Lithium absorption method and lithium adsorption peptide

Abstract

The invention relates to the field of metal recovery, and discloses a lithium absorption method and a lithium adsorption peptide.The lithium absorption method comprises the steps that the lithium adsorption peptide and outer membrane protein are combined and expressed on the surface of a specified strain, and a lithium adsorption strain is formed; and treating lithium-containing wastewater by using the lithium adsorption strain so as to recover lithium from the lithium-containing wastewater. The method is used for treating the waste lithium battery and the lithium wastewater, and is beneficial to reducing the pollution of the lithium element to the environment.

Description

Technical Field

[0001] The present invention relates to the field of metal recycling, and particularly to a method for absorbing lithium and a lithium-adsorbing peptide. Background Art

[0002] Lithium is an important energy material, mainly used for making lithium-ion batteries, and is widely used in industries such as electric vehicles, mobile phones, and household appliances. The recycling and treatment of lithium elements is beneficial to reducing resource waste and environmental pollution. Existing lithium recycling technologies mainly include the recycling and reuse of lithium-ion batteries, the re-extraction of lithium ore waste residues, the extraction of lithium-containing brines, high-temperature electrolysis methods, gas-phase reduction methods, etc.

[0003] However, these recycling and treatment methods have some common problems and challenges, including high cost, high energy consumption, environmental pollution, high technical complexity, and low efficiency. There is a need to find a new method for absorbing lithium to reduce the recycling cost of lithium and minimize the negative impact on the environment. Summary of the Invention

[0004] In view of the problems in the prior art, the present invention provides a method for absorbing lithium and a peptide for absorbing lithium.

[0005] A method for absorbing lithium includes:

[0006] Binding a lithium-adsorbing peptide to an outer membrane protein and expressing it on the surface of a designated strain to form a lithium-adsorbing strain;

[0007] Using the lithium-adsorbing strain to treat lithium-containing wastewater to recover lithium from the lithium-containing wastewater.

[0008] Optionally, the lithium-adsorbing peptide includes LBP1 and / or LBP2;

[0009] The LBP1 contains the amino acid residues GPGAP;

[0010] The LBP2 contains the amino acid residues MKKVLALVPTPVMLERKAS.

[0011] Optionally, the designated strain includes Escherichia coli.

[0012] Optionally, the step of binding the lithium-adsorbing peptide to the outer membrane protein and expressing it on the surface of the designated strain to form a lithium-adsorbing strain includes:

[0013] Designing gRNA;

[0014] Inserting the designed gRNA into a CRISPR-Cas9 expression vector;

[0015] In vitro synthesizing and amplifying the LBP sequence, cloning the LBP sequence into the OmpF gene to obtain an OmpF-LBP gene fragment;

[0016] Transform the CRISPR-Cas9 expression vector and the OmpF-LBP gene fragment onto the surface of a designated strain to form the lithium-adsorbing strain.

[0017] Optionally, before inserting the designed gRNA into the CRISPR-Cas9 expression vector, it further includes:

[0018] Amplify the OmpF-LBP gene by polymerase chain reaction to obtain a PCR product;

[0019] Clone the PCR product into a plasmid using NdeI and BamHI restriction enzymes to obtain the CRISPR-Cas9 expression vector.

[0020] Optionally, the gRNA includes: 5'-GGTACGAGCTCTTCG-3'.

[0021] A lithium-adsorbing peptide, the lithium-adsorbing peptide includes LBP1 and / or LBP2;

[0022] The LBP1 contains the amino acid residues GPGAP;

[0023] The LBP2 contains the amino acid residues MKKVLALVPTPVMLERKAS.

[0024] Optionally, the lithium-adsorbing peptide includes at least one of LBP1, LBP1-LBP1, LBP1-LBP1-LBP1, LBP2, LBP2-LBP2, LBP2-LBP2-LBP2, LBP1-LBP2, LBP1-LBP2-LBP1, LBP2-LBP1-LBP2.

[0025] Optionally, the gene sequence for generating the LBP1 includes: 5'-GGC GGT GGA GGA GCG-3'.

[0026] Optionally, the gene sequence for generating the LBP1 includes: 5'-ATGAAAGTACTTAAA GCC CCCCCATTACCTAAATGT CCG TCAGCC TGC CTC GTC GAG-3'.

