Preparation method of CaAIBZ1 gene edited pepper for improving drought tolerance

Abstract

The present invention relates to a composition for genome editing for enhancing the drought tolerance of a pepper plant and a method for preparing a T-DNA free genome-edited pepper plant in which the drought tolerance is enhanced by using the composition. More specifically, the composition of the present invention comprises: a complex of a guide RNA and an endonuclease protein, which has specificity for a base sequence of interest of a CaAIBZ1 gene derived from pepper; or a recombinant vector comprising a DNA encoding a guide RNA having specificity for a target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein.

Description

Technical Field

[0001] The present invention relates to a method for preparing a gene-edited pepper for enhancing drought tolerance CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1 ( Capsicum annuum ASRF1-Interacting bZIP transcription factor 1)).

[0002] This result was obtained through research supported by the New Breeding Technology Center of the Rural Development Administration (Project No.: PJ01479802). Background Art

[0003] Due to climate change and global warming, natural disaster phenomena such as drought, water shortage, and floods have occurred worldwide, and these phenomena will become more severe in the future. Pepper ( Capsicum annuum L. ) ranks second after tomatoes in the global vegetable market and is cultivated worldwide. More than 90% of sweet peppers or chili peppers are cultivated in the open field. Especially in India, China and other places where the pepper cultivation density is high, there are cases where the yield decreases sharply due to drought or water shortage during the growth period. So far, there is no pepper gene source with drought tolerance. Therefore, it is difficult to develop varieties adapted to various environmental changes such as drought through existing traditional breeding and marker-assisted selection (MAS). On the contrary, gene editing technology can develop new gene sources, making it possible to develop drought-tolerant peppers.

[0004] In the present invention, a guide RNA related to a target gene conferring drought tolerance characteristics is placed in a green fluorescent protein (GFP) and Cas9 expression vector, and a gene-edited body is developed through pepper transformation, and then drought-tolerant peppers are screened.

[0005] On the other hand, Korean Patent Publication No. 2015-0106528 discloses "Pepper-derived genes for increasing abiotic stress tolerance of plants and their uses", and Korean Patent Publication No. 2013-0055050 discloses "Freezing injury and drought-resistant pepper transcription factor genes and their uses", but there is no record of the "method for preparing a gene-edited pepper for enhancing drought tolerance" of the present invention. MSRB2 CaWRKY1 CaAIBZ1

[0006] Summary of the Invention

[0006] (I) Technical Problems to be Solved

[0007] The present invention is derived from the above requirements, and the present inventors constructed a CRISPR vector containing a gRNA targeting a gene related to drought tolerance, Cas9, and a GFP expression cassette. Then, the vector was transformed into pepper cotyledon explants by Agrobacterium-mediated transformation to obtain genome-edited plants with the target site edited. Then, drought tolerance experiments of water withholding and re-irrigation were carried out using T2 generation genome-edited plants. As a result, it was confirmed that compared with the control group (non-edited plants) and mono-allelic edited plants, CaAIBZ1 bi-allelic edited plants of the gene showed significantly increased drought tolerance, thus completing the present invention. CaAIBZ1

[0008] (II) Technical Solution

[0009] To solve the above problems, the present invention provides a genome editing composition for enhancing the drought tolerance of pepper plants, comprising the following components as active ingredients: a ribonucleoprotein complex of a guide RNA specific to the target base sequence of a pepper-derived CaAIBZ1 gene and an endonuclease protein; or a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of a pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein.

[0010] In addition, the present invention provides a method for preparing a genome-edited pepper plant with enhanced drought tolerance, comprising: step (a), editing the genome by introducing a guide RNA specific to the target base sequence of a pepper-derived CaAIBZ1 gene and an endonuclease protein into pepper plant cells; and step (b), regenerating a pepper plant from the pepper plant cells with the edited genome.

[0011] In addition, the present invention provides a genome-edited pepper plant with enhanced drought tolerance prepared by the above method and its genome-edited seeds.

