Kit for visually detecting Newcastle disease virus based on RPA-CRISPR / Cas12a system and application
By combining RPA amplification technology and CRISPR/Cas12a system, a visual detection method of Newcastle virus was designed, which solved the problems of slow detection speed and low sensitivity in the existing technology, and achieved rapid, sensitive and visual detection effects, which were especially suitable for grassroots clinical testing.
Patent Information
- Application Number
- CN202510423832.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-06-27
AI Technical Summary
The existing technology is difficult to achieve rapid, sensitive and visual detection of Newcastle virus, and the traditional detection methods are cumbersome, high equipment requirements and complex operations, making it difficult to meet the needs of grassroots clinical levels.
Combining RPA amplification technology and CRISPR/Cas12a system, a visual detection method based on RPA-CRISPR/Cas12a system was designed, using specific RPA primers and crRNA guide sequences, combining Cas12a enzyme and ssDNA fluorescent probes to achieve efficient detection of Newcastle Virus.
The method can complete the detection in only 40 minutes under constant temperature conditions, with a minimum sensitivity of 30copies/μL, exceeding 1000 times that of traditional PCR and qPCR. The detection results can be visually displayed, which is easy to operate and is suitable for basic clinical testing.
Smart Images

Figure CN120210429A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular detection, in particular to a kit for visual detection of Newcastle disease virus based on the RPA-CRISPR / Cas12a system and its application. Background Art
[0002] Newcastle disease (ND) is an acute avian infectious disease caused by Newcastle disease virus (NDV), which seriously threatens the global poultry farming industry. The disease spreads rapidly and has a high fatality rate, especially affecting chickens. Newcastle disease virus widely exists in various tissues, body fluids and secretions of diseased poultry, and is mainly transmitted through the respiratory tract, digestive tract and skin wounds, and can also be vertically transmitted to infect young poultry. Currently, Newcastle disease has become one of the important diseases in the global poultry farming industry.
[0003] At present, the detection methods for Newcastle disease include virus isolation, serological detection and molecular detection, such as RT-PCR, RT-qPCR, LAMP, recombinase polymerase amplification (RPA), etc. Although these methods are widely used in clinics, traditional detection methods are often cumbersome, have a long detection time, and require relatively complex equipment and professional personnel. In addition, although new molecular detection methods have high sensitivity, they also face problems such as high equipment requirements and complex operations, and it is difficult to meet the needs of rapid, sensitive and stable pathogen detection in primary clinics.
[0004] As a new isothermal amplification technology, RPA technology has the advantages of rapidity, simple operation and low environmental requirements, and can obtain detection results within 20 - 30 minutes. Therefore, it has been successfully applied to the detection of various pathogens. However, the RPA method still has certain limitations. For example, its products need to be purified before agarose gel electrophoresis imaging, and non-specific amplification between primers may occur, affecting the accuracy and popularization of detection.
[0005] CRISPR / Cas12a technology has developed rapidly in recent years and has shown great potential in the field of molecular diagnosis. Especially the combination of CRISPR / Cas12a and RPA enables the detection to not only have high specificity, but also amplify signals, reduce false positives and enhance the sensitivity of detection. This technology has been successfully applied to the detection of human papillomavirus (HPV) and novel coronavirus, etc. However, although the combination of RPA and Cas12a has achieved good results in the detection of various diseases, the rapid, sensitive and visual detection technology for Newcastle disease virus is not yet mature. Therefore, there is an urgent need for a new detection method that can combine RPA and CRISPR / Cas12a technologies to make up for the deficiencies of the existing technology and achieve rapid, accurate, sensitive and visual detection of Newcastle disease virus, so as to provide an effective means for clinical early diagnosis and prevention and control. Summary of the Invention
[0006] The object of the present invention is to provide a kit and application for visual detection of Newcastle disease virus based on the RPA-CRISPR / Cas12a system to solve the problems existing in the above-mentioned prior art. The present invention combines the RPA amplification technology with the CRISPR / Cas12a system to provide a highly efficient visual detection method for Newcastle disease virus. Under isothermal conditions, the detection can be completed in only 40 minutes, and the sensitivity is 1000 times that of PCR and qPCR detection reagents.
[0007] To achieve the above object, the present invention provides the following solutions:
[0008] Technical solution one: An RPA primer pair, the nucleotide sequences of which are shown in SEQ ID NO.6 and SEQ ID NO.11.
[0009] The RPA primer sequences are as follows:
[0010] NDV-F-RPA-F1 (forward primer): 5’-GACATTGCATGAGTGCCTATCTATTAGAGA-3’ (SEQ ID NO.6);
[0011] NDV-F-RPA-R2 (reverse primer): 5’-CTTACTACGCCATATATGACTATCAAGGGC-3’ (SEQ ID NO.11);
[0012] Technical solution two: A crRNA guiding sequence, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0013] The crRNA guiding sequence is as follows:
[0014] 5’-UAAUUUCUACUAAGUGUAGAUCGAUAUGAUACCCGGAGGGUCUG-3’ (SEQ ID NO.1).
[0015] Technical solution three: A kit for visual detection of Newcastle disease virus based on the RPA-CRISPR Cas12a system, the kit includes the above-mentioned RPA primer pair, the above-mentioned crRNA guiding sequence, Cas12a enzyme and ssDNA fluorescent probe.