[0027] The present invention combines a lithium adsorption peptide and an outer membrane protein, expresses them on the surface of a designated strain to form a lithium adsorption strain, and uses the lithium adsorption strain to treat lithium-containing wastewater to recover lithium from the lithium-containing wastewater. The present invention provides a method for efficiently and environmentally removing lithium from lithium-polluted water, which can be used for the treatment of waste lithium batteries and lithium-containing wastewater, and helps to reduce the environmental pollution caused by lithium. Moreover, this method does not require the use of a large amount of chemical reagents or high-energy-consuming processes, achieving inexpensive, efficient, and environmentally friendly lithium removal and recovery, and having important environmental protection value and industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 It is a schematic flowchart of a method for absorbing lithium in an embodiment of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the following further details the present invention with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0031] As Figure 1 shown, an embodiment of the present invention provides a method for absorbing lithium, including:

[0032] S10. Combine a lithium adsorption peptide and an outer membrane protein, express them on the surface of a designated strain to form a lithium adsorption strain;

[0033] S20. Use the lithium adsorption strain to treat lithium-containing wastewater to recover lithium from the lithium-containing wastewater.

[0034] It can be understood that a lithium adsorption peptide (Lithium Binding Peptide, LBP) is a polypeptide molecule with a high affinity for adsorbing lithium ions, usually composed of an amino acid sequence. These peptides have the ability to remove or recover lithium ions in the environment, and have application prospects especially in the treatment of lithium-ion battery waste and lithium resource recovery.

[0035] An outer membrane protein (OmpF) is a protein present in the outer membrane of bacteria. It is widely present in the outer membrane of bacteria such as Escherichia coli.

[0036] The designated strain can be selected according to actual needs, such as Escherichia coli.

[0037] By binding the lithium adsorption peptide to the outer membrane protein and expressing it on the surface of the designated strain, a lithium adsorption strain can be formed. The lithium adsorption strain has the ability to adsorb and enrich lithium elements.

[0038] Using the lithium adsorption strain to treat lithium-containing wastewater can recover lithium from the lithium-containing wastewater. After measurement, in lithium-containing wastewater with an appropriate concentration, the lithium adsorption strain can enrich lithium by 8 to 56 times.

[0039] The lithium absorption method provided in this embodiment does not require the use of a large amount of chemical reagents or high-energy-consuming processes, achieving cheap, efficient, and environmentally friendly removal and recovery of lithium elements, and having important environmental protection value and industrial application value.

[0040] Optionally, the lithium adsorption peptide includes LBP1 and / or LBP2;

[0041] LBP1 contains the amino acid residue GPGAP;

[0042] LBP2 contains the amino acid residue MKKVLALVPTPVMLERKAS.

[0043] Understandably, the lithium adsorption peptide (Lithium Binding Peptide, LBP) is a polypeptide molecule with high affinity for adsorbing lithium ions. It has a specific amino acid sequence and can selectively bind to lithium ions. In some instances, the lithium adsorption peptide includes LBP1 and / or LBP2. LBP1 contains the amino acid residue GPGAP; LBP2 contains the amino acid residue MKKVLALVPTPVMLERKAS.

[0044] This embodiment provides two amino acid sequences with the ability to adsorb lithium.

[0045] Optionally, the designated strain includes Escherichia coli.

[0046] Understandably, Escherichia coli is a common Gram-negative bacillus and is a member of the intestinal flora. It is a single-celled microorganism that usually lives in the intestines of humans and animals. Escherichia coli is usually a Gram-negative rod-shaped cell, and its cell wall consists of two layers of membranes, with cytoplasm in between. The morphology of this bacterium makes it easy to culture and study in the laboratory. Escherichia coli is an aerobic bacterium that can grow under aerobic conditions and can also ferment anaerobically. It has diverse metabolic pathways and can survive using a variety of carbon sources and energy sources. Escherichia coli is widely used in scientific research and industry. As a model organism, its genome has been studied in detail. In addition, some strains of Escherichia coli are crucial for the intestinal health of humans and animals.

[0047] Escherichia coli generally does not have natural lithium adsorption ability. When ordinary Escherichia coli is cultured in a solution containing lithium element (LiCl), no significant lithium element adsorption phenomenon is found.

[0048] The surface membrane proteins of Escherichia coli generally refer to the proteins located in the outer membrane of the bacteria. These proteins play important biological functions on the outer layer membrane of Escherichia coli cells. Among them, outer membrane porin proteins (Porins): These proteins form outer membrane channels, allowing small molecule substances (such as ions, small molecule nutrients, and drugs, etc.) to pass through the outer membrane and enter the cell. The outer membrane porin proteins in Escherichia coli include OmpF and OmpC. Antigenic determinant proteins: The presence of these proteins can affect the immunogenicity of Escherichia coli, that is, its ability to be recognized by the immune system. They have important effects on host immune responses and bacterial pathogenicity. Adhesin proteins: Adhesin proteins help Escherichia coli adhere to the surface of host cells, which is the first step of bacterial infection. They play a key role in bacterial pathogenicity. In some cases, outer membrane proteins can also affect the infection of bacteria by viruses because the viruses may interact with these proteins.

