Primer group for PMAxxTM-qPCR of infectious PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) and detection kit thereof
Through the PMAxxTM-qPCR method, the photolysis reaction of PMAxxTM dye is combined with the PMAxxTM dye, and the problem of being difficult to accurately distinguish infectious and non-infectious PRRSV in the prior art is solved, and the rapid and accurate infectious PRRSV detection is achieved, reducing the occurrence of false positive results.
Patent Information
- Application Number
- CN202510484216.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to accurately distinguish infectious and non-infectious PRRSV, resulting in false positive results and affecting disease prevention and control and breeding management.
The PMAxxTM-qPCR method was used to design specific primer sets and fluorescent probes, and combine the photolysis reaction of the PMAxxTM dye to distinguish infectious and non-infectious PRRSV.
It realizes rapid and accurate diagnosis and quantitative detection of infectious PRRSV, reduces the occurrence of false positive results, and improves the accuracy of disease prevention and control.
Smart Images

Figure CN120210430A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of PRRSV nucleic acid detection, and specifically relates to a primer set for PMAxx TM -qPCR for infectious PRRSV and a detection kit thereof. Background Art
[0002] Porcine reproductive and respiratory syndrome (PRRS) is a viral infectious disease mainly characterized by reproductive disorders and respiratory symptoms caused by porcine reproductive and respiratory syndrome virus (PRRSV). Since some diseased pigs show cyanosis of the ears, the disease is also commonly known as blue ear disease. Blue ear disease was first discovered in North Carolina, USA in 1987. In 1996, classical PRRSV (CH-1a) was first isolated in China. So far, PRRS in China presents a complex situation of diversified infections with vaccine strains, HP-PRRSV, NADC30-like, NADC34-like and their recombinant strains. Due to the easy variation of PRRSV pathogens and the presence of antibody-dependent enhancement, the prevention and control of the disease are very complex and difficult. The protective effect of PRRSV inactivated vaccine is not strong, and there are problems such as virus spreading, increased virulence and immunosuppression in attenuated live vaccines, and the clinical application is not ideal. Therefore, early, rapid and accurate diagnosis of PRRS is of great significance for the prevention and control of the disease.
[0003] At present, molecular biological detection of PRRSV often uses methods such as qPCR, dPCR, isothermal amplification, etc. However, these methods can only detect the viral nucleic acid contained in the sample, and cannot indicate whether PRRSV has a complete envelope, capsid structure and infectivity. A nucleic acid detection positive sample does not necessarily represent the infectivity of the virus. After treatment with disinfectants, or due to too long virus exposure time or high temperature inactivation, nucleic acid detection positive - "false positive" will also occur. In fact, pigs contacting such "false positive" PRRSV samples will not cause PRRSV infection.
[0004] However, the appearance of nucleic acid detection "false positive" will seriously affect the authenticity of the results data such as the risk assessment of PRRSV, daily biosafety monitoring, purification and elimination of breeding pig farms, delay the introduction and purification time of farms, may lead to incorrect elimination of breeding pigs, and affect the breeding benefits and efficiency. Therefore, excluding "false positive" and detecting infectious PRRSV is very important.
[0005] Traditional methods for detecting infectious viruses include plaque assay, TCID 50 , enzyme treatment-qPCR, ICC-qPCR, etc. Their disadvantages are as follows:
[0006] 1. Plaque assay and TCID50 They all rely on cell culture, which is time-consuming and laborious. The result determination is subjective, with large operator errors, and it cannot be applied to the judgment of viral infectivity without cytopathic effect.
[0007] 2. Since proteases and nucleases are relatively large in size, enzyme treatment-qPCR can only effectively distinguish non-infectious viruses with severely damaged viral envelopes and capsids that allow the entry of enzymes.
[0008] 3. (Integrated) cell culture–qPCR (integrated cell culture quantitative PCR, ICC-qPCR) utilizes the characteristic that only infectious viruses can infect host cells and replicate, and combines qPCR to examine the result of the initial adsorption of infectious viruses into cells. However, it has not divorced from cell culture and still takes 2-3 days to complete the detection. Moreover, there is still a controversy over whether PBS can completely remove the nucleic acids of non-infectious viruses.
[0009] Different from the above traditional methods for detecting infectious viruses, vPCR is fast and sensitive. It is a detection method proposed based on the concept that nucleic acid-binding dyes and living cells have intact cell membranes, and can perform qualitative and quantitative analysis of living microorganisms. Commonly used nucleic acid-binding dyes include ethidium monoazide (EMA), propidium monoazide (PMA), and its improved version PMAxx TMand PEMAX, etc. These biologic dyes do not have cell membrane permeability and can only selectively modify the DNA of dead cells. After the DNA modified by the dye is photolyzed, the photoreactive azide group on the dye is converted into a highly reactive nitrene free radical, which forms a stable covalent carbon-nitrogen bond by inserting into the C-H bond of the DNA binding site, resulting in permanent DNA modification. This modification process makes the DNA insoluble and causes the modified DNA to be removed during subsequent DNA extraction, as well as inhibits the amplification process of subsequent PCR (Bellehumeur et al 2015, Sun Miaomiao 2019). As early as the 1970s and 1980s, scientists prepared azide compounds for photoaffinity labeling of DNA (Coffman et al 1982, DeTraglia et al 1978, Hixon et al 1975). In 2003, Nogva et al (Nogva et al 2003) established an EMA-PCR method to distinguish dead bacteria and live bacteria. Although this technology is promising, subsequent scientists found that EMA is also prone to penetrate the cell membrane of live cells, resulting in the loss of DNA of some live bacteria and false negative results. Based on this, in 2006, Nocker et al (Nocker et al 2006), scientists from Biotium, tested and developed a new alternative - PMA. PMA is similar to the traditional non-permeable membrane fluorescent dye propidium iodide, but has an additional azide group that allows cross-linking with DNA under light illumination. It was found that PMA has the important advantage of not penetrating live cells compared to EMA. The reason for its significantly improved selectivity for live cells is likely related to the higher charge of the molecule (EMA has one positive charge, PMA has two). Subsequently, PMA has been widely used in many fields such as bacteria, fungi, and viruses. However, neither EMA nor PMA can completely inhibit the DNA signal in dead cells, resulting in false positive results and overestimating the microbial risk. Aiming to improve this, researchers have carried out a large number of optimizations and validations on the variables and parameters of vPCR, including improving plastic microtubes, improving active dyes, using reagent enhancers, optimizing the dark incubation temperature and time, etc., to improve the accuracy and repeatability of vPCR. PEMAX is a mixed reagent containing EMA and PMA, integrating the different characteristics of EMA and PMA, which not only improves the strength of DNA binding, but also improves the detection ability for cells with intact membranes and no metabolic activity, PMAxx TM is an improved version of PMA. It has the same spectral characteristics and is more effective than PMA in distinguishing live and dead cells by vPCR.
