.

7. The method according to claim 4, wherein In step S3, the positive control is known TiLV-positive nucleic acid.

8. A TiLV detection kit, comprising the microfluidic chip as described in claim 1, characterized in that, Further comprising: Sample processing reagents, including a buffer and a lysis solution, for nucleic acid extraction of the sample; Detection reagents, including a qPCR primer pair, T7 RNA polymerase, and a positive control product.