Human milk oligosaccharides and their applications in improving gut microbiota and regulating short-chain fatty acids during constipation.
By supplementing with 6'-sialic acid lactose foods, the gut microbiota of constipation is regulated, the abundance of beneficial bacteria is increased, harmful bacteria are reduced, short-chain fatty acids are restored, constipation symptoms are improved, and the problem of regulating the intestinal environment in constipation is solved.
Patent Information
- Application Number
- CN202510703329.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-05-29
AI Technical Summary
There are few reports on the role of human milk oligosaccharides in regulating gut microbiota in constipation, and the methods for improving the gut environment in constipation are not clear.
By supplementing with 6'-sialyl lactose, food products are prepared to improve constipation, increase the abundance of beneficial bacteria in the gut, reduce the abundance of harmful bacteria, regulate the SCF/C-kit signaling pathway, restore short-chain fatty acid content, and enhance intestinal motility and fecal water content.
It significantly improves constipation, increases the abundance and diversity of gut microbiota, restores short-chain fatty acid content, regulates gut microbiota structure, increases fecal water content and intestinal motility, and relieves constipation symptoms.
Smart Images

Figure CN120226772B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a breast milk oligosaccharide for improving the intestinal flora environment and regulating short-chain fatty acids in constipation and application, belonging to the field of food. BACKGROUND
[0002] Constipation is a common gastrointestinal disease in infants, children and adults. Constipation can be divided into functional constipation and organic constipation according to the presence or absence of organic lesions. Functional constipation (FC) is a functional bowel disease characterized by decreased defecation frequency, stool shape change, defecation difficulty, abdominal discomfort, and incomplete defecation. Functional constipation is most commonly seen in slow transit constipation (STC). The incidence of pediatric functional constipation is more than 90% of children with constipation. Long-term repeated constipation in children can lead to intestinal function disorder, decreased appetite, nutritional absorption disorder, mental abnormalities, and decreased immunity, such as affecting the memory and intelligence development of children, and even can lead to enuresis, fecal incontinence, etc., which seriously affects the growth and development and physical and mental health of children. If constipation in childhood is not effectively treated, a part of the children will suffer from other digestive system diseases in adulthood, which seriously affects their quality of life.
[0003] There is a complex relationship between constipation and intestinal flora. The intestinal flora of constipation patients is significantly different from that of healthy people. Studies have found that the abundance of certain genera in the intestines of constipation patients, such as Coprobacillus, Hungatella, Holdemanella, Anaerostipes, etc., is significantly increased, while the abundance of Megasphaera, Paraprevotella, Prevotella, Enterococcus, etc. is reduced. In addition, the diversity of the intestinal flora of constipation patients is usually lower than that of healthy people. In addition, the intestinal flora affects intestinal function by producing metabolic products such as short-chain fatty acids (SCFA). SCFA can increase the water content of feces and the contractility of the colon, reduce the transit time of the colon, and thus relieve constipation. The intestinal flora can also indirectly affect the motility and secretion function of the intestine by regulating the host's immune system. Dysbiosis of the intestinal flora can lead to abnormal intestinal immune function, and thus affect the normal function of the intestine.
[0004] Human milk oligosaccharides (HMOs) are the third most abundant nutrients in human milk, after lactose and fat. The HMOs content is highest in colostrum, about 20-25 g / L, and about 5-20 g / L in mature milk. HMOs are mainly lactose-derived oligosaccharides composed of five basic sugar units of glucose (Glc), sialic acid (SA), fucose (Fuc), N-acetylglucosamine (GlcNAc) and galactose (Gal). Different HMOs have different fucosylation and sialylation structures, so the HMOs in human milk can be divided into: (1) neutral fucosylated HMOs, such as 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL); (2) neutral non-fucosylated HMOs, such as lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT); (3) acidic sialylated HMOs, such as 3'-sialyllactose (3'-SL) and 6'-sialyllactose (6'-SL).
[0005] It has been shown that HMOs in human milk can regulate the intestinal flora of infants and young children.
[0006] For example, reference document 1 discloses a nutritional composition comprising at least one fucosylated oligosaccharide and at least one N-acetylated oligosaccharide, which can be used in infant formula, plays a role in regulating the intestinal flora of infants and young children, and achieves the effect of inducing intestinal microorganisms close to the intestinal microorganisms of breastfed infants.