[0049] The surface membrane proteins of Escherichia coli play a key role in the adaptability and pathogenicity of bacteria. They participate in a variety of biological processes by regulating the permeability of the outer membrane, the interaction between bacteria and host cells, and immune responses, etc. The research on these proteins is of great significance for understanding the biological characteristics of Escherichia coli and developing antibacterial drugs and vaccines, etc.

[0050] In Escherichia coli, the OmpF gene (Outer Membrane Protein F) is used to encode the outer membrane protein of Escherichia coli. This outer membrane protein is the OmpF protein. The OmpF protein is an outer membrane channel protein with the following important functions and characteristics: 1. Outer membrane channel: The OmpF protein is one of the main components of the outer membrane of Escherichia coli and forms the channel structure of the outer membrane. This channel allows small molecules (such as ions, small molecule glucose, etc.) to pass through the outer membrane of Escherichia coli, enabling these molecules to enter or leave the cell. This channel function is crucial for the survival and metabolic processes of the cell because it ensures that the cell can obtain the necessary nutrients and excrete metabolic wastes. 2. Ion selectivity: The OmpF channel is selective for different types of ions and molecules, allowing only specific substances to pass through. This selectivity ensures that the outer membrane channel only transports the substances required by the cell while preventing harmful substances from entering. 3. Maintaining osmotic pressure balance: The OmpF channel plays a key role in regulating the osmotic pressure balance of Escherichia coli. When the cell is in a high osmotic pressure environment, the OmpF channel can open to allow water molecules to enter the cell, thereby reducing the osmotic pressure. This helps to maintain the stability of the cell. 4. Affected by environmental conditions: The expression of OmpF is affected by environmental conditions, especially changes in external ion concentration and osmotic pressure. This enables Escherichia coli to adapt to different environmental conditions to maintain the ion balance inside and outside the cell. The OmpF protein forms an outer membrane channel, regulates the permeability of ions and small molecules, and helps Escherichia coli survive and adapt under different environmental conditions. This is crucial for maintaining the stability and normal function of the cell. The study of the OmpF protein not only helps to understand the biological characteristics of Escherichia coli but also has potential value for applications such as biotechnology and drug delivery.

[0051] Optionally, step S10, that is, binding the lithium adsorption peptide and the outer membrane protein and expressing them on the surface of the designated strain to form a lithium adsorption strain, includes:

[0052] S101. Design gRNA;

[0053] S102. Insert the designed gRNA into the CRISPR-Cas9 expression vector;

[0054] S103. In vitro synthesize and amplify the LBP sequence, and clone the LBP sequence into the OmpF gene to obtain the OmpF-LBP gene fragment;

[0055] S104. Transform the CRISPR-Cas9 expression vector and the OmpF-LBP gene fragment onto the surface of the designated strain to form the lithium adsorption strain.

[0056] Understandably, gRNA (guide RNA), namely the guiding gRNA, is a key component in the CRISPR-Cas9 gene editing technology. In the CRISPR-Cas9 system, the gRNA plays a role in guiding the Cas9 protein to a specific gene location for cleavage. Designing a specific gRNA can locate and edit a specific gene.

[0057] A gRNA can be designed that can guide the CRISPR-Cas9 system to cleave a specific region of the gene encoding the OmpF protein so that the gene sequence of the lithium adsorption peptide can be inserted. In one example, a partial DNA sequence of the OmpF gene is as follows:

[0058] ATGCTTTCGAGTCAGTACGAGCTCTTCGTACGATGCTTTCGAGTCAGT ACGAGCTCTTCG...

[0059] The above-synthesized different peptide sequences can be selected for insertion after the start codon "ATG" of the OmpF gene. For example, the gRNA sequence can be: 5'-GGTACGAGCTCTTCG-3'.

[0060] This gRNA sequence will guide the Cas9 protein to initiate double-strand cleavage after the start codon of the OmpF gene and leave a nick at this position for inserting the LBP sequence.

[0061] The designed gRNA is inserted into the CRISPR-Cas9 expression vector. This vector will be used to transfer the Cas9 protein and gRNA into Escherichia coli for gene editing.