[0012] (III) Beneficial Effects

[0013] ​The genome-edited pepper plants with enhanced drought tolerance prepared by the method of the present invention can be effectively utilized in the future for ensuring drought-tolerant pepper gene sources and developing high-value-added pepper varieties. Moreover, the method of the present invention does not involve the insertion of exogenous genes and only has small variations no different from natural mutations, differing from genetically modified organism (GMO) crops that consume a large amount of costs and time for evaluating safety and environmental harmfulness, and it is expected to save costs and time. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 For pepper CaAIBZ1 The schematic diagram of the CRISPR-Cas9 vector pCam- CaAIBZ1 for gene editing. The pepper gene editing vector has a pCambia vector backbone and has a structure with both a gRNA expression and a Cas9 expression cassette and a GFP expression cassette. Cas9 expression is regulated by the Cauliflower mosaic virus (CaMV) 35S promoter, CaAIBZ1 and the gene-targeting gRNA expression is regulated by the AtU6 promoter. LB: T-DNA left border; NLS: nuclear localization signal; pCas9: Plant-codon optimized spCas9; 2A: 2A self-cleaving peptide; eGFP: enhanced green fluorescent protein; CaMV35S P: Cauliflower mosaic virus (CaMV) 35S promoter; 35S(T): CaMV 35S terminator, NOS-T: nopaline synthase terminator; NPTⅡ: neomycin phosphotransferase Ⅱ (kanamycin resistance determinants), RB: T-DNA right border.

[0015] Figure 2 Showing on the pepper genome CaAIBZ1Target guide RNA positions and sequences of the gene. The colored bars indicate the target RNA positions, the black bars indicate the PAM positions, the arrows indicate the predicted cleavage sites, and the black boxes indicate the exon regions on the genome.

[0016] Figure 3 Results of analyzing the editing efficiency of the target gRNA using ribonucleoprotein (RNP) (sgRNA / Cas9 protein) in pepper protoplasts.

[0017] Figure 4 Process for ensuring pepper transformants, showing the process from pepper cotyledon explants through the callus stage to redifferentiation and growth into small plants.

[0018] Figure 5 Appearance of the gene-edited pepper plants (T0) during flowering in the plant growth chamber after being planted in flower pots. CaAIBZ1 Appearance of the gene-edited pepper plants (T0).

[0019] Figure 6 For analysis CaAIBZ1 Results of high-throughput sequencing technology (NGS) for analyzing the editing patterns of gene-edited pepper T0 individuals.

[0020] Figure 7 And Figure 8 For analysis CaAIBZ1 Results of NGS for analyzing the editing patterns of gene-edited pepper T1 individuals.

[0021] Figure 9 For ensuring T2 seeds for the drought tolerance experiment CaAIBZ1 Appearance of the gene-edited pepper T1 generation plants.

[0022] Figure 10 For CaAIBZ1 Results of the drought tolerance experiment of gene-edited pepper T2 individuals.

[0023] Figure 11 For CaAIBZ1 Results of the survival rate experiment after rewatering of gene-edited pepper T2 individuals.

[0024] Figure 12 For confirming CaAIBZ1 Results of polymerase chain reaction (PCR) analysis to determine whether gene-edited pepper T2 individuals are T-DNA free. M: 1 kb marker, N: wild type, P: vector, 10-1 #1 to 12-18 #1: CaAIBZ1 Gene-edited pepper T2 plants CaAIBZ1 gene editedhot pepper T2plants Detailed implementation mode

[0025] To achieve the object of the present invention, the present invention provides a composition for genome editing for enhancing the drought tolerance of pepper plants, comprising the following components as active ingredients: a complex of a guide RNA specific to the target base sequence of a pepper-derived CaAIBZ1 gene and an endonuclease protein; or a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of a pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein.

[0026] In the composition of the present invention, the target gene for genome editing for enhancing the drought tolerance of pepper plants is the CaAIBZ1 gene of GenBank accession no: LY715037.1.

[0027] The term "genome / gene editing" in this specification is a technology capable of introducing a target-directed variation into the genomic base sequence of animal and plant cells including human cells, and refers to knocking out (knock-out) or knocking in (knock-in) a specific gene by deletion, insertion, or substitution of nucleic acid molecules caused by DNA cleavage, or it is also possible to introduce a variation into a non-coding DNA sequence that does not generate a protein. The term "gene editing" can be used interchangeably with "gene correction".