[0007] Reference document 2 discloses the use of oligosaccharides, such as 2'-fucosyllactose or combinations of oligofructose, oligogalactose and 2'-fucosyllactose, in the preparation of products for regulating the intestinal flora, including inhibiting the adhesion ability of pathogenic bacteria, and / or improving the competitive adhesion and bacteriostatic ability of Lactobacillus rhamnosus, and / or improving the exclusion adhesion and bacteriostatic ability of Lactobacillus rhamnosus.
[0008] Reference 3 discloses the use of human milk oligosaccharides to improve the intestinal flora of mother and infant, specifically the use of 2'-fucosyllactose in the preparation of a food for consumption by a mother during pregnancy and / or lactation to help modulate the intestinal flora of the mother and her offspring. The invention proposes that the supplementation of a certain amount of 2'-fucosyllactose to the mother during pregnancy and / or lactation can significantly increase the abundance of beneficial bacteria in the mother's intestine and reduce the content of harmful bacteria, while significantly increasing the abundance of beneficial bacteria in the offspring's intestine and reducing the content of harmful bacteria, especially it can regulate the abundance of some non-edible beneficial bacteria in the mother's and offspring's intestine.
[0009] Reference 4 discloses a human milk oligosaccharide composition for improving the abundance of intestinal flora and the odor of feces of infants and young children and its application. The human milk oligosaccharide composition includes 2'-FL, 3'-FL, 3'-SL or 6'-SL, and ganglioside GM3, etc. The human milk oligosaccharide can increase the abundance of actinomycetes and firmicutes in the intestinal microbiome of infants and young children, increase the number of bifidobacteria and lactobacillus, change the composition of intestinal flora, and also reduce the pH value of the intestine and the content of indole and skatole, reduce the content of indole and skatole in the feces of infants and young children, improve the properties of the feces of infants and young children, and reduce the concentration of odor compounds.
[0010] Reference 5 discloses human milk oligosaccharides for regulating butyric acid and improving the health of intestinal microenvironment and their application, which include 2'-FL, 3'-FL, 3'-SL or 6'-SL. The improvement of the health of intestinal microenvironment includes: regulating the production of butyric acid in the intestinal system, increasing the total production of short-chain fatty acids, being utilized by intestinal flora in the intestinal system as a prebiotic and producing gas, reducing the production of isobutyric acid and isovaleric acid, and / or reducing the pH to maintain the health of intestinal microenvironment.
[0011] Reference 6 considers that HMOs play a key role in the formation and maintenance of a healthy infant intestinal flora, and the composition of the infant's intestinal microbiota is related to the metabolized HMOs. Since HMOs are resistant to low gastric pH and enzymes in the upper digestive tract, they cannot be digested in the upper part of the infant's gastrointestinal tract, and most of them reach the colon, where they affect the composition and activity of the intestinal microbiota as substrates for specific microorganisms (i.e., as prebiotics).
[0012] Reference 7 studies the effect of 2'-FL on the composition and metabolites of intestinal flora by simulating an infant intestinal model.
[0013] Although the above-mentioned prior art has disclosed the regulating effect of human milk oligosaccharides on intestinal flora, the research direction is mainly for the intestinal flora of healthy infants, and there is little report on the effect of intestinal flora in constipation.
[0014] CITED LITERATURE
[0015] CITED LITERATURE 1 (CN107847509B)
[0016] CITED LITERATURE 2 (CN115836733A)
[0017] CITED LITERATURE 3 (CN119138609A)
[0018] CITED LITERATURE 4 (CN110839702A)
[0019] CITED LITERATURE 5 (CN114568504A)
[0020] CITED LITERATURE 6: Yuan H, Xuanyiping, Pu Xiaolu, et al. Research Progress on the Correlation between Human Milk Oligosaccharides and Infant Intestinal Flora [J]. Food Science, 2021, 42(13): 7.
[0021] CITED LITERATURE 7: Salli, K., Anglenius, H., Hirvonen, J. et al. The effect of 2'-fucosyllactose on simulated infant gut microbiome and metabolites; a pilot study in comparison to GOS and lactose. Sci Rep 9, 13232 (2019). SUMMARY
[0022] PROBLEMS TO BE SOLVED BY THE INVENTION:
[0023] Although the prior art has disclosed the improvement of human milk oligosaccharides on intestinal flora, it is mainly for the intestinal flora of healthy infants, and there is little report on the influence of intestinal flora in constipation. It is known that the intestinal condition in constipation is different from that in normal condition, and it is not easy to find the answer whether or how to improve the intestinal condition in constipation to relieve constipation.