[0010] Currently, there is no PMAxx for infectious PRRSV N gene TM-qPCR detection method. Due to the discontinuous transcription mechanism of PRRSV, the PRRSV N gene has a higher abundance in the PRRSV genome, which is more conducive to the early diagnosis of PRRSV. Summary of the Invention
[0011] The object of the present invention is to overcome the deficiencies of the prior art and provide a PMAxx TM -qPCR universal detection kit for infectious PRRSV and its application; the kit of the present invention can quantitatively monitor infectious PRRSV, can achieve rapid and accurate diagnosis and quantification of infectious PRRSV, is conducive to the early diagnosis of PRRSV, and has great commercial value.
[0012] To achieve the above object, the technical solution designed by the present invention is as follows:
[0013] The present invention provides a primer set for PMAxx TM -qPCR for infectious PRRSV, the primer set includes a pair of primer pairs PRRSV ORF67-UTR’3F / 3R and a fluorescent probe P; wherein, the sequences of the primer pair PMA-F / R are as follows:
[0014] PRRSV ORF67-UTR’3F: AGAAGCCCCATTTCCCTCTA, as shown in SEQ ID No.2,
[0015] PRRSV ORF67-UTR’3R: CGTCGGCAAACTAAACTCCAC, as shown in SEQ ID No.3;
[0016] The sequence of the fluorescent probe P is as follows: CTGACAGGGCACAAGTTCCAGCAC, as shown in SEQ ID No.4.
[0017] Furthermore, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quenching group.
[0018] Still further, in the fluorescent probe, the fluorescent reporter group is FAM; the fluorescent quenching group is BHQ1.
[0019] The present invention also provides a TaqMan fluorescence quantitative kit for rapidly detecting infectious PRRSV, and the fluorescence quantitative kit includes the above primer set.
[0020] Furthermore, the TaqMan fluorescence quantitative kit further includes One Step U+Enzyme Mix, 2x OneStep U+Mix, PMAxx TM dye solution, positive control product and negative control product.
[0021] Further, the positive control is a standard product of the target fragment containing the PRRSV N gene, and the negative control is DEPC water.
[0022] The present invention also provides a method for rapidly detecting infectious PRRSV with the above TaqMan fluorescence quantitative kit, comprising the following steps:
[0023] 1) Collect the sample to be detected and divide the sample to be detected into three samples for standby;
[0024] 2) Add PMAxx TM staining solution to the first sample, inactivate the second sample at 98 °C and then add PMAxx TM staining solution, and add DEPC water (without inactivation, as a control) to the third sample;
[0025] 3) Simultaneously place the three samples processed in step 2) on a shaker for dark incubation, and then perform photolysis on a photolysis device for standby;
[0026] 4) Then extract the nucleic acids of the three samples respectively, perform qPCR amplification using the primer set in the kit, and obtain the Ct values of the three samples to be detected, which are respectively:
[0027] The Ct value of the first sample (PMAxx TM staining solution) is denoted as Ct1;
[0028] The Ct value of the third sample (DEPC water) is denoted as Ct2;
[0029] The Ct value of the second sample (inactivated and added with PMAxx TM staining solution) is denoted as Ct3;
[0030] 5) Perform interpretation and judgment analysis based on the above Ct values. Further, in step 5), the interpretation and judgment are marked as follows:
[0031] a. Nucleic acid detection judgment:
[0032] When Ct2 ≤ 37 and there is a typical S-shaped amplification curve, it indicates that the nucleic acid detection of the sample is positive, and further infectiousness judgment is performed according to requirements;
[0033] Or, when there is no Ct value or no typical S-shaped curve in the detection result, it indicates that the nucleic acid detection of the sample is negative;
[0034] Or, when 37 < Ct2 ≤ 40, the sample to be detected should be retested. If the result of the repeated experiment is still 37 < Ct2 ≤ 40 and there is a typical S-shaped amplification curve, it is determined to be positive, and further infectiousness judgment is performed, otherwise it is negative;
[0035] b. Infectivity judgment:
[0036] When ΔCt = (Ct1 - Ct2) ≥ 10, it indicates that the sample to be tested is not infectious;
[0037] Or, when ΔCt = (Ct1 - Ct2) < 10 and Ct2 > 23, it indicates that the sample to be tested may also not be infectious and further judgment is required (further judgment may exceed the PMAxx TM -qPCR quantification range);
[0038] Or, when ΔCt = (Ct1 - Ct2) < 10 and Ct2 ≤ 23, it indicates that the sample to be tested is infectious, and further analysis of the proportion of infectious virus is carried out according to the requirements.
[0039] c. Analysis of the proportion of infectious virus:
[0040] Calculate the proportion of infectious virus contained in the sample to be tested according to the formula (Ct3 - Ct1) / (Ct3 - Ct2) * 100%.
[0041] Furthermore, in step 2), the concentration of the PMAxx TM staining solution is 100 μM;
[0042] In step 3), the dark incubation time is 10 min and the photolysis time is 20 min.
[0043] The present invention also provides an application of the above TaqMan fluorescence quantitative kit in judging the disinfection effect of disinfectants.
[0044] According to the actual situation, the TaqMan fluorescence quantitative kit can make different judgment analyses according to different samples.