[0028] For the purpose of the present invention, the genome editing can particularly be an act of introducing a variation into a plant using an endonuclease, for example, using CRISPR associated protein 9 (Cas9) and a guide RNA.

[0029] Furthermore, the term "target gene" refers to a part of DNA present in the genome of a plant to be edited by the present invention, and may include both a coding region and a non-coding region. A person of ordinary skill in the art to which the present invention pertains can screen a target gene according to its purpose for the genome-edited plant to be prepared.

[0030] Also, the term "guide RNA" refers to a short single-stranded RNA that contains an RNA specific to the target DNA in the base sequence encoding the target gene and serves to guide the relevant target DNA base sequence to an endonuclease protein by complementary binding to all or part of the target DNA base sequence. The guide RNA refers to the following forms: dual RNA, which contains two RNAs, namely, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as structural elements; or single guide RNA (sgRNA), which contains a first part and a second part, where the first part contains a sequence that is fully or partially complementary to the base sequence within the target gene, and the second part contains a sequence that interacts with an endonuclease (in particular, an RNA-guided nuclease). However, as long as the endonuclease can be active in the target base sequence, it can be included in the scope of the present invention without limitation, and can be prepared and used according to the techniques known in the technical field to which the present invention pertains, taking into account the type of endonuclease used or the source microorganism of the endonuclease, etc.

[0031] Also, the guide RNA can be a guide RNA transcribed from a plasmid template, transcribed in vitro ( in vitro ), for example, an oligonucleotide duplex), or a synthetic guide RNA, etc., but is not limited thereto.

[0032] In the genome editing composition of the invention, the guide RNA is designed to be specific to the target base sequence of a pepper-derived gene consisting of the base sequences of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4. CaAIBZ1

[0033] Also, in the genome editing composition of the present invention, the endonuclease protein can be one or more selected from the group consisting of Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1, also known as CAs12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), or functional analogs thereof. Preferably, it can be a Cas9 protein, but is not limited thereto.​

[0034] Moreover, the Cas9 protein may be selected from the group consisting of, but not limited to, Cas9 proteins derived from Streptococcus pyogenes ( Streptococcus pyogenes ), Campylobacter jejuni ( Campylobacter jejuni ), Streptococcus thermophilus ( S.thermophilus ), or Staphylococcus aureus ( S.aureus ), Cas9 proteins derived from Neisseria meningitidis ( Neisseria meningitidis ), Cas9 proteins derived from Pasteurella multocida ( Pasteurella multocida ), Cas9 proteins derived from Francisella novicida ( Francisella novicid a), etc. The Cas9 protein or its gene information can be obtained from publicly known databases such as GenBank of the National Center for Biotechnology Information (NCBI).

[0035] The Cas9 protein is an RNA-guided DNA endonuclease that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target base sequence and cleave the DNA strand, a short base sequence consisting of 3 bases, known as PAM (Protospacer Adjacent Motif), should be present next to the target base sequence. The Cas9 protein cleaves by predicting between the third and fourth base pairs starting from the PAM sequence (NGG).

[0036] In the genome editing composition of the present invention, the guide RNA and the endonuclease protein can function as an RNA gene scissors (RNA-Guided Engineered Nuclease, RGEN) by forming a ribonucleoprotein complex.

[0037] In addition, the present invention also provides a method for preparing a genome-edited pepper plant with enhanced drought tolerance, comprising: step (a), editing the genome by introducing a guide RNA and an endonuclease protein specific to the target base sequence of a pepper-derived CaAIBZ1 gene into pepper plant cells; and step (b), regenerating a pepper plant from the genome-edited pepper plant cells.

[0038] In the preparation method of an example of the present invention, the guide RNA and the endonuclease protein specific to the target base sequence of the pepper-derived CaAIBZ1 gene are as described above.

[0039] The CRISPR / Cas9 system used in the present invention is a method for achieving gene editing through the following mechanism, that is, introducing double-strand cleavage into a specific position of a specific gene to be edited, thereby causing non-homologous end joining (NHEJ) of insertion-deletion (InDel) mutations induced by incomplete repair during the induction of DNA repair through the non-homologous end joining mechanism.