[0024] The present application relates to the use of human milk oligosaccharides to improve the intestinal flora environment in constipation, specifically or 6'-sialyllactose, in the preparation of food for the purpose of helping to regulate the intestinal flora environment through the intake of constipation. After a large amount of research, the present application proposes that the supplementation of a certain amount of 6'-sialyllactose in constipation can improve the constipation condition, significantly increase the content of short-chain fatty acids, significantly increase the beneficial bacteria in the intestine and reduce the abundance of harmful bacteria, and the intestinal flora diversity is close to that of normal mice, especially the abundance of some bacteria related to maintaining the balance of flora and promoting the production of short-chain fatty acids in the intestine.
[0025] Solutions for solving the problem:
[0026] 1. Use of a human milk oligosaccharide in the preparation of a food for improving constipation, wherein the human milk oligosaccharide is 6'-sialyl lactose;
[0027] The constipation is functional constipation;
[0028] The improvement of constipation comprises the following improvements:
[0029] (a) increasing the water content of feces;
[0030] (b) improving the peristalsis capacity of the intestine;
[0031] (c) regulating the SCF / C-kit signaling pathway.
[0032] 2. The use according to 1, wherein the regulation of the SCF / C-kit signaling pathway comprises increasing the transcription level of SCF and / or C-kit in the colon tissue.
[0033] 3. The use according to 1, wherein the improvement of constipation further comprises the following improvement: improving the intestinal flora abundance and diversity.
[0034] 4. The use according to 1, wherein the improvement of constipation further comprises the following improvement: regulating the intestinal flora structure.
[0035] 5. The use according to 4, wherein the regulation of the intestinal flora structure comprises at least one of the following: reducing the ratio of Firmicutes and Bacteroidetes, reducing the relative abundance of Adlercreutzia.
[0036] 6. The use according to 1, wherein the improvement of constipation further comprises the following improvement: restoring the content of short-chain fatty acids in the intestine.
[0037] 7. The use according to 6, wherein the restoration of the content of short-chain fatty acids in the intestine comprises increasing the content of at least one of the following: acetic acid, propionic acid, butyric acid and valeric acid.
[0038] 8. Use of a human milk oligosaccharide in the preparation of a food for improving the intestinal flora environment, wherein the human milk oligosaccharide is 6'-sialyl lactose;
[0039] The intestinal flora environment is the intestinal flora environment under constipation condition.
[0040] 9. The use according to 8, wherein the improvement of the intestinal flora environment comprises improving the intestinal flora abundance and diversity, and / or regulating the intestinal flora structure.
[0041] Optionally, the increasing the abundance and diversity of gut microbiota comprises increasing the relative abundance of Verrucomicrobia;
[0042] Optionally, the increasing the abundance and diversity of gut microbiota comprises increasing the relative abundance of one or more of Lactobacillus, Bacteroides, Akkermansia, Adlercreutzia, Parabacterodes, Corynebacterium, Anaerotruncus, Anaeroplasma and Anaerostipes;
[0043] Optionally, the adjusting the structure of gut microbiota comprises at least one of decreasing the ratio of Firmicutes and Bacteroidetes, and decreasing the relative abundance of Adlercreutzia.
[0044] 10. The use according to any one of 1-9, wherein the food product is an oral preparation; the oral preparation comprises at least one of a tablet, a pill, a granule, a powder, a tea, a capsule and an oral liquid.
[0045] 11. The use according to 10, wherein the food product comprises at least one of a plant product ingredient, an animal milk product ingredient, an animal meat product ingredient, a functional additive ingredient and any acceptable adjuvant in food products.
[0046] 12. The use according to any one of 1-10, wherein the food product is a candy, a beverage, a dairy product, a baked food, a special dietary food or a dietary supplement.
[0047] 13. The use according to any one of 1-12, wherein the food product comprises the human milk oligosaccharide in an amount of at least 0.05%.