[0062] The LBP sequence is synthesized and amplified in vitro. The LBP sequence can be the coding sequences of LBP1 monomer (pETLBP1x1), dimer (pETLBP1x2), trimer (pETLBP1x3), LBP2 monomer (pETLBP2x1), dimer (pETLBP2x2), trimer (pETLBP2x3), and heterodimer (pETLBP1-LBP2), heterotrimer (pETLBP1-LBP2-LBP1), heterotrimer (pETLBP2-LBP1-LBP2), etc.

[0063] A DNA fragment containing the above LBP sequence is synthesized, ensuring that it contains the required restriction enzyme cleavage sites for inserting it into the OmpF gene.

[0064] The above coding sequence is cloned into the cleavage region of the OmpF gene. The OmpF gene is cut with a restriction enzyme, and then the above-synthesized sequence is inserted and ligated to form the OmpF-LBP gene fragment.

[0065] The obtained CRISPR-Cas9 expression vector and the OmpF-LBP gene fragment were transformed into Escherichia coli. Using LB medium, expression was induced with IPTG (Isopropyl β-D-1-thiogalactopyranoside). Subsequently, cell treatment was carried out by centrifugation and urea buffer, and cultured at 30 °C for 48 hours to obtain a recombinant Escherichia coli strain, which is the lithium adsorption strain.

[0066] This example provides the cultivation process of the lithium adsorption strain.

[0067] Optionally, before step S102, that is, before inserting the designed gRNA into the CRISPR-Cas9 expression vector, it further includes:

[0068] S1021. Amplify the OmpF-LBP gene by polymerase chain reaction to obtain a PCR product;

[0069] S1022. Clone the PCR product into a plasmid by NdeI and BamHI restriction enzymes to obtain the CRISPR-Cas9 expression vector.

[0070] Understandably, the pET21a expression plasmid can be used to construct the recombinant plasmid. pET21a is a prokaryotic expression plasmid vector, which is applied to bacteria such as Escherichia coli for the production of high-efficiency expression of foreign proteins. The gene encoding LBP was integrated into the truncated OmpF gene. The OmpF-LBP gene was amplified by polymerase chain reaction (PCR). The designed LBP nucleic acid sequences are LBP1 and LBP2. The PCR product (OmpF-lbp) was cloned into a plasmid by NdeI and BamHI restriction enzymes to obtain pETLBP. Both NdeI and BamHI are restriction enzymes used for the cleavage and recombination of DNA molecules in molecular biology experiments.

[0071] To confirm the cell surface display of the LBP peptide, the gfp gene was cloned downstream of ompC-LBP using BamHI and HindIII restriction enzymes. Further, recombinant plasmids of LBP1 monomer (pETLBP1x1), dimer (pETLBP1x2), trimer (pETLBP1x3), LBP2 monomer (pETLBP2x1), dimer (pETLBP2x2), trimer (pETLBP2x3), and heterodimer (pETLBP1-LBP2), heterotrimer (pETLBP1-LBP2-LBP1), heterotrimer (pETLBP2-LBP1-LBP2), etc. were constructed.

[0072] The designed gRNA will guide the CRISPR-Cas9 expression vector to deliver Cas9 protein to the designated position in Escherichia coli for corresponding gene editing.

[0073] An embodiment of the present invention also provides a lithium-adsorbing peptide, which includes LBP1 and / or LBP2;

[0074] The LBP1 contains the amino acid residues GPGAP;

[0075] The LBP2 contains the amino acid residues MKKVLALVPTPVMLERKAS.

[0076] Optionally, the lithium-adsorbing peptide includes at least one of LBP1, LBP1-LBP1, LBP1-LBP1-LBP1, LBP2, LBP2-LBP2, LBP2-LBP2-LBP2, LBP1-LBP2, LBP1-LBP2-LBP1, LBP2-LBP1-LBP2.

[0077] Optionally, the gene sequence for generating the LBP1 includes: 5'-GGC GGT GGA GGA GCG-3'.

[0078] Optionally, the gene sequence for generating the LBP1 includes: 5'-ATGAAAGTACTTAAA GCC CCCCCATTACCTAAATGT CCG TCAGCC TGC CTC GTC GAG-3'.

[0079] Performance verification test 1 of the lithium absorption method

[0080] The lithium-adsorbing strain was centrifuged and then incubated in a lithium chloride solution with a concentration of 20 mM. The bacteria were grown at 30 °C for 48 hours, and the adsorbed lithium was quantitatively measured by atomic absorption spectrometry after absorbing the metal to evaluate the selectivity of the peptide for lithium.