[0040] In the preparation method of the present invention, in the step (a), the following components are used to introduce the guide RNA and the endonuclease protein into the pepper plant cells: a complex of a guide RNA specific to the target base sequence of the pepper-derived CaAIBZ1 gene and the endonuclease protein; or a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding the endonuclease protein. However, it is not limited thereto.

[0041] In the preparation method of the present invention, the method for transducing the complex of the guide RNA and the endonuclease protein into plant cells can be appropriately selected from the calcium / polyethylene glycol method of protoplasts, the electroporation method of protoplasts, the microinjection method of plant elements, the (DNA or RNA-encoded) ion bombardment method of various plant elements, and the (incomplete) transfection of bacteria in the gene transfer mediated by Agrobacterium tumefaciens ( Agrobacterium tumefaciens ).

[0042] Moreover, introducing a recombinant vector comprising a DNA encoding a guide RNA specific to the target base sequence and a nucleic acid sequence encoding the endonuclease protein into plant cells refers to the transformation method. The transformation of plant species is currently a common operation for plant species including both dicotyledonous plants and monocotyledonous plants. In principle, any transformation method can be used when introducing the recombinant vector of the present invention into appropriate progenitor cells.

[0043] In the preparation method of the present invention, a guide RNA specific to the target base sequence and the endonuclease protein can be introduced into any plant cell. The plant cell is a cultured cell, a cultured tissue, a cultured organ, or a whole plant. "Plant tissue" includes differentiated or undifferentiated plant tissues, for example, including roots, stems, leaves, pollen, microspores, egg cells, seeds, and various forms of cells used in culture, that is, single cells, protoplasts, buds, and callus. The plant tissue can be in the state of in planta, organ culture, tissue culture, or cell culture.

[0044] In the preparation method of the present invention, the genome-edited pepper plant cells in step (b) may be derived from pepper, CaAIBZ1 but are not limited thereto, being biallelically edited plant cells of the CaAIBZ1 gene.

[0045] In the preparation method of the present invention, the method of redifferentiating genome-edited plants from genome-edited plant cells can use any method known in the technical field to which the present invention pertains. For many species, techniques for redifferentiating mature plants by culturing callus or protoplasts are well known in the technical field to which the present invention pertains.

[0046] Moreover, the present invention provides genome-edited pepper plants with enhanced drought tolerance prepared by the above method and their genome-edited seeds.

[0047] The genome-edited pepper plants with enhanced drought tolerance of the present invention use the CRISPR / Cas9 system to edit genes related to drought tolerance, CaAIBZ1 being genome-edited pepper plants that have enhanced cold resistance compared to pepper plants with unedited genomes and single-allele edited plants of the CaAIBZ1 gene by knocking out the bialleles of the CaAIBZ1 gene. CaAIBZ1 CaAIBZ1

[0048] Hereinafter, the present invention will be described in detail through examples. However, the following examples are only for illustrating the present invention, and the content of the present invention is not limited to the following examples.

[0049] Example 1. Screening CaAIBZ1 sgRNA of the CaAIBZ1 gene

[0050] Pepper CaAIBZ1 The target gRNA sequences of the CaAIBZ1 gene are shown in Table 1. Using the CaAIBZ1 gene sequence (GenBank no: LY715037.1), sgRNAs disclosed in Table 1 were screened on the CRISPR RGEN Tools homepage (www.rgenome.net / Cas-designer) by reflecting various conditions (GC contents, out of frame score, mismatch number in the genome sequence, etc.). CaAIBZ1

[0051] Table 1

[0052] sgRNA target sequences for editing the CaAIBZ1 gene CaAIBZ1

[0053]

[0054] ​​​​To confirm the editing efficiency of the four screened sgRNAs, after synthesizing each sgRNA and forming a ribonucleoprotein (RNP) complex by mixing with Cas9 protein, the RNP complex was introduced into pepper protoplast cells (1×10 5 ) using the polyethylene glycol (PEG)-mediated transduction method. After 24 hours, genomic DNA was isolated from the protoplasts and subjected to target deep-sequencing analysis to analyze the insertion / deletion (InDel) efficiency.