[0016] Furthermore, the nucleotide sequence of the ssDNA fluorescent probe is: 5’-FAM-TTTATTT-BHQ1-3’.
[0017] Furthermore, the kit also includes A Buffer, B Buffer (MgOAC), enzyme dry powder and ddH2O.
[0018] Technical solution four: A detection method for rapid detection of Newcastle disease virus for non-diagnostic purposes, comprising the following steps:
[0019] Using the genomic cDNA of the sample to be tested as a template, performing an RPA amplification reaction to obtain an RPA amplification product; performing a CRISPR / Cas12a reaction on the RPA amplification product according to the CRISPR / Cas12a reaction system, and the reaction conditions are: 37°C, 20 min, to obtain a CRISPR / Cas12a reaction solution; if the CRISPR / Cas12a reaction solution has fluorescence brightness, then the sample to be tested contains Newcastle disease virus.
[0020] Further, the reaction system for RPA amplification includes: 29.4 μL A Buffer, 2.5 μL B Buffer, 2 μL of the forward primer shown in SEQ ID NO. 6 at a concentration of 10 μM, 2 μL of the reverse primer shown in SEQ ID NO. 11 at a concentration of 10 μM, 12.1 μL ddH2O, and 2 μL of template DNA.
[0021] Further, the reaction conditions for RPA amplification are: 37°C, 20 min.
[0022] Further, the CRISPR / Cas12a reaction system includes: 2 μL of 10xBuffer buffer, 1 μL of the crRNA sequence shown in SEQ ID NO. 1 at a concentration of 10 μM, 1 μL of the ssDNA probe sequence at a concentration of 10 μM, 1.5 μL of Cas12a enzyme at a concentration of 1 μM, 5 μL of the RPA amplification product, and finally made up to 20 μL with ddH2O.
[0023] Technical solution five: Application of the RPA primer pair, the crRNA guiding sequence, the kit or the detection method in the detection of Newcastle disease virus for non-diagnostic purposes.
[0024] The present invention discloses the following technical effects:
[0025] The present invention combines RPA amplification technology with CRISPR / Cas12a system to provide an efficient visualization detection method for Newcastle disease virus. The present invention realizes a wider detection range by selecting conservative targets of multi-type Newcastle disease virus F gene, realizes the detection of multi-type Newcastle disease virus, and realizes accurate detection of clinical strains with high specificity. Under constant temperature conditions, the detection scheme of the present invention can be completed in only 40 minutes, and the sensitivity can reach a minimum of 30 copies / μL, which is 1000 times the sensitivity of PCR and qPCR detection reagents. At the same time, the test results can be displayed intuitively, which is convenient for observation and judgment. The present invention is easy to operate, has strong specificity and sensitivity, and does not require complex equipment. Only basic constant temperature heating is required to complete the detection, which is particularly suitable for clinical detection at the grassroots level. It provides a reference for timely prevention and control, better protects the healthy development of the livestock and poultry industry, and is more conducive to promoting the promotion and application of Newcastle disease virus detection technology in the front line of breeding, and effectively detecting and controlling Newcastle disease. This technology can not only realize the early diagnosis of Newcastle disease, but also provide a reliable means for prevention and control, and has important application value.
[0026] In addition, for the construction of Newcastle disease virus, RPA amplification technology and CRISPR / Cas12a system are constructed. The detected F gene coding region has a high frequency of mutation and significant heterogeneity between genotypes, which brings certain challenges to detection. In this regard, the present invention relies on the Class I and Class II genotypes and subtype NDV strain F gene sequences included in the NCBI database, and through multiple sequence alignment technology and strict screening, it is constructed to obtain a detection target site with certain broad spectrum, anti-mutation and specificity. The target maintains a certain degree of conservatism between different genotypes, and can maintain good stability under mutation pressure, and can also maintain high accuracy in complex clinical samples, which is difficult to be escaped by the virus. The Newcastle disease virus detection method provided by the present invention, under constant temperature conditions, detection only needs 40 minutes to complete, and the sensitivity is 1000 times that of traditional PCR and qPCR detection, which can fully meet the detection needs of Newcastle disease in the front line of breeding. At present, the invention team is working with Guangzhou Aidi Gene Technology Co., Ltd., a manufacturer of RPA test kits and Cas12a enzymes, to reduce the cost of the test kit for a single reaction to less than 5 yuan and promote market promotion; at the same time, the detection technology of the present invention has been verified and recognized by Guangzhou Zhihui Biotechnology Co., Ltd., which has veterinary GMP certification and production license. After the invention is authorized successfully, the test kit based on the detection means of this application will be quickly transformed and handed over to the company for commercial production and application. In short, the rapid detection method provided by the present invention makes up for the shortcomings of the prior art, significantly improves the disease prevention and control capabilities of farmers, helps to recover the economic losses caused by the disease, and conservatively estimates that the added output value can reach 4 million yuan. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0028] Figure 1 It is a screening diagram for verifying the effectiveness of crRNA; specifically, it is the measurement of the fluorescence values after the CRISPR / Cas12a reaction using three candidate crRNAs respectively on the PCR amplification products with ddH2O (NC), 10 -3 and 10 -4 cDNA dilution as templates.