[0045] Advantages of the present invention:
[0046] The present invention adopts a one-step method to ensure the same reverse transcription efficiency, uses a trace virus RNA extraction kit to ensure the stability and reliability of the processing results of different batches, and ensures the detection of low-copy virus nucleic acids. Description of the drawings
[0047] Figure 1 It is the agarose gel electrophoresis result diagram of the target fragment;
[0048] Figure 2 It is the sequencing result diagram of the target fragment;
[0049] Figure 3 It is the BLAST alignment result diagram of the target fragment;
[0050] Figure 4 It is the result graph of ddPCR;
[0051] Figure 5 It is the schematic diagram of the CPE phenomenon of PRRSV-infected cells
[0052] In the figure, A is the micrograph of normal Marc-145 cells (100×);
[0053] B is the micrograph of Marc-145 cells (100×) after being infected with PRRSV;
[0054] Figure 6 It is the electrophoresis graph of the identification result of PRRSV stock solution;
[0055] In the figure, M: DL 2000 DNA Maker; 1: PCR product of PRRSV stock solution; 2: negative control;
[0056] Figure 7 It is the result graph of the screening of effective water bath inactivation temperature of PRRSV;
[0057] Figure 8 It is the result graph of the standard curves of three pairs of primer-probe groups,
[0058] In the figure, A is the standard curve graph of the 88BP primer-probe group,
[0059] B is the standard curve graph of the 142BP primer-probe group,
[0060] C is the standard curve graph of the 173BP primer-probe group;
[0061] Figure 9 It is the result graph of the primer screening of three pairs of primer-probe groups;
[0062] Figure 10 It is the result graph of the tissue specificity test of PRRSV TaqMan qPCR;
[0063] In the figure, 1: PRRSV amplification curve; 2 - 8: PRRSV-negative porcine kidney, lymph node, liver, spleen, anticoagulated whole blood, nasal swab, anal swab; NC: negative control (ddH2O);
[0064] Figure 11 It is the result graph of the specificity test of PRRSV TaqMan qPCR;
[0065] In the figure, 1: PRRSV positive control product amplification curve; 2 - 5: amplification results of ASFV, PRV, PPV, PCV2; NC: negative control (ddH2O);
[0066] Figure 12 It is the result graph of the sensitivity test of PRRSV TaqMan qPCR;
[0067] Figure 13 Schematic diagram of Ct values of nucleic acid amplification of infectious and heat-inactivated PRRSV pretreated with different PMAxxTM concentrations;
[0068] Figure 14 Schematic diagram of Ct values of nucleic acid amplification of infectious and heat-inactivated PRRSV treated with different dark incubation times;
[0069] Figure 15 Schematic diagram of Ct values of nucleic acid amplification of infectious and heat-inactivated PRRSV treated with different photolysis times;
[0070] Figure 16 Schematic diagram of the method for rapid detection of infectious PRRSV using TaqMan fluorescence quantitative kit;
[0071] Figure 17 Histogram of ΔCt values of TaqMan fluorescence quantitative kit for rapid detection of infectious PRRSV to determine the mixture of infectious and inactivated PRRSV;
[0072] Figure 18 Relationship diagram between PRRSV titer and PRRSV TaqMan qPCR Ct value;
[0073] Figure 19 Detection result diagram of four disinfectants inactivating PRRSV by ICC-qPCR,
[0074] In the figure, GA: glutaraldehyde; OXONE: potassium peroxymonosulfate compound salt; BB: benzalkonium bromide; PVP-1: povidone iodine;
[0075] Figure 20 Detection result diagram of four disinfectants inactivating PRRSV by PMAxxTM-qPCR,
[0076] In the figure, Hard Water: standard hard water control group; GA: glutaraldehyde; OXONE: potassium peroxymonosulfate compound salt; BB: benzalkonium bromide; PVP-1: povidone iodine. Detailed implementation mode
[0077] The present invention will be further described in detail below in conjunction with specific embodiments for those skilled in the art to understand.
[0078] Example 1 Preparation of standard quality control products and mixed samples
[0079] I. Primer design and preparation of target fragment standard quality control products
[0080] Using the conserved region of Porcine reproductive and respiratory syndrome virus type 2 WH3 strain as the target gene (the accession number of the PRRSV-2 full genome sequence is HM853673.1 in the NCBI database), common PCR primers were designed. The common PCR primers are as follows:
[0081] F: TTGCTAGGCCGCAAGTACATTCT,
[0082] R: GCATGGTTCTCGCCAATTAAACT;
[0083] Performing PCR amplification to obtain a target fragment with a product length of 720 bp. The specific steps are as follows:
[0084] 1. RNA extraction:
[0085] Extract PRRSV RNA according to the commercial virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.).
[0086] 2. Reverse transcription to obtain PRRSV cDNA. The reverse transcription program is as follows:
[0087] ① Genomic DNA removal
[0088] Add 11 μL of RNase-free ddH2O, 4 μL of 4x gDNA wiper Mix, and 1 μL of template RNA into an RNase-free centrifuge tube. Pipette and mix well, and incubate at 42°C for 2 min. The reverse transcription reagent is purchased from Nanjing Novoprotein Scientific Co., Ltd.
[0089] ② Reverse transcription reaction system
[0090] Directly add 4 μL of 5x HiScriptⅡqRT SuperMixⅡ into the reaction tube in step ① to a total volume of 20 μL. Gently pipette and mix well, and perform reverse transcription reaction at 50°C for 15 min and 85°C for 5 sec;
[0091] 3. PCR amplification. The specific program is as follows:
[0092] The common PCR reaction system is: 12.5 μL of 2x Taq Plus Master MixⅡ (Dye Plus), 1 μL of upstream primer, 1 μL of downstream primer, 9.5 μL of ddH2O, and 1 μL of PRRSV cDNA template. The common PCR enzyme is purchased from Nanjing Novoprotein Scientific Co., Ltd.
[0093] Amplification program: Pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s; annealing at 60°C for 20 s; extension at 72°C for 1 min, 35 cycles, final extension for 7 min
[0094] Agarose gel electrophoresis: Prepare 1.5% agarose (containing goldview dye) with TAE buffer. Place the gel in a horizontal electrophoresis tank so that the electrophoresis solution just covers the gel surface by about 1 mm. The sample loading volume is 15 μL, and electrophoresis is carried out at 120 V for 20 - 30 min. After completion, observe the results in an agarose imaging system and cut the gel for recovery (as Figure 1 shown). The results showed that a target band was visible at about 720 bp, which was consistent with the expectation. Cut the gel and recover it as the standard for the target fragment.
[0095] 4. Sequencing:
[0096] Send the PCR product to the company for sequencing. The sequencing results are as follows: all are single peaks, the results are reliable, and the target gene sequence is compared with the sequencing results by BLAST( Figure 2 ).
[0097] The results showed that the target sequence was consistent with the sequencing results, and its nucleic acid similarity was 99%( Figure 3 ); the nucleotide sequence of its target gene (the target gene contains a segment of PRRSV ORF6, a segment of ORF7, and a part of the UTR3 sequence) is shown in SEQ ID No.1.
[0098] 5. After the target fragment standard is recovered by gel, the concentration of the standard is measured by two methods
[0099] Method 1: Detect the concentration of the standard with a UV spectrophotometer. The concentration of the gel-recovered standard measured by the UV spectrophotometer is 10.71 ng / μL; according to the copy number calculation formula, the concentration of this standard is 1.36^10 10 copies / μL.
[0100] Method 2: Detect the concentration of the standard by ddPCR
[0101] Table 1 Results of measuring the concentration of the standard by dPCR
[0102]
[0103] As Figure 4 and Table 1 show: The concentration of this standard is 923.3857 copies / μL.