[0055] Pepper protoplasts were isolated from the cotyledons of germinated young plants of the C15 pepper line (Nongyou Biotech Co., Ltd., Korea) and used. Referring to the method of You et al. (Nat. Protoc. (2007) 2; 1565-1572) and with some modifications, pepper protoplasts were isolated. Then, 30 μg of sgRNA and 30 μg of Cas9 were added, and after mixing 1 μl of 3× NEB buffer (#3), the reaction was carried out at room temperature for 10 minutes to prepare the ribonucleoprotein complex. Then, 10 - 20 μl of the ribonucleoprotein complex (sgRNA + Cas9) was mixed into the protoplasts, and then an equal volume of 40% PEG solution was added and mixed, and the reaction was carried out at room temperature for 10 minutes.

[0056] The analysis results showed that the editing efficiency at the target sites was confirmed. For sgRNA 1, it was 6.0%, for sgRNA 2, it was 0.0005%, for sgRNA 3, it was 3.4%, and for sgRNA 4, it was 4.8% ( Figure 3 ). It was confirmed that all except sgRNA 2 with unconfirmed editing efficiency could be used as targets. Therefore, sgRNA 4 was used to prepare the transformation recombinant vector.

[0057] Example 2. Preparation CaAIBZ1 Gene-edited plants

[0058] The present inventors introduced a recombinant vector containing sgRNA4 into pepper cotyledon explants by Agrobacterium-mediated transformation. The process of regenerating plants from cotyledon slices referred to the method of Lee et al. (Plant Cell Rep. 2004 Aug; 23(1-2):50-8. doi: 10.1007 / s00299-004-0791-1.) and was carried out with some modifications.

[0059] 2-1. Preparation and pre-culture of explants

[0060] The Capsicum C15 strain (Nongyou Biotech Co., Ltd., Korea) was used in the experiment. After disinfecting the surface of the seeds with 95% ethanol for 30 seconds, they were then disinfected with 50% bleach for 10 minutes. Then, they were washed 3 times with sterilized water. After placing the sterilized seeds on 1 / 2 MS medium, germination was carried out under light conditions at 25°C. Then, cotyledons and hypocotyls were excised from the plants on the 8th to 10th day after germination and used as explants. After making wounds on the explants with a blade, they were placed in pre-culture medium PM-A and cultured for 2 to 6 days under light conditions at 22 - 28°C.

[0061] 2-2. Co-cultivation with Agrobacterium

[0062] The recombinant vector was introduced into Agrobacterium tumefaciens strain EHA105. The transformed Agrobacterium was cultured in YEP medium containing 50 mg / l kanamycin, 50 mg / l rifampicin, and 100 μM acetosyringone. After centrifuging the culture solution, it was diluted with MS basal medium to an OD 600 value reaching 0.3 - 0.5. After mixing the culture suspension with MS liquid medium (CCM medium in Table 2) containing 100 μM acetosyringone and 100 μM dithiothreitol (DTT), it was inoculated into the explants pre-cultured in 2-1. for 10 - 20 minutes. Then, it was co-cultured for 48 - 96 hours under light conditions in the pre-culture medium PM-A used in 2-1. The explants co-cultured with Agrobacterium were washed 3 times with 1 / 2 MS liquid medium containing 3% sucrose, 600 mg / l timentin, and 2 ml / l plant broad-spectrum antibiotic (PPM, Plant preservation mixture; Plant Cell Technology, USA).

[0063] 2-3. Callus induction and shoot formation

[0064] To screen for transformants, the explants co-cultured with Agrobacterium in Example 2-2 were cultured in MS basal medium (Selection-A medium in Table 2) containing 0.2 mg / l zeatin, 1.0 mg / l auxin (IAA), 100 mg / l kanamycin, 300 mg / l ticarcillin, and 10 μM STS (silver thiosulfate + silver nitrate) for 4 to 6 weeks. In the 4th to 5th week of culture, tissues similar to callus could be observed around the wound sites in several explants. Then, to induce new shoots in the callus, the explants were transferred to MS basal medium (TSIM medium in Table 2) containing 2 mg / l zeatin, 0.05 mg / l IAA, 50 mg / l kanamycin, 300 mg / l ticarcillin, and 10 μM STS and cultured for 8 to 12 weeks. Then, for new shoot growth, the explants were transferred to MS basal medium (TEM medium in Table 2) containing 2 mg / l zeatin, 0.05 mg / l IAA, 2 mg / l GA3, 50 mg / l kanamycin, 300 mg / l ticarcillin, and 10 μM STS and cultured for 2 to 4 weeks.