[0029] Figure 2 It is a screening diagram for the specificity of RPA primers; among them, M represents DNAmaker; lanes 1-16 respectively represent: the results of the products after RPA amplification using the combinations of NDV-F-RPA primers F1 and R1, F1 and R2, F1 and R3, F1 and R4, F2 and R1, F2 and R2, F2 and R3, F2 and R4, F3 and R1, F3 and R2, F3 and R3, F3 and R4, F4 and R1, F4 and R2, F4 and R3, F4 and R4 and then electrophoresed on a gel.
[0030] Figure 3 It is a diagram of the optimization result of the Cas12a enzyme dosage in the RPA-CRISPR / Cas12a reaction; among them, A is the result of the visualization fluorescence detection photographed under a blue light instrument, where 1-5 respectively represent the results of the CRISPR / Cas12a reaction using 0 μL, 0.5 μL, 1 μL, 1.5 μL and 2 μL of 1 μM Cas12a enzyme; B is the result of the fluorescence detection curve.
[0031] Figure 4 It is a diagram of the optimization result of the ssDNA probe dosage in the RPA-CRISPR / Cas12a reaction; among them, A is the result of the visualization fluorescence detection photographed under a blue light instrument, where 1-5 respectively represent the results of the CRISPR / Cas12a reaction using 0 μL, 0.5 μL, 1 μL, 1.5 μL and 2 μL of 10 μM ssDNA probe; B is the result of the fluorescence detection curve.
[0032] Figure 5It is the optimized result diagram of the RPA product dosage for the RPA-CRISPR / Cas12 reaction; among them, A is the result of the visualization fluorescence detection photographed under a blue light instrument, where 1-5 respectively represent the results of the CRISPR / Cas12a reaction using 0 μL, 1 μL, 5 μL, 10 μL, and 15 μL of the RPA amplification product; B is the result diagram of the fluorescence detection curve;
[0033] Figure 6 It is the optimized result diagram of the CRISPR / Cas12a reaction time; it includes the results of the CRISPR / Cas12a cleavage reaction for 5, 10, 15, 20, 25, and 30 minutes respectively and photographed under a blue light instrument; 1-5 respectively represent the results of the CRISPR / Cas12a reaction using ddH2O, NDV 10 -2 、10 -3 、10 -4 、10 -5 cDNA dilution as the template for the RPA amplification product;
[0034] Figure 7 It is the result diagram of the specificity analysis of the RPA-CRISPR / Cas12a visualization fluorescence detection reaction; among them, A is the comparison result photographed under a blue light instrument after the RPA-CRISPR / Cas12a fluorescence detection reaction with the total DNA / cDNA 100 dilution of various common diseases viruses in livestock and poultry; B is the result diagram of the fluorescence value of the RPA-CRISPR / Cas12a fluorescence detection reaction with the total DNA / cDNA 100 dilution of various common diseases viruses in livestock and poultry;
[0035] Figure 8 It is the result diagram of the fluorescence detection reaction of RPA-CRISPR / Cas12a with different concentrations of Newcastle disease DNA dilutions;
[0036] Figure 9 It is for 10 -1 -10 -7 cDNA dilution as the template for the qPCR reaction result diagram; among them, M represents DNA2000Maker, and the 1st-10th lanes respectively represent the PCR detection bands of 10 0 -10 -9 cDNA dilution;
[0037] Figure 10 It is the result diagram of the PCR detection reaction with different concentrations of Newcastle disease DNA dilutions;
[0038] Figure 11Results graph of the visual fluorescence detection reaction of RPA-CRISPR / Cas12a with different concentrations of Newcastle disease cDNA dilutions; among them, NC represents the detection result with the RPA amplification product obtained using ddH2O as the template as the detection object, and 1-7 respectively represent 10 -1 -10 -7 The detection result with the RPA amplification product obtained using cDNA dilution as the template as the detection object;
[0039] Figure 12 Results graph of the fluorescence detection of RPA-CRISPR / Cas12a using standard plasmids with different copy numbers;
[0040] Figure 13 For the result graph of the qPCR reaction using standard plasmids at 10 9 -10 0 copies / μL as the template; among them, M represents DNA 2000 Maker, and lanes 1-10 respectively represent the PCR amplification bands with standard plasmids at 10 9 -10 0 copies / μL as the template;
[0041] Figure 14 Results graph of the PCR detection reaction using standard plasmids with different copy numbers as the template;
[0042] Figure 15 Results graph of the visual fluorescence detection reaction of RPA-CRISPR / Cas12a using standard plasmids with different copy numbers; among them, NC represents the detection result with the RPA amplification product obtained using ddH2O as the template as the detection object, and 1-7 respectively represent 10 7 -10 0 The detection result with the RPA amplification product obtained using standard plasmids at copies / μL as the template as the detection object;
[0043] Figure 16 Results graph of the TCID 50 determination of clinical strains using different detection methods; among them, A is the results graph of the ordinary PCR detection, M represents DNA 2000 Maker, and lanes 1-4, 5-8, 6-12, 13-16, 17-20, 21-24 respectively represent the detection results of the viral cDNA extracted from the culture supernatant of DF-1 cells incubated with 10 -5 、10 -6 、10 -7 、10 -8 、10 -9 、10 -10 virus dilutions; B is the results graph of the gold standard qPCR detection, showing 10-5 ~10 -10 qPCR detection results of viral cDNA extracted from the culture supernatant of DF-1 cells incubated with virus diluent in 24-well plates; C is the RPA-CRISPR / Cas12a fluorescence detection result diagram, showing 10 -5 ~10 -10 RPA-CRISPR / Cas12a fluorescence detection results of viral cDNA extracted from the culture supernatant of DF-1 cells incubated with virus diluent; D is the RPA-CRISPR / Cas12a visual fluorescence detection reaction result diagram, where 1-6 respectively represent 10 -5 ~10 -10 Detection results of viral cDNA extracted from the culture supernatant of DF-1 cells incubated with virus diluent. Detailed implementation manners
[0044] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0045] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0046] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0047] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.