[0048] Effects of the invention:
[0049] The food containing 6'-sialic acid lactose provided by this invention can significantly improve constipation, specifically by increasing fecal water content, enhancing intestinal motility, increasing the content of short-chain fatty acids in the intestine, and improving the abundance and diversity of intestinal flora. More specifically, it includes: increasing the relative mRNA expression levels of SCF and C-kit in colonic tissue to relieve constipation; improving intestinal flora α diversity (Chao1 index, Observed species index, Shannon index, and Simpson index); reducing the difference between intestinal flora β diversity analysis and normal mice; intestinal flora at the phylum level (e.g., Firmicutes, Bacteroidetes) being closer to normal mice; intestinal flora at the genus level (e.g., Bacteroidetes, Akkermansia); increasing the relative abundance of Lactobacillus and Akkermansia, which maintain intestinal flora balance and intestinal barrier, inhibit the growth of harmful bacteria, and prevent intestinal infection and inflammation; and increasing the relative abundance of Bacteroidetes and Ruminococcus, which promote the production of short-chain fatty acids to maintain intestinal health and inhibit the growth of harmful microorganisms. Attached Figure Description
[0050] Figure 1 The images show the morphology of mouse feces; A: feces of mice in group K; B: feces of mice in group M; C: feces of mice in group Y.
[0051] Figure 2 The effect of different doses of 6'-SL on the α diversity of gut microbiota in constipated mice; A: Chao 1 index; B: Observed species index; C: Simpson index; D: Shannon index; where * indicates p < 0.05, ** indicates p < 0.01.
[0052] Figure 3 The effect of different doses of 6'-SL on the β diversity of gut microbiota in constipated mice; A: PCoA analysis; B: NMDS analysis.
[0053] Figure 4 Effects of different doses of 6'-SL on the relative abundance of gut microbiota in constipated mice (phylum level); A: Bar chart of average relative abundance of species at the phylum level for each group; B: Relative abundance of Firmicutes; C: Relative abundance of Bacteroidetes; D: Ratio of relative abundance of Firmicutes to relative abundance of Bacteroidetes; E: Relative abundance of Verrucomicrobia; Different letters indicate significant differences between treatment groups (P < 0.05).
[0054] Figure 5Effects of different doses of 6'-SL on the relative abundance of intestinal flora of constipated mice (genus level); A: species average relative abundance column chart of each group at genus level; B: relative abundance of Lactobacillus; C: relative abundance of Bacteroides; D: relative abundance of Akkermansia; E: relative abundance of Adlercreutzia; F: relative abundance of Parabacterodes. Different letters indicate significant differences between each treatment group (P<0.05).
[0055] Figure 6 LEfSe species difference analysis of intestinal flora of each group of mice intervened by different doses of 6'-SL; A: taxonomic branch diagram; B: LDA column chart. DETAILED DESCRIPTION
[0056] Various exemplary embodiments, features, and aspects of the present application will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.
[0057] In addition, for a better understanding of the present application, numerous specific details are given in the following detailed description. It will be understood by those skilled in the art that the present application can be practiced without certain specific details, which are provided for the purpose of illustration. In other instances, methods, apparatuses, and steps well known to those skilled in the art are not described in detail in order to avoid obscuring the subject matter of the present application.
[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The meaning of "a", "an", and "the" includes plural references unless otherwise indicated. The meaning of "in" includes "in" and "on" unless otherwise indicated. The meaning of "including" and "comprising" includes "open" terms such as "comprising" and "including" but also "closed" terms such as "consisting of" and "consisting essentially of".
[0059] In this specification, the meaning of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.
[0060] In this specification, "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", and the like refer to the specific elements (e.g., features, structures, properties, and / or characteristics) described in relation to the embodiment, which are included in at least one embodiment described herein, and can be present in other embodiments or can not be present in other embodiments. In addition, it should be understood that the elements can be combined in various embodiments in any suitable manner.
[0061] In the present specification, "optional" and "optionally" mean that the subsequently described event or circumstance can or can not occur, and that the description includes the situation in which the event or circumstance occurs and the situation in which the event or circumstance does not occur.
[0062] In the present specification, the numerical range indicated using "numerical value A ~ numerical value B" means a range including the end point numerical values A, B.
[0063] In the present specification, when "room temperature" is used, the temperature thereof can be 23 ± 2°C.
[0064] In addition, unless otherwise defined, other technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.