[0065] 2-4. Root induction and soil acclimation

[0066] The newly emerged shoots were placed in MS basal medium (TRIM medium in Table 2) containing 1 mg / l 3-indolebutyric acid (IBA, Indole-3-butyric acid) and 150 mg / l ticarcillin to induce root formation and cultured for 2 to 4 weeks. The regenerated plants with roots were transferred to flower pots filled with horticultural soil (seedling pot&soil) and acclimated and cultured under light conditions of 25 °C and 16 hours for 3 to 6 weeks.

[0067] Table 2

[0068] Composition of media used in the preparation of pepper transformants

[0069]

[0070]

[0071] Example 3. Confirmation of editing efficiency in pepper T0 plants

[0072] To confirm the editing efficiency in the obtained T0 transformed individuals, NGS analysis was performed. Analyze 35 CaAIBZ1- Results of the I4 chili redifferentiated individuals showed that 15 individuals with an editing efficiency of 10% or more were identified, including 3 individuals with editing at the single - allele level (50%). (Number of individuals with an editing efficiency of 10% or more among all individuals: 42.8%).

[0073] Table 3

[0074] Among the transformed chili T0 individuals CaAIBZ1 Gene editing efficiency

[0075]

[0076] CaAIBZ1 - The I4 T0#10 individual was confirmed to be at the single - allele editing level (50%) with an overall editing efficiency of 49.8%. The main editing pattern was confirmed to be the 1 - bp insertion form of A or G ( Figure 6 ). CaAIBZ1 - The I4 T0#12 individual was confirmed to be at the single - allele editing level (50%) with an overall editing efficiency of 45.6%. The main editing pattern was confirmed to be the 1 - bp insertion form of T or A ( Figure 6 ). Predicted CaAIBZ1 - I4 T0#10 and CaAIBZ1 - I4 T0#12 individuals can be separated in the next generation to obtain edited individuals with a 1 - bp single - base insertion. And, CaAIBZ1 - The I4 T0#28 individual was confirmed to be at the single - allele editing level (50%) with an overall editing efficiency of 54.8%. The main editing pattern was mostly the - 1 - bp deletion form ( Figure 6 ). Predicted CaAIBZ1 - The I4 T0#28 individual can be separated in the next generation to obtain an individual with a single - base - 1 - bp deletion.

[0077] Example 4. Confirming the editing efficiency in chili T1 plants

[0078] To confirm the editing efficiency in the chili T1 transformed individuals planted in flowerpots, NGS analysis was performed. Analyzing the results of 42 CaAIBZ1 - I4 chili redifferentiated individuals, 34 individuals with an editing efficiency of 50% or more were obtained, including 12 individuals with a double - allele editing level (93% or more). (Number of individuals with an editing efficiency of 50% or more among all individuals: 81.0%).

[0079] Confirmed CaAIBZ1 - The editing efficiency of the I4 T1#10 - 8 and #12 - 6 individuals was at the double - allele editing level (99% or more). Confirmed CaAIBZ1- The editing efficiency of individuals #10 - 1, #12 - 18 in I4 T1 is at the single - allele editing level (50% level). In this case, it can be known that the editing pattern is the introduction of A or T bases in the +1 bp form ( Figure 7 and Figure 8 ). That is, gene - edited organisms with the +1 bp single - base introduction form can be obtained.

[0080] Table 4

[0081] In the transformed pepper T1 individuals CaAIBZ1 Gene editing efficiency

[0082]

[0083] Example 5. Analysis CaAIBZ1 Drought tolerance of gene - edited plants

[0084] To investigate CaAIBZ1 the drought tolerance of gene - edited peppers, the control group (control: C15 line) and 4 T2 peppers with confirmed gene editing in the T1 generation were sown ( CaAIBZ1 ). The peppers after 4 weeks of sowing were deprived of water for 8 days and 9 days to observe the degree of drought tolerance. It can be confirmed that starting from the 6th day of water deprivation, the leaves of the control group began to wilt, and from the 8th day, they completely withered ( Figure 9 ). The drought tolerance of single - allele - edited pepper edited organisms is similar to that of the control group, but significantly stronger drought - tolerance characteristics than the control group were seen in the double - allele - edited pepper edited organisms ( Figure 10 ). It was confirmed that about 47% of the peppers (double - allele; 10 - 8 and 12 - 6) that survived completely until the 9th day of water deprivation, while the survival rates of the control group and single - allele - edited peppers were 0% ( Figure 10 ). Figure 10 ).