[0048] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0049] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are all reagents and materials that can be obtained commercially.
[0050] The nucleotide sequence of the ssDNA fluorescent probe is: 5'-FAM-TTTATTT-BHQ1-3'.
[0051] Example 1 Conservation analysis of NDV-F gene and verification and screening of crRNA effectiveness
[0052] In the present invention, different NDV F gene sequences were retrieved from the literature and downloaded from NCBI. After analysis, PCR primers were designed with their conserved sequences as targets. The RNA genome of the NDV isolated strain from clinically infected poultry in the laboratory was extracted and reverse transcribed to obtain the cDNA sequence. Its conservation was determined by sequencing and BLAST on the NCBI website. After screening, the conserved fragment of the NDV F gene was determined. The conserved sequence was targeted on the CHOPCHOP (https: / / chopchop.cbu.uib.no / ) website, and three spacer crRNA sequences with higher scores were selected as candidate sequences (Table 1).
[0053] Table 1
[0054]
[0055] Using the NDV cDNA obtained by reverse transcription as the stock solution, it was serially diluted 10-fold, and 10 -3 and 10 -4Using the multiple dilution as a template, perform PCR amplification on the PAM region where crRNA is located (the amplification primers, reaction system, and conditions are as follows: (1) Amplification primers: NDV-F: CAACTCAGCTCATTAATTGG (SEQ ID NO.4); NDV-R: GGTAATGAGAGCAGATGTGC (SEQ ID NO.5); (2) Reaction system: 25 μL DNA Taq enzyme, 2.5 μL of each corresponding primer pair at 10 μM, 2.5 μL of NDV cDNA template, and make up to 50 μL with ddH2O; (3) Reaction conditions: Pre-denaturation at 95°C for 3 min; Denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 35 cycles; Finally, extension at 72°C for 5 min and store at 4°C), to obtain the PCR amplification product. Take the PCR amplification product as a template and use the CRISPS / Cas12a reaction system (2 μL of 10x Buffer buffer, 1 μL of crRNA sequence at a concentration of 10 μM, 1 μL of ssDNA probe sequence at a concentration of 10 μM, 1.5 μL of Cas12a enzyme at a concentration of 1 μM, 5 μL of RPA amplification product, and finally make up to 20 μL with ddH2O; Reaction conditions: 37°C, 20 min) to detect the template. Set a negative control with ddH2O as the template for each group and use GraphPad Prism 9.5 for plotting. The results are as Figure 1 shown. It can be seen that when using NDV-F-crRNA1, the fluorescence value is the largest after the CRISPR / Cas12a reaction. Therefore, NDV-F-crRNA1 (SEQ ID NO.1) is selected for subsequent experiments.
[0056] Example 2 Design and Specificity Screening of NDV-F Target RPA Primers
[0057] Based on the 224bp length sequence selected as the target target in the region where the best-effective crRNA selected in Example 1 is located, design four pairs of spaced RPA primers (F is the forward primer, R is the reverse primer, and the sequences are shown in Table 2). After reverse-transcribing NDV to obtain the cDNA stock solution, perform RPA amplification reaction using the cDNA stock solution as a template (Reaction system: 29.4 μL AB Buffer, 2 μL of forward primer at 10 μM, 2 μL of reverse primer at 10 μM, 12.1 μL ddH2O, and 2 μL template DNA; Reaction conditions: 37°C, 20 min), to obtain the RPA amplification product.
[0058] Table 2
[0059] Sequence Name Sequence (5'-3') NDV-F-RPA-F1 GACATTGCATGAGTGCCTATCTATTAGAGA(SEQ ID NO.6) NDV-F-RPA-F2 CCCGTCTAAGGATAAGACATTGCATGAGTG(SEQ ID NO.7) NDV-F-RPA-F3 GATAAGACATTGCATGAGTGCCTATCTATT(SEQ ID NO.8) NDV-F-RPA-F4 TGCATGAGTGCCTATCTATTAGAGACACAG(SEQ ID NO.9) NDV-F-RPA-R1 GCTTGCATGTATTCAAAGACTGAAGGTGCA(SEQ ID NO.10) NDV-F-RPA-R2 CTTACTACGCCATATATGACTATCAAGGGC(SEQ ID NO.11) NDV-F-RPA-R3 GCACTTACTACGCCATATATGACTATCAAG(SEQ ID NO.12) NDV-F-RPA-R4 GACTGAAGGTGCACTTACTACGCCATATAT(SEQ ID NO.13)
[0060] After the RPA reaction (the combinations used for screening the best primer pairs were: F1 and R1, F1 and R2, F1 and R3, F1 and R4, F2 and R1, F2 and R2, F2 and R3, F2 and R4, F3 and R1, F3 and R2, F3 and R3, F3 and R4, F4 and R1, F4 and R2, F4 and R3, F4 and R4 combinations), agarose gel electrophoresis was carried out and photographed in the gel electrophoresis imaging system ( Figure 2 ). The results showed that the band in lane 2 had the best singularity and the highest brightness, that is, the RPA amplification specificity of the combination of "NDV-F-RPA-F1 (forward primer, SEQ ID NO.6)" and "NDV-F-RPA-R2 (reverse primer, SEQ ID NO.11)" was the best and the effect was the best. Therefore, the NDV-F-RPA-F1 / R2 primer pair was selected for the subsequent RPA amplification reaction.