[0104] It can be seen from the above that the difference between the digital quantification and the copy number calculated from the concentration measured by the UV spectrophotometer is not significant. The copy number calculated by the UV spectrophotometer is accurate and reliable. Dilute the standard 10-fold gradient as a template and store it at 4°C for standby.
[0105] II. Preparation of Mixed Samples of Inactivated PRRSV and Infectious PRRSV
[0106] Since the focus of this invention is to distinguish inactivated PRRSV from infectious PRRSV, quality control products of inactivated PRRSV and infectious PRRSV are required.
[0107] As Figure 5 shown: By culturing Marc-145 cells, inoculating PRRSV, and clarifying the CPE phenomenon after PRRSV infects Marc-145 cells, which is manifested as the cells showing ridge-like lesions, and then stretching, aggregating, rounding, and shedding ( Figure 5 ).
[0108] Subsequently, the virus was harvested, and the virus stock solution was identified using the PRRSV-2 common PCR primers of GB / T 18090-2023. The gel electrophoresis result was equivalent to the expected fragment size, and the virus was identified as PRRSV-2 (American type) ( Figure 6 ).
[0109] Next, different water bath temperatures were used to inactivate the PRRSV WH3 virus solution at 10 8.42 TCID 50 / mL,
[0110] Grouping for inoculating six-well plates: 60 °C inactivation for 15 min group, 70 °C inactivation for 15 min group, 98 °C inactivation for 15 min group, infectious PRRSV positive control group, DMEM negative control group
[0111] Combined with the medium color and inverted microscope observation of lesions. The result of inoculating cells after inactivation at 98 °C for 15 min was equivalent to the negative control result, and no CPE was observed under the microscope. Finally, the effective inactivation condition of PRRSV was determined to be inactivation in a water bath at 98 °C for 15 min ( Figure 7 ).
[0112] Thus, the inactivated PRRSV and infectious PRRSV were mixed in different ratios according to Table 2 below to prepare mixed samples for subsequent experiments.
[0113] Table 2
[0114]
[0115] Example 2 Establishment of a PRRSV Taqman Fluorescent Quantitative PCR Method Suitable for PMAxx TM
[0116] 1. Design and Evaluation of Primers and Probes
[0117] PMAxx TM As an aryl azide compound, it photolyzes into aryl nitrene, randomly inserts into the C-H bond to form a stable covalent carbon-nitrogen bond, thereby causing permanent nucleic acid modification and preventing PCR amplification. Due to the randomness of inserting into the C-H bond, theoretically, the longer the amplification product, the greater the probability of encountering base pairs modified by PMAxx TM during the amplification process.
[0118] According to the principle of action of PMAxx TM and the conventional Taqman primer-probe design principle, three pairs of primer-probes with different lengths were designed for the PRRSV ORF7 sequence, and the product lengths were 88bp, 142bp, and 173bp respectively; the specific sequences are shown in Table 3 below:
[0119] Table 3
[0120]
[0121] All primer-probes were synthesized by Shanghai Sangon Biotech Co., Ltd. In this example, the reporter group at the 5' end of the probe was FAM, and the quenching group at the 3' end was BHQ1
[0122] By plotting standard curves (the standard curve of the 88BP primer-probe group, the standard curve of the 142BP primer-probe group, and the standard curve of the 142BP primer-probe group), the primer-probe concentration, annealing temperature, etc. were investigated to ensure that the amplification efficiency of each primer-probe group was qualified; specifically as follows:
[0123] As Figure 8 shown: a. The standard curve of the 88BP primer-probe group is as follows:
[0124] y = -3.403x + 34.578
[0125] R 2 = 0.999;
[0126] b. The standard curve of the 142BP primer-probe group is as follows:
[0127] y = -3.355x + 38.142
[0128] R 2 = 0.999;
[0129] c. The standard curve of the 173BP primer-probe group
[0130] y = -3.369x + 40.775
[0131] R 2 = 0.999
[0132] The one-step TaqMan qPCR for the target fragment standard product template with gradient dilution was performed using three pairs of primer-probe sets shown in Table 3 for PRRSV.
[0133] The results showed that the linear equation of the copy number Log value (x) and Ct value (y) of the primer-probe set with an amplified product length of 88 BP was: y = -3.403x + 34.578, R2 = 0.999, Eff% = 96.736.
[0134] The linear equation of the copy number Log value (x) and Ct value (y) of the primer-probe set with an amplified product length of 142 BP was: y = -3.355x + 38.142, R2 = 0.999, Eff% = 98.654.
[0135] The linear equation of the copy number Log value (x) and Ct value (y) of the primer-probe set with an amplified product length of 173 BP was: y = -3.369x + 40.775, R2 = 0.999, Eff% = 98.056.
[0136] The R2 values of the standard curves of the three pairs of primer-probe sets were all 0.999, indicating good linear relationships. The amplification efficiency Eff% was between 96.736% and 98.654%, close to 100%, meeting the experimental expectations.
[0137] The amplification systems of the above three pairs of primer-probe sets were all: 2x One Step U+Mix 10 μl, One Step U+Enzyme Mix 1 μl, upstream primer (400 nM) 0.8 μL, downstream primer (400 nM) 0.8 μL, TaqMan Probe (200 nM) 0.4 μL, standard product template 4 μL, RNase-free ddH2O 3 μl. The total system was 20 μL.
[0138] The reaction procedures of the above three pairs were as follows:
[0139] 88 BP primer-probe set - pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, annealing and extension at 55°C for 30 sec, 40 cycles
[0140] 142 BP primer-probe set - pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, annealing and extension at 60°C for 30 sec, 40 cycles
[0141] 88 BP primer-probe set - pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, annealing and extension at 56°C for 30 sec, 40 cycles
[0142] The fluorescence quantitative instrument was Applied Biosystems QuantStudioTM 5 96-well plates (Thermo Fisher, USA), and the amplification curves, standard curves, and quantitative data were exported by QuantStudio TM Design&Analysis Software
[0143] 2. PMAxx TM -qPCR primer screening
[0144] Take 800 μL of the PRRSV stock solution, in quadruplicate, 200 μL each, and the groups are as follows:
[0145] ① Infectious PRRSV + PMAxx TM group;
[0146] ② Infectious PRRSV - PMAxx TM group;
[0147] ③ Heat-inactivated PRRSV + PMAxx TM group;
[0148] ④ Heat-inactivated PRRSV - PMAxx TM group.