[0081] Table 1 Lithium absorption concentrations of different strains

[0082]

[0083]

[0084] As can be seen from Table 1, the unmodified Escherichia coli does not have the ability to adsorb lithium. The lithium-adsorbing strain can absorb a certain amount of lithium. Among them, the lithium-adsorbing strain combined with the mixed tripeptide LBP1-LBP2-LBP1 has the strongest lithium adsorption ability, and its lithium adsorption intensity is 11.2 mmol / g-DCW, that is, each gram of cells can adsorb 11.2 mmol of lithium.

[0085] Performance Verification Test 2 of the Method for Absorbing Lithium

[0086] The lithium-adsorbing strain was centrifuged and then incubated in a solution containing 20 mM lithium chloride (LiCl), 5 mM chromium chloride (CrCl), 5 mM cobalt chloride (CoCl2), and 5 mM copper chloride (CuCl2). After the bacteria grew for 48 hours and absorbed the metals, the adsorbed lithium, chromium, cobalt, and copper were quantitatively measured by atomic absorption spectrometry to evaluate the selectivity of the peptide for lithium.

[0087] Table 2 Metal Absorption Concentrations of Different Strains

[0088]

[0089]

[0090] As can be seen from Table 2, the unmodified Escherichia coli hardly has the ability to adsorb elements such as lithium, chromium, cobalt, and copper. The lithium-adsorbing strain can absorb a certain amount of lithium, especially the recombinant strain combined with the LBP1-LBP2-LBP1 hybrid tripeptide, which has the strongest lithium adsorption ability, and its lithium adsorption intensity is 9.8 mmol / g-DCW, that is, each gram of cells can adsorb 9.8 mmol of lithium.

[0091] Compared with other metal ions, whether it is the unmodified Escherichia coli or the lithium-adsorbing strain, the adsorption of other metal ions is relatively less than that of lithium, showing good adsorption specificity for lithium.

[0092] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for absorbing lithium, characterized in that, Comprising: Binding a lithium adsorption peptide and an outer membrane protein and expressing them on the surface of a designated strain to form a lithium adsorption strain; Using the lithium adsorption strain to treat lithium-containing wastewater to recover lithium from the lithium-containing wastewater.

2. The method for absorbing lithium according to claim 1, wherein The lithium adsorption peptide includes LBP1 and / or LBP2; The LBP1 contains the amino acid residue GPGAP; The LBP2 contains the amino acid residue MKKVLALVPTPVMLERKAS.

3. The method for absorbing lithium according to claim 1, characterized in that, The designated strain includes Escherichia coli.

4. The method for absorbing lithium according to claim 1, wherein, The binding of the lithium adsorption peptide and the outer membrane protein and expressing them on the surface of the designated strain to form a lithium adsorption strain includes: Designing gRNA; Inserting the designed gRNA into a CRISPR-Cas9 expression vector; Synthesizing and amplifying the LBP sequence in vitro, cloning the LBP sequence into the OmpF gene to obtain an OmpF-LBP gene fragment; Transforming the CRISPR-Cas9 expression vector and the OmpF-LBP gene fragment onto the surface of the designated strain to form the lithium adsorption strain.

5. The method for absorbing lithium according to claim 4, characterized in that, Before inserting the designed gRNA into the CRISPR-Cas9 expression vector, it further includes: Amplifying the OmpF-LBP gene by polymerase chain reaction to obtain a PCR product; Cloning the PCR product into a plasmid by NdeI and BamHI restriction enzymes to obtain the CRISPR-Cas9 expression vector.

6. The method for absorbing lithium according to claim 4, characterized in that, The gRNA includes: 5'-GGTACGAGCTCTTCG-3'.

7. A lithium-adsorbing peptide, characterized in that, The lithium adsorption peptide includes LBP1 and / or LBP2; The LBP1 contains the amino acid residue GPGAP; The LBP2 contains the amino acid residue MKKVLALVPTPVMLERKAS.

8. The lithium-adsorbing peptide according to claim 7, wherein, The lithium adsorption peptide includes at least one of LBP1, LBP1-LBP1, LBP1-LBP1-LBP1, LBP2, LBP2-LBP2, LBP2-LBP2-LBP2, LBP1-LBP2, LBP1-LBP2-LBP1, LBP2-LBP1-LBP2.

9. The lithium-adsorbing peptide according to claim 7, wherein The gene sequence for generating the LBP1 includes: 5'-GGC GGT GGA GGA GCG-3'.

10. The lithium-adsorbing peptide according to claim 7, wherein The gene sequence for generating the LBP1 includes: 5'-ATG AAA GTA CTT AAA GCC CCC CCA TTA CCT AAA TGT CCG TCA GCC TGC CTC GTCGAG-3'.

Images