[0061] Example 3 Optimization of RPA / Cas12a Reaction
[0062] I. Optimization of Cas12a Enzyme for CRISPR / Cas12a Reaction
[0063] Take 10 -3 dilution of NDV cDNA as the template and carry out the RPA amplification reaction (reaction system: 29.4 μL A Buffer, 2 μL 10 μM forward primer NDV-F-RPA-F1, 2 μL 10 μM reverse primer NDV-F-RPA-R2, 12.1 μL ddH2O, 2.5 μL B Buffer and 2 μL template DNA; reaction conditions: 37 °C, 20 min) to obtain the RPA amplification product.
[0064] Take the RPA amplification product and carry out 5 CRISPR / Cas12a reactions respectively with 0 μL, 0.5 μL, 1 μL, 1.5 μL and 2 μL 1 μM Cas12a enzyme (reaction system: 2 μL of 10xBuffer buffer, 1 μL of crRNA sequence with a concentration of 10 μM, 1 μL of ssDNA probe sequence with a concentration of 10 μM, Cas12a enzyme at the concentration to be screened, 5 μL of RPA amplification product, and finally made up to 20 μL with ddH2O; reaction conditions are: 37 °C, 20 min). The results are as Figure 3 shown in A. It can be seen that after "4", there is no obvious change in the fluorescence effect observed with the naked eye. Therefore, when using 1.5 μL 1 μM Cas12a enzyme, the best fluorescence detection effect can be achieved. At the same time Figure 3B also demonstrated that when using 1.5 μL of 1 μM Cas12a enzyme, the fluorescence value could react and reach the highest fluorescence value in the shortest time. Therefore, 1.5 μL of 1 μM Cas12a enzyme was selected for the subsequent RPA-CRISPR / Cas12 reaction.
[0065] II. Optimization of ssDNA Probe for CRISPR / Cas12a Reaction
[0066] Using the cDNA dilution of NDV 10 -3 as a template, an RPA amplification reaction was carried out (reaction system: 29.4 μL A Buffer, 2 μL of 10 μM forward primer NDV-F-RPA-F1, 2 μL of 10 μM reverse primer NDV-F-RPA-R2, 12.1 μL ddH2O, and 2 μL template DNA; reaction conditions: 37 °C, 20 min), and the RPA amplification product was obtained.
[0067] Using the RPA amplification product as a template, five CRISPR / Cas12a reactions were carried out using 0 μL, 0.5 μL, 1 μL, 1.5 μL, and 2 μL of 10 μM ssDNA probe respectively (reaction system: 2 μL of 10xBuffer buffer, 1 μL of crRNA sequence with a concentration of 10 μM, the ssDNA probe sequence with the concentration to be screened, 1.5 μL of 1 μM Cas12a enzyme, 5 μL of RPA amplification product, and finally made up to 20 μL with ddH2O; reaction conditions: 37 °C, 20 min). The results are as Figure 4 shown in A. It can be seen that after "3", there is no obvious change in the fluorescence effect observed with the naked eye. Therefore, when using 1 μL of 10 μM ssDNA probe, the best fluorescence detection effect can be achieved. At the same time Figure 3 B also demonstrated that when using 1 μL of 10 μM ssDNA probe, the fluorescence value could react and reach the highest fluorescence value in the shortest time. Therefore, 1 μL of 10 μM ssDNA probe was selected for the subsequent RPA-CRISPR / Cas12 reaction.
[0068] III. Optimization of RPA Amplification Product for CRISPR / Cas12a Reaction
[0069] Using the cDNA dilution of NDV 10 -3 as a template, an RPA amplification reaction was carried out (reaction system: 29.4 μL A Buffer, 2 μL of 10 μM forward primer NDV-F-RPA-F1, 2 μL of 10 μM reverse primer NDV-F-RPA-R2, 12.1 μL ddH2O, and 2 μL template DNA; reaction conditions: 37 °C, 20 min), and the RPA amplification product was obtained.
[0070] Take the RPA amplification products and perform 5 CRISPR / Cas12a reactions using 0 μL, 1 μL, 5 μL, 10 μL, and 15 μL of the RPA amplification products respectively (reaction system: 2 μL of 10x Buffer buffer, 1 μL of crRNA sequence with a concentration of 10 μM, 1 μL of 10 μM ssDNA probe, 1.5 μL of 1 μM Cas12a enzyme, the RPA amplification products at the concentration to be screened, and finally make up to 20 μL with ddH2O; reaction conditions: 37 °C, 20 min). The results are as Figure 5 shown in A of Figure 5 . It can be seen that after "3", there is no obvious change in the fluorescence effect observed with the naked eye. Therefore, when using 5 μL of the RPA amplification products, the best fluorescence detection effect can be achieved. At the same time Figure 5 B of Figure 5 also proves that when using 5 μL of the RPA amplification products, the fluorescence detection value can react and reach a relatively high fluorescence value in a short time. Therefore, 5 μL of the RPA amplification products is selected for subsequent RPA-CRISPR / Cas12 reactions.