[0065] The present application was mainly completed based on the following insight:
[0066] Human milk oligosaccharides have been proven to have the effect of improving the intestinal flora of infants, but the research objects are mostly aimed at the intestinal environment of healthy infants, and there is no report on the improvement of the intestinal environment under constipation. The effect of human milk oligosaccharides on the intestinal environment under constipation is unknown, and whether it can or how to improve the intestinal environment under constipation to relieve constipation is not easy to know. The present application constructs a constipation mouse model, and applies human milk oligosaccharides to the model, and it is unexpectedly found that human milk oligosaccharides can improve the constipation symptoms of mice, and significantly promote the improvement of the microbial abundance in the intestine, the reduction of the ratio of Firmicutes and Bacteroidetes, the improvement of the SCF / C-kit pathway, and the increase of the content of short-chain fatty acids.
[0067] That is, the present application relates to the use of human milk oligosaccharides in the preparation of (functional) foods for improving constipation, the human milk oligosaccharides being 6'-sialyllactose, and the constipation being functional constipation.
[0068] At the same time, the present application also relates to the use of 6'-sialyllactose in the preparation of foods having one or more of the following effects: regulating the SCF / C-kit signal pathway, increasing the water content of feces, improving the intestinal peristalsis, improving the intestinal flora abundance and diversity, regulating the intestinal flora structure, and restoring the content of short-chain fatty acids in the intestine.
[0069] I. Human milk oligosaccharides
[0070] Human milk oligosaccharides are a class of complex non-digestible sugars, mainly composed of 3-10 monosaccharides (such as glucose, galactose, N-acetylglucosamine, fucose, sialic acid). In some specific embodiments of the present application, the human milk oligosaccharides are 6'-sialyllactose.
[0071] The 6'-sialyllactose (6'-SL) described in the present application is a disaccharide containing sialic acid, mainly formed by lactose (D-galactose and D-glucose) and sialic acid (N-acetylneuraminic acid) connected by an α-2,6 glycosidic bond, C 23 H 39 O 19 , and the molecular weight is 633.55 g / mol.
[0072] The present application does not make special limitation to the source of the 6'-sialyllactose, which can be natural source, synthetic source, microbial fermentation source, etc. Typically, for 6'-sialyllactose, sialic acid (N-acetylneuraminic acid, Neu5Ac) can be connected with lactose by chemical reaction and other steps to be synthesized; or lactose + CMP-Neu5Ac (cytidine-5'-monophosphate-sialic acid) as the substrate, catalyzed by sialic acid synthase (such as NeuA) and CMP-sialic acid synthase (such as CSS) to generate CMP-Neu5Ac, under the action of sialic acid transferase, the sialic acid of CMP-Neu5Ac is transferred to the 6'-OH position of lactose to generate 6'-sialyllactose.
[0073] In some embodiments, the mass content of 6'-sialyllactose can be 60% or more, preferably 80% or more, more preferably 90% or more, or any other content, relative to the total mass of each source product of 6'-sialyllactose.
[0074] II. Food
[0075] The food described in the present application contains or uses the breast milk oligosaccharide described above, especially 6'-sialyllactose.
[0076] The present application does not make special limitation to the specific form of the food. At room temperature, the edible nutrient is solid, semi-solid or liquid, which can exemplarily include drinkable composition, powder or granular composition, gel, frozen or partially frozen composition. The food can optionally form part of a capsule filling, or can optionally form part of a beverage, dairy product, non-dairy cream, sauce or baked food.
[0077] In some specific embodiments, the food can be powdered instant food (solid beverage, instant coffee, cereal powder, nut powder or lotus root powder, etc.), baked food (bread, cake or biscuit baked food, etc.), beverage (carbonated beverage, fruit and vegetable juice beverage, functional beverage, tea beverage, milk beverage or alcoholic beverage, etc.), candy (gel candy, hard candy, pressed tablet, etc.), milk and dairy product (fresh milk derived from raw cow (sheep) milk, milk powder, whey powder, fermented milk, cheese or condensed milk, etc.), etc.
[0078] In other embodiments, the food of the present application can also be a health food, such as various types of oral preparations, including but not limited to tablets, pills, granules, powders, tea, capsules, or oral liquids, etc.
[0079] The present application does not particularly limit the absolute content of 6'-sialyllactose in the food, and the requirement of local food-related laws and regulations can be met. In some embodiments, the mass content of the 6'-sialyllactose is at least 0.05%, preferably at least 0.1%, more preferably at least 1%, and further preferably at most 12%, relative to the total mass of the food.