[0085] And starting from the 10th day, water was supplied again to the control group peppers and gene - edited peppers that had been deprived of water for 9 days. In the control group, only 1 individual (20%) recovered by the 2nd day of re - watering. In the case of gene - edited peppers, it was confirmed that compared with double - allele - edited individuals, the recovery of single - allele - edited individuals was slower. On the 2nd day of re - watering, the complete recovery rate of single - allele - edited organisms was 25%, while the complete recovery rate of double - allele - edited organisms was 73% ( Figure 11 ).

[0086] And, for 13 peppers selected as drought - tolerant individuals through the above - mentioned drought - tolerance test (re - watering after water deprivation) CaAIBZ1Using T2 edited plants as the object, it was confirmed whether there was no T-DNA, and PCR was performed using the Cas9 primer pair (Cas9 #2-F: TTCGATAAGAACCTTCCAAA (SEQ ID NO: 5), Cas9 #2-R: TTGAGCCTTTCTTCAATCAT (SEQ ID NO: 6)). As a result, PCR bands were not confirmed in 11 individuals except for 2 individuals (10-8 #2, 10-8 #3). Therefore, after developing to the T2 generation, the T-DNA was removed from the CaAIBZ1 gene-edited plants, and 9 individuals with bi-allelic gene editing (10-8 #1, #4, and 12-6 #1-#7) were obtained ( Figure 12 ).

Claims

1. A composition for genome editing for enhancing the drought tolerance of pepper plants, characterized in that, Comprising the following components as active ingredients: For the source of chili peppers CaAIBZ1 A complex of a guide RNA with specific target base sequence for the gene and an endonuclease protein; or Recombinant vector, comprising DNA encoding a guide RNA specific for a target base sequence of a gene derived from pepper CaAIBZ1 and a nucleic acid sequence encoding an endonuclease protein.

2. The composition for genome editing for enhancing the drought tolerance of pepper plants according to claim 1, wherein, The source of the chili pepper CaAIBZ1 The target base sequence of the gene consists of the base sequences of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO:

4.

3. A method for preparing a genome-edited pepper plant with enhanced drought tolerance, characterized in that, Including: Step (a), editing the genome by introducing a guide RNA and an endonuclease protein specific to the target base sequence of the chili pepper-derived CaAIBZ1 gene; and Step (b), regenerating a pepper plant from the genome-edited pepper plant cells.

4. The method for preparing a genome-edited pepper plant with enhanced drought tolerance according to claim 3, characterized in that In the step (a), the following components are used to introduce guide RNA and endonuclease protein into pepper plant cells: For the source of chili peppers CaAIBZ1 A complex of a guide RNA with specific target base sequence for the gene and an endonuclease protein; or Recombinant vector, comprising a DNA encoding a guide RNA specific for a target base sequence of a gene derived from pepper and a nucleic acid sequence encoding an endonuclease protein. CaAIBZ1 The gene has a target base sequence specific for the DNA of the guide RNA and the nucleic acid sequence encoding the endonuclease protein.

5. The method for preparing a genome-edited pepper plant with enhanced drought tolerance according to claim 3, characterized in that, The source of the chili pepper CaAIBZ1 The target base sequence of the gene consists of the base sequences of SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO:

4.

6. A genome-edited pepper plant with enhanced drought tolerance, characterized in that, Prepared by the method according to any one of claims 3 to 5.

7. The genome-edited pepper plant with enhanced drought tolerance according to claim 6, characterized in that, The genome-edited pepper plant is CaAIBZ1 a biallelic edited plant of the 8. The genome-edited pepper plant with enhanced drought tolerance according to claim 6, characterized in that, The genome-edited pepper plant is T-DNA-free.

9. A seed whose genome of the pepper plant according to claim 6 is edited.

Images