[0071] IV. Optimization of CRISPR / Cas12a reaction time
[0072] Take ddH2O, NDV 10 -2 、10 -3 、10 -4 、10 -5 cDNA dilution as templates for RPA amplification reactions (reaction system: 29.4 μL A Buffer, 2 μL of 10 μM forward primer NDV-F-RPA-F1, 2 μL of 10 μM reverse primer NDV-F-RPA-R2, 12.1 μL ddH2O, and template DNA at the concentration to be measured; reaction conditions: 37 °C, 20 min), and obtain RPA amplification products.
[0073] Take the RPA amplification products and perform CRISPR / Cas12a reactions (reaction system: 2 μL of 10x Buffer buffer, 1 μL of crRNA sequence with a concentration of 10 μM, 1 μL of 10 μM ssDNA probe, 1.5 μL of 1 μM Cas12a enzyme, 5 μL of RPA amplification products, and finally make up to 20 μL with ddH2O; reaction conditions: 37 °C, the time to be measured / min). During the reaction process, take out the reaction samples at 5, 10, 15, 20, 25, and 30 min and observe and record them under a blue light instrument. The results are as Figure 6 shown. When the reaction time reaches 20 min, during subsequent reactions, the fluorescence effect observed with the naked eye will not increase with the increase of time. Therefore, 20 min is selected as the subsequent CRISPR / Cas12 reaction time.
[0074] In summary, the optimized CRISPR / Cas12a reaction system was finally combined with the RPA amplification reaction to establish the optimal RPA-CRISPR / Cas12a reaction system. The optimal RPA-CRISPR / Cas12a reaction system is as follows:
[0075] (1) The specific RPA reaction system is as follows:
[0076] 29.4 μL of A Buffer, 2 μL of 10 μM forward primer NDV-F-RPA-F1, 2 μL of 10 μM reverse primer NDV-F-RPA-R2, 12.1 μL of ddH2O, and 2 μL of template cDNA solution were mixed well and quickly placed into a PCR reaction tube containing dry enzyme. After dissolving the dry enzyme, finally 2.5 μL of MgOAC (B Buffer) was added to the reaction tube and mixed thoroughly. After mixing, the reaction solution was flicked (or quickly centrifuged) to the bottom of the reaction tube and reacted at 37 °C for 20 min. After the reaction, the corresponding RPA amplification product was obtained.
[0077] (2) The specific CRISPR / Cas12a reaction system is as follows:
[0078] Take 2 μL of 10x Buffer buffer, 1 μL of 10 μM crRNA sequence, 1 μL of 10 μM ssDNA probe sequence, 1.5 μL of 1 μM Cas12a enzyme, 5 μL of RPA amplification product, and finally make up to 20 μL with ddH2O and mix well. After mixing, the reaction solution was flicked (or quickly centrifuged) to the bottom of the reaction tube and reacted at 37 °C for 20 min.
[0079] Example 4 Establishment of a detection kit for Newcastle disease virus based on RPA-CRISPR / Cass12a
[0080] (1) Extract the genomic RNA of the pharyngeal swab of the suspected poultry infected with Newcastle disease virus and perform reverse transcription to obtain genomic cDNA solution;
[0081] (2) Using the genomic cDNA solution as a template, perform RPA amplification reaction using the RPA reaction system in Example 3 to obtain RPA amplification product;
[0082] (3) CRISPR / Cas12a detection
[0083] Take the RPA amplification product in step (2) for CRISPR / Cas12a reaction, perform fluorescence detection reaction according to the optimal CRISPR / Cas12a reaction system in Example 3, place the reaction test tube into the fluorescence detector for reaction, and finally obtain the result of fluorescence detection. Finally, the CRISPR / Cas12a reaction test tube was placed under a blue light instrument for irradiation, and the fluorescence result was observed with the naked eye.
[0084] Example 5 Analysis of Specificity and Sensitivity of RPA-CRISPR / Cas12a Detection Method
[0085] I. Specificity Analysis
[0086] (1) Preparation of genomic DNA samples of different virus nucleic acid samples: Use a nucleic acid extraction kit to extract the virus nucleic acid samples to obtain a total genomic DNA / RNA solution. Then, use reverse transcription reagents to reverse transcribe the viral genomic RNA to obtain a cDNA solution of the RNA virus nucleic acid samples.
[0087] (2) Take the total DNA / cDNA solutions of the different virus nucleic acid samples prepared in (1) as templates, and follow the operation in (2) of Example 4
[0088] (3) Perform RPA-CRISPR / Cas12a reaction according to the operation in step (3). The results are as Figure 7 shown Figure 7 When performing naked-eye fluorescence observation in A of Figure 7 , except for Newcastle disease virus, there is no obvious visible fluorescence for other disease viruses. In B of
[0089] II. Sensitivity Analysis
[0090] Use the RPA-CRISPR / Cas12a detection kit established in Example 4 to detect clinical Newcastle disease virus samples and standard plasmids containing the target sequence respectively. At the same time, use PCR or qPCR to detect the same site (the universal primer sequences of PCR and qPCR are shown in Table 3) to verify its sensitivity.