[0149] Among them, groups ③ and ④ were inactivated at 98°C for 15 min, and PMAxx TM (biotium, USA) was added to groups ① and ③ in the dark to a final concentration of 25 μM. The same volume of DEPC water was added to groups ② and ④ as a control. Subsequently, the four groups were incubated in the dark for 10 min, photolyzed for 15 min, and PRRSV RNA was extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.). Subsequently, qPCR was performed. Three parallel experiments were carried out.
[0150] The established one-step TaqMan qPCR amplification system is as follows:
[0151] Table 4 PRRSV TaqMan qPCR amplification system
[0152]
[0153] The reaction conditions were set as follows: reverse transcription at 50°C for 15 min, pre-denaturation at 95°C for 30 sec, denaturation at 95°C for 10 sec, set the annealing temperature for each primer-probe group, annealing and extension for 30 sec, 40 cycles. Three technical replicates were performed for each group.
[0154] Basis for primer screening: PMAxx TMIt has no membrane permeability and thus only affects the nucleic acid amplification of inactivated PRRSV. Accordingly, the key evaluation index △Ct is introduced, where △Ct = Ct (+PMAxx TM ) - Ct (-PMAXX TM )
[0155] + PMAxx TM refers to the addition of PMAxx to the sample TM
[0156] - PMAxx TM refers to the sample without the addition of PMAxx TM , and DEPC water of the same volume is used as a control.
[0157] For the infectious virus groups ①②, △Ct = Ct ① - Ct ② , and the expected result is that △Ct is close to 0 (±1), indicating that the PMAxx TM treatment does not affect the nucleic acid amplification of infectious virus
[0158] For the inactivated virus groups ③④, △Ct = Ct ③ - Ct ④ , the larger △Ct is, indicating that PMAxx TM blocks more nucleic acid amplification of inactivated virus.
[0159] Such as Figure 9 The experimental results show that: for the corresponding longer amplification products, △CT [Ct (+PMAxx TM ) – Ct (-PMAxx TM ) is larger, and the 173BP primer-probe group is selected for subsequent experiments.
[0160] 3. Detection of the specificity test of the 173BP primer-probe group for infectious PRRSV
[0161] Using the Taqman fluorescence quantitative PCR method established with the above optimal amplification system and amplification conditions and applicable to PMAxx TM , the nucleic acids of PRRSV-negative porcine kidney, lymph node, liver, spleen, anticoagulated whole blood, nasal swab, and anal swab quality control products were detected.
[0162] Such as Figure 10 shown: Except for the PRRSV positive control product, there was no non-specific amplification in the others, indicating that the method has good tissue specificity.
[0163] Such as Figure 11As shown: The Taqman fluorescence quantitative PCR method established using the above optimal amplification system and amplification conditions and applicable to PMAxx TM was used to detect the nucleic acids of viruses such as ASFV, PRV, PPV, and PCV2 that are similar to and easily confused with the clinical symptoms of PRRSV. The results showed that except for the PRRSV positive control product, there was no non-specific amplification, indicating that the method has good specificity.
[0164] 4. Sensitivity test for the analysis of the 173BP primer-probe set for detecting infectious PRRSV
[0165] As Figure 12 shown: Using the target fragment standard control product with a concentration of 1×10⁸ - 1×10⁰ copies / μL as the template, the qPCR quantitative lower limit of this 173BP primer-probe set was 40 copies / reaction (with a coefficient of variation CV < 1% as the quantitative lower limit), and the lowest detection limit was 4 copies / reaction.
[0166] 5. Repeatability test for the 173BP primer-probe set for detecting infectious PRRSV
[0167] The standard products of the target fragment at three different dilution ratios (4×10⁶ copies / μL, 4×10⁵ copies / μL, 4×10⁴ copies / μL) were selected as templates, and each dilution was repeated three times as the within-group repeatability test. The between-group repeat experiment was repeated 3 times at 3 different time periods. The standard deviation and coefficient of variation (CV) were calculated based on the Ct values of each dilution ratio to evaluate the repeatability of the method.
[0168] According to the analysis of the within-group repeatability test, the coefficient of variation was between 0.25% and 0.66%; the results of the between-group repeatability test showed that the coefficient of variation was between 0.50% and 1.14%. The coefficient of variation of the repeatability test was within 2%, indicating that the method has good repeatability.
[0169] The repeatability test was carried out on the detection system, and 3 samples were selected for three parallel tests (including PMA pretreatment, nucleic acid extraction, and qPCR amplification). The repeatability results showed that the overall coefficient of variation was < 1%; indicating that the stability of PMAxx TM pretreatment and nucleic acid extraction efficiency is good.
[0170] Example 3 Optimization of the reaction conditions of PMAxx TM 1. Optimization of the PMAxx
[0171] concentration TM 800 μL of the PRRSV stock solution was taken, in quadruplicate, with each portion being 200 μL, and the groups were as follows:
[0172] ① Infectious PRRSV + PMAxx
[0173] ① Infectious PRRSV + PMAxxTM Group
[0174] ② Infectious PRRSV - PMAxx TM Group
[0175] ③ Inactivated PRRSV + PMAxx TM Group
[0176] ④ Inactivated PRRSV - PMAxx TM Group;
[0177] Among them, groups ③ and ④ were inactivated at 98 °C for 15 min, and groups ① and ③ were added with different concentrations (final concentrations were 25 μM, 50 μM, 100 μM, 200 μM) of PMAxx TM (biotium, USA) in the dark environment. Groups ② and ④ were added with the same volume of DEPC water as a control. Subsequently, the four groups were simultaneously incubated in the dark for 10 min, photolyzed for 15 min, and PRRSV RNA was extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.), and then qPCR was performed. Each concentration was in quadruplicate for re - grouping, and three parallel experiments were carried out.
[0178] The results were as Figure 13 shown: For infectious PRRSV, when the concentration of PMAxx TM increased from 25 μM to 100 μM, there was no significant difference in △CT (p > 0.05). When it continued to increase to 200 μM, the △Ct value increased significantly (p < 0.05). High PMAxx TM concentration (>200 μM) would increase the penetration of infectious PRRSV. Therefore, the optimal concentration of PMAxx TM was selected as 100 μM.
[0179] 2. Optimization of PMAxx TM Dark incubation time
[0180] Take 800 μL of the PRRSV stock solution, in quadruplicate, 200 μL each, and the groups were:
[0181] ① Infectious PRRSV + PMAxx TM Group
[0182] ② Infectious PRRSV - PMAxx TM Group
[0183] ③ Inactivated PRRSV + PMAxx TM Group
[0184] ④ Inactivated PRRSV - PMAxx TM Group;
[0185] Among them, groups ③ and ④ were inactivated at 98 °C for 15 min, and PMAxx was added to groups ① and ③ in the dark environment TM (Biotium, USA) to make its final concentration 100 μM. The same volume of DEPC water was added to groups ② and ④ as a control. Subsequently, the four groups were respectively placed on a shaker and incubated in the dark for 5 min, 10 min, 15 min, and 30 min, and then photolyzed for 15 min. The PRRSV RNA was extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.), and then qPCR was performed. Three parallel experiments were carried out.