[0080] In addition to the 6'-sialyllactose, other ingredients such as proteins / amino acids, carbohydrates, fats, vitamins, minerals, etc. that are often contained in foods can also be included. Furthermore, depending on the type of food and the final needs of the target subject, in some embodiments, the food of the present application also contains any one or more of the following ingredients: plant product ingredients, animal milk product ingredients, animal meat product ingredients, functional additive ingredients, and any acceptable adjuvants.
[0081] For plant product ingredients, examples include fruits such as figs, pomegranates, kiwis, oranges, tangerines, pineapples, strawberries, apples, bananas, grapes, pears, cherries, blueberries, blackberries, blackcurrants, cranberries, raspberries, melons, emblics, and mulberries, or extracts thereof; vegetable materials such as onions, cucumbers, tomatoes, cauliflowers, red beetroots, spinach, kohlrabi, Brussels sprouts, garlic, basil, Oregon grass, or extracts thereof; cereals such as rice (indica rice, japonica rice, waxy rice), wheat (wheat, barley, oat, rye), corn, sorghum, millet, foxtail millet, yellow rice, buckwheat, soybeans, fava beans, peas, mung beans, adzuki beans, kidney beans, or extracts thereof; nut materials such as walnuts, pistachios, cashews, hazelnuts, almonds, apricot kernels, pine nuts, peanuts, melon seeds, chestnuts, macadamia nuts, ginkgo nuts, or extracts thereof; coffee or extracts thereof; and some medicinal and edible plant materials or extracts thereof.
[0082] For animal milk product ingredients, examples include fresh milk derived from mammals such as cows, sheep, and camels, as well as reprocessed milk products such as full-fat milk powder, skim milk powder, concentrated whey protein powder, desalted whey powder, whey protein powder, and hydrolyzed whey protein powder.
[0083] For animal meat product ingredients, examples include meat product ingredients of pigs, cows, sheep, aquatic animals, or birds, etc.
[0084] For functional additive ingredients, examples include vitamin supplements, mineral supplements, nucleotide supplements, dietary fibers, functional polyunsaturated fatty acid supplements, etc.
[0085] For any acceptable adjuvant, examples can include solvents, antioxidants, antibacterial agents, thickening agents, diluents, co-solvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, food flavors, food colors, and the like.
[0086] III. Use for improving constipation
[0087] The present application surprisingly found that 6'-sialyllactose can effectively improve constipation, especially functional constipation. The improvement of constipation includes one or more of the following: regulating SCF / C-kit signaling pathway, increasing fecal water content, improving intestinal peristalsis, improving intestinal flora abundance, regulating intestinal flora structure, and restoring short-chain fatty acid content in the intestine.
[0088] In some embodiments, the SCF (stem cell factor) / C-kit signaling pathway plays a key role in the regulation of gastrointestinal motility, and its dysfunction is closely related to the occurrence of constipation. It mainly acts on interstitial cells of Cajal (ICC), regulates the rhythmic contraction of smooth muscle by generating slow wave potentials, and directly affects gastrointestinal motility. In the colon tissue of constipated mice, the mRNA content of SCF and C-kit was significantly decreased compared with the blank control group, and after the administration of 6'-sialyllactose, the mRNA expression of SCF and C-kit in the colon tissue of constipated mice was significantly improved.
[0089] In some embodiments, the improvement of intestinal peristalsis includes the improvement of intestinal transit rate and the shortening of the time of the first black stool.
[0090] In some embodiments, the present application performs alpha diversity analysis, beta diversity analysis, difference analysis at the door level, difference analysis at the genus level, and LEfSe species difference analysis on the intestinal flora of mice, so as to find that the 6'-sialyllactose provided in the present application can improve the decrease of intestinal flora abundance and diversity in constipated mice.
[0091] In some specific embodiments, the improvement of the decrease of intestinal flora abundance and diversity in constipated mice includes the improvement of Chao1 index, Observed species index, Shannon index and Simpson index; the reduction of the difference from the flora diversity of normal mice alleviates the change of intestinal flora beta diversity in constipated mice.
[0092] In some specific embodiments, 6'-sialyllactose can reduce the relative abundance of Firmicutes and increase the relative abundance of Bacteroidetes and Verrucomicrobia in the gut of constipated mice at the phylum level. The increase of the relative abundance of Firmicutes and the decrease of the relative abundance of Bacteroidetes in the gut of constipated mice can result in the increase of the ratio of Firmicutes to Bacteroidetes (F / B ratio), which is an important indicator of the composition of gut microbiota and is closely related to the occurrence and development of constipation. The administration of 6'-sialyllactose can also significantly improve the increase of the F / B ratio, bringing the F / B ratio close to that of normal mice and improving the constipation.