[0091] Table 3
[0092] Sequence Name Sequence (5'-3') NDV-F-target-F (Forward Primer) GTTACATCAAATTCTCCACT(SEQ ID NO.14) NDV-F-target-R (Reverse Primer) GCTTGCATGTATTCAAAGAC(SEQ ID NO.15)
[0093] (1) Sensitivity analysis of clinical Newcastle disease virus samples
[0094] Preparation of cDNA stock solution of clinical NDV samples: Use a nucleic acid extraction kit to extract NDV nucleic acid samples to obtain a total NDV RNA solution. Then, use reverse transcription reagents to perform reverse transcription to obtain a cDNA stock solution of NDV nucleic acid samples. Dilute the cDNA stock solution of NDV nucleic acid samples at a 10-fold gradient concentration to 10 -10 .
[0095] Take 10 -1 -10 -10Using the cDNA dilution of the NDV nucleic acid sample with a concentration of Figure 10 as a template, a PCR amplification reaction was carried out (the amplification primers, reaction system and conditions were as follows: (1) Amplification primers: The forward primer was as shown in SEQ ID NO.14; the reverse primer was as shown in SEQ ID NO.15; (2) Reaction system: 25 μL of DNATaq enzyme, 2.5 μL of each corresponding primer pair at 10 μM (i.e., 2.5 μL of forward primer, 2.5 μL of reverse primer), 2.5 μL of NDV cDNA template, and made up to 50 μL with ddH2O; (3) Reaction conditions: Pre-denaturation at 95 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, for 35 cycles; finally extension at 72 °C for 5 min and stored at 4 °C). The results were as -3 shown. It was found that there was still a band in the 4th lane at the lowest, that is, the PCR could be detected down to 10
[0096] Take 10 -1 -10 -7 of the concentration of the cDNA dilution of the NDV nucleic acid sample as a template, and a fluorescence quantitative PCR (qPCR) reaction was carried out. The negative control used ddH2O as a template.
[0097] The specific qPCR reaction system was as follows: 10 μL of 2×Taq Pro Unversal SYBR qPCR MASTER Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 1 μL of the cDNA dilution of the NDV nucleic acid sample, and made up to 20 μL with ddH2O. Among them, the forward primer was as shown in SEQ ID NO.14; the reverse primer was as shown in SEQ ID NO.15. The DNA dilutions of the NDV nucleic acid samples with different concentrations were used for three replicate reactions. After the reaction samples were prepared, they were put into a qPCR instrument for detection.
[0098] The program was set as follows: Pre-denaturation at 95 °C for 1 min, cyclic reaction at 95 °C for 10 s, 60 °C for 20 s, for a total of 39 cycles, and finally a melting curve was added: 95 °C for 15 s, 65 °C for 5 s, 95 °C for 15 s.
[0099] The results were as Figure 9 shown. It can be seen that the qPCR can be detected down to 10 -3 of the cDNA dilution.
[0100] 1) Take 10 -1 -10 -7 of the concentration of the cDNA dilution of the NDV nucleic acid sample as a template, and carry out the RPA-CRISPR / Cas12a reaction according to the operations in steps (2) and (3) of Example 4. The results were as Figure 8 shown. The RPA-CRISPR / Cas12a could be detected down to 10-6 a cDNA dilution, and Figure 11 obvious fluorescence can be seen.
[0101] In summary, the sensitivity of the RPA-CRISPR / Cas12a detection reaction is 1000 times that of ordinary qPCR and PCR detection.
[0102] (2) Sensitivity analysis of standard plasmids
[0103] The target gene was inserted into pUC57, and the pUC57-NDV plasmid and glycerol bacteria were synthesized by Sangon Biotech. After diluting the synthesized plasmid, it was measured by a spectrophotometer to be a plasmid standard with a concentration of 10 ng / μL for standby. According to the formula, the copy number of the plasmid standard with a concentration of 10 ng / μL was calculated to be 3×10 9 copies / uL. It was serially diluted 10-fold until it was diluted to single copy per microliter, that is, 10 9 -10 0 copies / uL.
[0104] 1) Take 10 9 -10 0 copies / uL dilution for PCR amplification reaction, and the results are as shown in Figure 14 . It can be seen that there are still bands in the lowest lane 4, that is, the lowest detection concentration of PCR can reach 10 4 copies / μL.
[0105] 2) Take 10 9 -10 0 copies / uL dilution for qPCR amplification reaction, and the results are as shown in Figure 13 . It can be seen that the lowest is 10 2 copies / uL and the CT value ≤ 34, that is, the lowest detection concentration of qPCR can reach 10 2 copies / μL.
[0106] 3) Take 10 6 -10 0 copies / uL dilution for RPA-CRISPR / Cas12a detection reaction, and the final reaction results are as shown in Figure 12 . It can be seen that the lowest detection concentration of RPA-CRISPR / Cas12a fluorescence detection can reach 10 1 copies / μL. As can be seen from Figure 15 : The plasmid with 10 1 copies / μL has obvious fluorescence.
[0107] In summary, the sensitivity of the RPA-CRISPR / Cas12a detection reaction can reach as low as 101 copies / μL, which is better than the detection limit of ordinary qPCR detection and 1000 times the sensitivity of ordinary PCR detection.
[0108] Detection of Clinical Samples in Example 6
[0109] This example aims to further verify the application effect of the established method in clinical practice. Specifically, the 50% tissue culture infective dose (TCID 50 ) of the epidemic strains collected clinically was determined by using different detection methods, and the results of conventional ordinary PCR, the gold standard real-time fluorescence quantitative PCR (qPCR), and the recombinase polymerase amplification-CRISPR / Cas12a (RPA-CRISPR / Cas12a) detection methods were compared to determine the application effect of the established method in clinical detection.