[0186] The results are as Figure 14 shown: For infectious PRRSV, PMAxx TM does not enter the virus particles with intact envelopes and protein capsids, and the △CT is close to 0 (±1). For heat-inactivated PRRSV with incomplete envelopes and protein capsids, during the dark incubation process, PMAxx TM gradually enters the virus particles, approaches the viral nucleic acid, and covalently cross-links with it during the subsequent photolysis process, preventing the amplification of PRRSV nucleic acid dependent on RNA polymerase.
[0187] When the dark incubation time increased from 5 minutes to 10 minutes, the △CT gradually increased. Continuing to extend the time, the △CT hardly changed, indicating that PMA had completely entered the inactivated virus particles. Therefore, the dark incubation time of PMAxx TM was selected as 10 min.
[0188] 3. Optimization of PMAxx TM photolysis time
[0189] Take 800 μL of the PRRSV stock solution, in quadruplicate, with 200 μL for each. The groups are as follows:
[0190] ① Infectious PRRSV + PMAxx TM group,
[0191] ② Infectious PRRSV - PMAxx TM group,
[0192] ③ Inactivated PRRSV + PMAxx TM group,
[0193] ④ Inactivated PRRSV - PMAxx TM group;
[0194] Among them, groups ③ and ④ were inactivated at 98 °C for 15 min, and PMAxx was added to groups ① and ③ in the dark environment TM(Biotium, USA) was added to make its final concentration 100 μM. In groups ② and ④, the same volume of DEPC water was added as a control. Subsequently, the four groups were simultaneously placed on a shaker and incubated in the dark for 10 min, and then photolyzed for 5 min, 10 min, 15 min, 20 min, and 25 min respectively using a self-made high-power blue light LED photolysis device. PRRSV RNA was extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.), and then qPCR was performed. Three parallel experiments were carried out.
[0195] The results are as Figure 15 shown. Based on the largest △Ct difference and saving the detection time as much as possible, the PMAxx TM photolysis time was selected as 20 min.
[0196] Example 4 Establishment of a TaqMan fluorescence quantitative kit for rapid detection of infectious PRRSV based on optimized conditions
[0197] The TaqMan fluorescence quantitative kit for rapid detection of infectious PRRSV includes a primer set, One Step U+EnzymeMix, 2x One Step U+Mix, PMAxx TM staining solution, a positive control product, and a negative control product; among them,
[0198] The primer set includes a pair of primer pairs PRRSV ORF67-UTR’3F / 3R and a fluorescent probe P; among them, the sequences of the primer pair PMA-F / R are as follows:
[0199] PRRSV ORF67-UTR’3F: AGAAGCCCCATTTCCCTCTA, as shown in SEQ ID No.2;
[0200] PRRSV ORF67-UTR’3R: CGTCGGCAAACTAAACTCCAC, as shown in SEQ ID No.3;
[0201] The sequence of the fluorescent probe P: CTGACAGGGCACAAGTTCCAGCAC, as shown in SEQ ID No.4; the fluorescent reporter group is FAM; the fluorescent quenching group is BHQ1.
[0202] The positive control product is a target fragment standard product containing the PRRSV N gene, and the negative control product is DEPC water.
[0203] As Figure 16 shown, the method for rapid detection of infectious PRRSV using the above TaqMan fluorescence quantitative kit (PRRSVPMAxxTM -qPCR), comprising the following steps:
[0204] 1) Collect the sample to be detected and divide the sample to be detected into three samples for standby;
[0205] 2) Add PMAxx TM staining solution to the first sample, inactivate the second sample at 98 °C and then add PMAxx TM staining solution, add DEPC water to the third sample (without inactivation, as a control); and the concentration of PMAxx TM staining solution is 100 μM;
[0206] 3) Place the three samples processed in step 2) above on a shaker for dark incubation for 10 min, and then perform photolysis on a photolysis device for 20 min for standby;
[0207] 4) Then extract the nucleic acids of the three samples respectively, perform qPCR amplification using the primer set in the kit, and obtain the Ct values of the three samples to be detected, which are respectively:
[0208] The Ct value of the first sample (PMAxx TM staining solution) is denoted as Ct1;
[0209] The Ct value of the third sample (DEPC water) is denoted as Ct2;
[0210] The Ct value of the second sample (inactivated and added with PMAxx TM staining solution) is denoted as Ct3;
[0211] 5) Based on the above Ct values, perform interpretation and judgment analysis, specifically as follows:
[0212] a. Nucleic acid detection judgment:
[0213] When Ct2 ≤ 37 and there is a typical S-shaped amplification curve, it indicates that the nucleic acid detection of the sample is positive, and further infectiousness judgment is performed according to requirements;
[0214] Or, when there is no Ct value or no typical S-shaped curve in the detection result, it indicates that the nucleic acid detection of the sample is negative;
[0215] Or, when 37 < Ct2 ≤ 40, the sample to be detected should be retested. If the result of the repeated experiment is still 37 < Ct2 ≤ 40 and there is a typical S-shaped amplification curve, it is determined to be positive, and further infectiousness judgment is performed, otherwise it is negative;
[0216] b. Infectiousness judgment:
[0217] When △Ct = (Ct1 - Ct2) ≥ 10, it indicates that the sample to be detected is not infectious;
[0218] Alternatively, when △Ct = (Ct1 - Ct2) < 10 and Ct2 > 23, it indicates that the test sample may also be non-infectious and further judgment is required (further judgment is required, and it may exceed PMAxx TM -qPCR quantification range);
[0219] Alternatively, when △Ct = (Ct1 - Ct2) < 10 and Ct2 ≤ 23, it indicates that the test sample is infectious, and further analysis of the infectious virus ratio is carried out according to requirements;
[0220] c. Analysis of infectious virus ratio:
[0221] Calculate the ratio of infectious virus contained in the test sample according to the formula (Ct3 - Ct1) / (Ct3 - Ct2) * 100%.