[0110] 1. Clinical Sample Processing and Preparation of cDNA Stock Solution
[0111] The allantoic fluid of the clinical sample strains isolated in the laboratory was serially diluted 10-fold, and 10 -5 -10 -10 dilution was inoculated into a 24-well culture plate of DF-1 cells. After 1 h of inoculation, the supernatant was discarded and replaced with DMEM medium containing 2% fetal bovine serum (FBS). After 48 h of incubation, the viral genome in the culture supernatant was extracted using a viral DNA / RNA extraction kit. Subsequently, the viral genome was reverse transcribed using a reverse transcription kit to obtain the cDNA stock solution of the clinical sample strains.
[0112] 2. Different Detection Methods and Results
[0113] Conventional ordinary PCR detection: The cDNA solution of the clinical sample strains extracted was subjected to PCR amplification (the amplification method is shown in Example 5), and the results are as shown in Figure 16 A of. After calculation, the TCID 50 titer determined by this method was 10 -7 (Table 4).
[0114] Gold standard qPCR detection: The cDNA solution of the clinical sample strains extracted was detected by using the gold standard qPCR (the amplification method is shown in Example 5), and the results are as shown in Figure 16 B of. After calculation, the TCID 50 titer measured by this method was 10 -7.5 (Table 4).
[0115] RPA-CRISPR / Cas12a detection: The cDNA solution of the clinical sample strains extracted was detected by using the RPA-CRISPR / Cas12a method provided by the present invention, and the results are as shown inFigure 16 as shown in C-D. After calculation, the TCID 50 titer measured by this method is also 10 -7.5 (Table 4).
[0116] Table 4
[0117]
[0118] In summary, the accuracy of the RPA-CRISPR / Cas12a detection method provided by the present invention in clinical detection is completely consistent with the current gold standard qPCR and is superior to the conventional ordinary PCR method. This indicates that the RPA-CRISPR / Cas12a detection method established by the present invention has good effects and reliability in clinical practical applications.
[0119] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. An RPA primer pair, characterized in that: The nucleotide sequences thereof are shown in SEQ ID NO.6 and SEQ ID NO.
11.
2. A crRNA guide sequence, characterized in that Its nucleotide sequence is shown in SEQ ID NO.
1.
3. A kit for visual detection of Newcastle disease virus based on the RPA-CRISPR Cas12a system, characterized in that: The kit comprises the RPA primer pair according to claim 1, the crRNA guide sequence according to claim 2, the Cas12a enzyme and the ssDNA fluorescent probe.
4. The kit according to claim 3, characterized in that The nucleotide sequence of the ssDNA fluorescent probe is: 5'-FAM-TTTATTT-BHQ1-3'.
5. The kit according to claim 3, characterized in that The kit further includes A Buffer, B Buffer, enzyme dry powder and ddH2O.
6. A method for rapid detection of Newcastle disease virus for non-diagnostic purposes, characterized in that: The following steps are involved: Using the genomic cDNA of the sample to be tested as a template, an RPA amplification reaction is performed to obtain an RPA amplification product; the RPA amplification product is subjected to a CRISPR / Cas12a reaction according to the CRISPR / Cas12a reaction system, and the reaction conditions are: 37° C., 20 min, to obtain a CRISPR / Cas12a reaction solution; if the CRISPR / Cas12a reaction solution has fluorescent brightness, the sample to be tested contains Newcastle disease virus.
7. The detection method according to claim 6, characterized in that: The reaction system of the RPA amplification includes: 29.4 μL A Buffer, 2.5 μL B Buffer, 2 μL 10 μM forward primer as shown in SEQ ID NO.4, 2 μL 10 μM reverse primer as shown in SEQ ID NO.9, 12.1 μL ddH2O and 2 μL template DNA.
8. The detection method according to claim 6, characterized in that: The reaction conditions of the RPA amplification are: 37° C., 20 min.
9. The detection method according to claim 6, characterized in that: The CRISPR / Cas12a reaction system includes: 2 μL of 10xBuffer buffer, 1 μL of a crRNA sequence with a concentration of 10 μM as shown in SEQ ID NO.1, 1 μL of a ssDNA probe sequence with a concentration of 10 μM, 1.5 μL of a Cas12a enzyme with a concentration of 1 μM, and 5 μL of an RPA amplification product, and finally ddH2O is used to make up 20 μL.
10. Use of the RPA primer pair according to claim 1, the crRNA guide sequence according to claim 2, the kit according to any one of claims 3-5, or the detection method according to any one of claims 6-9 in detecting Newcastle disease virus for non-diagnostic purposes.
Citation Information
Patent Citations
Nucleic acid quantitative determination kit, detection method, primers and probes for Newcastle disease virus (NDV)
CN102417935B
Newcastle disease novel visualized room temperature recombinase ploymerase amplication nucleic acid test strip detection kit and applications
CN108841996A
RPA-CRISPR-Cas12a-based kit for visually detecting Getah virus and application of RPA-CRISPR-Cas12a-based kit
CN116356079A
Newcastle disease virus virulent nucleic acid CRISPR-Cas13a detection system, RPA primer pair and crRNA
CN117448495A
Rapid detection kit for pigeon Newcastle disease virus and application
CN117844983A