[0222] Example 5 Evaluation of the effect of the above TaqMan fluorescence quantitative kit in distinguishing infectious PRRSV from a mixed sample of infectious and inactivated PRRSV
[0223] To verify the PRRSV PMAxx of the established TaqMan fluorescence quantitative kit TM -qPCR detection method can distinguish infectious PRRSV in some inactivated samples, such as the mixed sample prepared in Example 1. Each mixing ratio is in duplicate. One is added with PMAxx in the dark environment TM , and one is added with the same volume of DEPC water as a control. Subsequently, both groups are incubated in the dark for 10 min and photolyzed for 20 min. PRRSV RNA is extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.), and then qPCR is performed. Three parallel tests are carried out for each dilution with different mixing ratios. The diluted sample refers to diluting the virus stock solution by ten-fold serial dilution and then mixing according to the ratio.
[0224] Table 5 △Ct values of the TaqMan fluorescence quantitative kit's detection method for determining infectious and inactivated PRRSV mixtures
[0225]
[0226] Note: Indicates that no amplification occurred after 40 cycles in two of the three biological replicates; the decrease in the ΔCt value is positively correlated with the increase in the percentage of infectious virus particles within all detected concentration ranges. This detection method can detect as low as 0.5% infectious virus particles in the sample. Compared with completely inactivated PRRSV (i.e., 0% infectious PRRSV), the △Ct value of the test sample containing infectious PRRSV is significantly lower.
[0227] As shown in Table 5 and Figure 17 as shown, an increase in the proportion of infectious PRRSV in the mixed sample led to a decrease in △Ct. Even when the proportion of infectious PRRSV in the sample was as low as 0.5%, its △Ct was significantly lower than the △Ct value of 100% heat-inactivated PRRSV. However, when the virus stock solution was diluted 1000×, the results were highly random and the discrimination effect was not obvious. This indicates that PMAxx TM -qPCR has limitations in the detection range. When the nucleic acid copy number of the sample is within the range of 1.5×10 5 ~4.6×10 6 / μL, the Ct is 18 - 23, and infectious PRRRSV can be quantified more accurately. If the Ct value of the sample is within this range, it can be directly judged by comparing with the table.
[0228] Example 6 Evaluation of the effect of disinfectants on inactivating PRRSV using TaqMan fluorescence quantitative kit - PMAxx TM -qPCR and ICC-qPCR Comparison of the effects of four disinfectants on inactivating PRRSV
[0229] This part refers to the types, dosages, and action times of disinfectants mentioned in the "Disinfection Technical Specification (2002 Edition)" promulgated by the Ministry of Health of the People's Republic of China, the "Technical Specification for the Prevention and Control of Porcine Reproductive and Respiratory Syndrome (DB51 / T 2823 - 2021)" issued by the Sichuan Provincial Department of Agriculture and Rural Affairs, and the agricultural industry standard "Disinfection Technology for Livestock and Poultry Farms (NY / T 3075 - 2017)" issued by the Chinese Ministry of Agriculture and Rural Affairs. Combining the literature and the suspension method neutralizer identification test, the corresponding neutralizers and neutralization times were determined. The disinfectants and corresponding neutralizers are selected as follows:
[0230] 0.5% (v / v) glutaraldehyde (aldehyde disinfectant), corresponding neutralizer 0.5% (w / v) glycine;
[0231] 0.25% (w / v) potassium peroxymonosulfate compound (chlorine-containing disinfectant / peroxide disinfectant), corresponding neutralizer 0.5% (w / v) sodium thiosulfate;
[0232] 0.1% (w / v) benzalkonium bromide (biguanide disinfectant), corresponding neutralizer 0.5% (w / v) sodium thiosulfate;
[0233] 1% povidone iodine (containing 800 mg / L available iodine, iodine disinfectant), corresponding neutralizer 0.5% (w / v) sodium thiosulfate.
[0234] 25% concentrated glutaraldehyde was purchased from Sinopharm Chemical Reagent Co., Ltd. (Wokai),
[0235] Benzalkonium bromide was purchased from Sinopharm Chemical Reagent Co., Ltd. (Wokai),
[0236] Povidone iodine and potassium peroxymonosulfate compound salt were purchased from Shanghai Yuanye Bio-Technology Co., Ltd.
[0237] The disinfectants were diluted with standard hard water. 0.304 g of anhydrous calcium chloride (Shanghai Reagent Co., Ltd., Sinopharm Chemical Reagent Co., Ltd.) and 0.139 g of anhydrous magnesium chloride (Shanghai Yuanye Bio-Technology Co., Ltd.) were added to 1 L of deionized water, and then sterilized for standby.
[0238] The unified disinfection time was 5 min and the neutralization time was 10 min. The disinfectants with a concentration 1.25 times the required concentration were prepared, and the ratio of neutralizer to disinfectant was 4:1. The specific experimental procedures were as follows:
[0239] According to the different disinfectants, the experimental groups were divided into four groups: For each group, the PRRSV stock solution was mixed with 3% BSA (organic interferent) at a volume ratio of 1:1, and reacted at 20°C ± 1°C for 5 min for standby. The above-mentioned PRRSV suspension was mixed with the disinfectant at a volume ratio of 1:4 (for example, 200 μL of virus suspension was added to 800 μL of disinfectant). The disinfectant needed to be diluted with standard hard water to 1.25 times the required concentration in advance. After reacting for the specified time, 0.1 mL was taken out and added to 0.9 mL of qualified neutralizer and mixed evenly. After neutralization for 10 min, the sample was taken in duplicate. One part was inoculated onto the pre-paved cells for ICC-qPCR, and the other part was used for PMAxx TM -qPCR.
[0240] ICC-qPCR, the full name is integrated cell culture - quantitative fluorescence nucleic acid amplification PCR (integrated cell culture quantitative PCR, ICC-qPCR). By combining cell culture and qPCR, the results of the initial infectious virus adsorbed into cells were investigated to distinguish inactivated virus and infectious virus. The experimental procedures of ICC-qPCR:
[0241] First, determine the sample collection time and establish a standard curve. That is, the virus suspension with known TCID 50 was serially diluted, inoculated into cells, and the samples were collected 4 h after adsorption. Whether the sample collection time was correct was judged through the standard curve, and the quantitative range of ICC-qPCR was determined.
[0242] Specific steps: Approximately 1×10 5 Marc145 cells were inoculated into each well of a 24-well plate and cultured in an incubator at 37°C and 5% CO2 for 24 h. The next day, the culture medium in the wells was discarded, and the cells were washed once with 1 mL of pre-warmed PBS. The PRRSV stock solution with 10 7.9 TCID 50 / mL was serially diluted tenfold. 100 μL of the 10 5.9 TCID50 / mL, 10 4.9 TCID 50 / mL, 10 3.9 TCID 50 / mL, 10 2.9 TCID 50 / mL, 10 1.9 TCID 50 / mL, 10 0.9 TCID 50 The diluent of / mL was inoculated into Marc145 cells. Each diluent was inoculated into at least three wells. At the same time, PRRSV inactivated in a 98°C water bath was set as a washing control, and DMEM was set as a negative control. Incubate in a cell culture incubator for 2 h (shake the culture plate several times every 20 min), then wash 5 times with PBS, supplement the cell maintenance medium (2% DMEM) and continue to culture for 2 h. Then, freeze-thaw 3 times in an -80°C refrigerator and collect the samples. Use a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.) to extract PRRSV RNA, and then perform qPCR. Conduct three parallel experiments.
[0243] For the disinfectant experimental group, only replace the inoculated sample with the corresponding experimental sample, and the remaining steps are the same as above.
[0244] As Figure 18 shown: Determine the established ICC-qPCR quantification range through the results of the standard curve group to be between 2.9Logs and 5.9Logs 2.9Logs·mL -1 ~0.9Logs·mL -1 (virus titer), the experimental conditions are incubation for 2 h, culture for 2 h, and washing 5 times. Perform ICC-qPCR for the experimental group under these conditions.
[0245] As Figure 19 shown: Take the value obtained by ICC-qPCR of the 98°C heat-inactivated sample as zero (non-infectious virus washing control). The disinfection effects from excellent to poor are: 0.25% potassium peroxymonosulfate compound > 0.1% benzalkonium bromide > 0.5% glutaraldehyde > 0.8% povidone iodine.
[0246] For another disinfection experimental sample, use PMAxx of the TaqMan fluorescence quantitative kit TM -qPCR to detect the content of PRRSV-N gene after disinfection by the disinfectant. The experimental steps are as follows: The sample is in duplicate. One part is added with PMAxx in a dark environment. TM, one with the same volume of DEPC water added as a control. Subsequently, both groups were incubated in the dark for 10 min and photolyzed for 20 min. PRRSV RNA was extracted using a virus genomic DNA / RNA extraction kit (TIANamp Virus DNA / RNA kit, Tiangen Biochemical Technology Co., Ltd.), and then qPCR was performed.
[0247] As Figure 20 shown: The disinfection effects (△Ct) from excellent to poor are as follows: 0.1% benzalkonium bromide > 0.25% potassium peroxymonosulfate compound > 0.8% povidone iodine > 0.5% glutaraldehyde.
[0248] Compared with the ICC-qPCR results, OXONE and BB both had better disinfection effects. The reason why the △Ct of OXONE was slightly smaller than that of BB might be that the neutralization products affected the qPCR amplification, resulting in differences in qPCR Ct values (compared with the hard water control group), and thus affecting the determination of △Ct. Analysis of the contrast situation in the GA group: The C-H bond of the neutralizer glycine reacted with PMA.
[0249] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A PMAxx of infectious PRRSV TM - Primer set for qPCR, characterized in that: The primer set includes a primer pair PRRSV ORF67-UTR'3F / 3R and a fluorescent probe P; wherein the sequence of the primer pair PMA-F / R is as follows: PRRSV ORF67-UTR'3F: AGAAGCCCCATTTCCCTCTA, PRRSV ORF67-UTR'3R:CGTCGGCAAACTAAACTCCAC; The sequence of the fluorescent probe P: CTGACAGGGCACAAGTTCCAGCAC.
2. The primer set according to claim 1, characterized in that: The 5' end of the fluorescent probe P is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.
3. The primer set according to claim 2, characterized in that: In the fluorescent probe P, the fluorescent reporter group is FAM; the fluorescent quencher group is BHQ1.
4. A TaqMan fluorescent quantitative kit for rapid detection of infectious PRRSV, characterized in that: The fluorescent quantitative kit comprises the primer set according to any one of claims 1 to 3.
5. The TaqMan fluorescent quantitative kit according to claim 4, characterized in that: The TaqMan fluorescent quantitative kit also includes One Step U+Enzyme Mix, 2x One Step U+Mix, PMAxx TM stain, positive control and negative control.
6. The TaqMan fluorescent quantitative kit according to claim 5, characterized in that: The positive control substance is a target fragment standard substance containing the PRRSV N gene, and the negative control substance is DEPC water.
7. A method for rapid detection of infectious PRRSV using the TaqMan fluorescent quantitative kit according to claim 4, characterized in that: The following steps are involved: 1) Collect the sample to be tested and divide it into three samples for future use; 2) Add PMAxx to the first sample TM The second sample was inactivated at 98°C and then PMAxx was added TM stain solution, add DEPC water to the third sample; 3) placing the three samples processed in step 2) above on a shaker at the same time for dark incubation, and then performing photolysis on a photolysis device for later use; 4) Then extract three nucleic acids respectively, and use the primer set in the kit for qPCR amplification to obtain the Ct values of the three samples to be tested: The Ct value of the first sample was recorded as Ct1; The Ct value of the third sample was recorded as Ct2; The Ct value of the second sample was recorded as Ct3; 5) Perform interpretation and analysis based on the above Ct values.
8. The method according to claim 7, characterized in that: In step 5), the interpretation and judgment are marked as follows: a. Nucleic acid test judgment: When Ct2≤37 and there is a typical S-shaped amplification curve, it indicates that the nucleic acid test of the sample is positive, and the next step of infectivity judgment can be carried out according to the needs; Alternatively, when the test result has no Ct value or a typical S-shaped curve, it indicates that the nucleic acid test of the sample is negative; Alternatively, when 37<Ct2≤40, the sample to be tested should be tested repeatedly. If the repeated experimental results are still 37<Ct2≤40 and there is a typical S-shaped amplification curve, it is judged as positive and further infectivity judgment is performed. Otherwise, it is negative. b. Infectivity judgment: When △Ct≥10, it indicates that the sample to be tested is not infectious; Alternatively, when △Ct<10 and Ct2>23, it indicates that the sample to be tested may not be infectious either and further judgment is required; Alternatively, when △Ct<10 and Ct2≤23, it indicates that the sample to be tested is infectious, and the next step of infectious virus ratio analysis is performed according to needs; c. Analysis of infectious virus ratio: The proportion of infectious viruses contained in the sample to be tested is calculated according to the formula (Ct3-Ct1) / (Ct3-Ct2)*100%.
9. The method according to claim 7, characterized in that: In step 2), PMAxx TM The concentration of the dye solution is 100 μM in step 3). The dark incubation time was 10 min and the photolysis time was 20 min.
10. Use of the TaqMan fluorescent quantitative kit according to claim 4 in determining the disinfection effect of a disinfectant.