[0093] In some specific embodiments, 6'-sialyllactose can also improve the relative abundance of gut microbiota at the genus level.
[0094] In some exemplary embodiments, 6'-sialyllactose can increase the relative abundance of Lactobacillus and Akkermansia, which are related to maintaining the balance of gut microbiota and intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation.
[0095] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Bacteroides, which is related to promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in the gut microbiota.
[0096] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Corynebacterium and decrease the relative abundance of Adlercreutzia.
[0097] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Parabacterodes, which is related to sugar metabolism and short-chain fatty acid secretion.
[0098] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Anaerotruncus, Anaeroplasma, and Anaerostipes, which are related to short-chain fatty acid secretion in the gut.
[0099] In some embodiments of the present application, 6'-sialyllactose improves the condition of constipation by improving the condition of intestinal flora. In particular, high dose of 6'-sialyllactose has more significant effect on the improvement of intestinal flora abundance and diversity, and also has more significant effect on the improvement of constipation.
[0100] Further, the present application also found that, in accordance with the improvement of intestinal flora abundance and intestinal flora structure, 6'-sialyllactose has a significant promoting effect on the recovery of short-chain fatty acid content in the intestine of constipation mice. The present application found that the content of short-chain fatty acids including formic acid, acetic acid, propionic acid, butyric acid, etc. in the intestine of constipation mice is significantly decreased, and after the administration of 6'-sialyllactose, the content of short-chain fatty acids can be recovered, and in particular, high dose of 6'-sialyllactose has a better recovery effect.
[0101] Therefore, the food containing human milk oligosaccharides, in particular 6'-sialyllactose provided by the present application, is helpful for relieving constipation, in particular functional constipation. The improvement of constipation by the present application is not for the purpose of preventing and treating diseases.
[0102] IV. Use for improving intestinal flora environment
[0103] The present application found that 6'-sialyllactose can improve the intestinal flora environment under the condition of constipation, in particular functional constipation. The improvement of intestinal flora under the condition of constipation includes the improvement of intestinal flora abundance and diversity, and the regulation of intestinal flora structure.
[0104] In some specific embodiments, at the phylum level of intestinal flora, the improvement of intestinal flora abundance and diversity includes the improvement of the relative abundance of Verrucomicrobia.
[0105] In some specific embodiments, at the genus level of intestinal flora, the improvement of intestinal flora abundance and diversity includes the increase of the abundance and diversity of beneficial bacteria.
[0106] In some exemplary embodiments, 6'-sialyllactose can improve the relative abundance of Lactobacillus and Akkermansia which are related to maintaining the balance of intestinal flora and intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infection and inflammation.
[0107] In some specific embodiments, 6'-sialyllactose can improve the relative abundance of Bacteroides which is related to promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in intestinal flora.
[0108] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Parabacterodes, which is associated with sugar metabolism and short-chain fatty acid secretion.
[0109] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Anaerotruncus, Anaeroplasma, and Anaerostipes, which are anaerobic bacteria in the intestine and are associated with short-chain fatty acid secretion.
[0110] In some specific embodiments, 6'-sialyllactose can also increase the relative abundance of Corynebacterium.
[0111] In some specific embodiments, 6'-sialyllactose can decrease the relative abundance of Firmicutes and increase the relative abundance of Bacteroidetes in the intestine of constipated mice. The increase in the relative abundance of Firmicutes and the decrease in the relative abundance of Bacteroidetes in the intestine of constipated mice lead to an increase in the ratio of Firmicutes to Bacteroidetes (F / B ratio), which is an important indicator of the composition of intestinal flora and is closely related to the occurrence and development of constipation. After administration of 6'-sialyllactose, the increase in the F / B ratio can be significantly improved, thereby improving the constipation condition.
[0112] In some specific embodiments, 6'-sialyllactose can decrease the relative abundance of Adlercreutzia.
[0113] On this basis, the food containing 6'-sialyllactose provided by the present application helps to alleviate the intestinal flora environment under constipation, especially under functional constipation. The improvement of the intestinal flora environment by the present application is not for the purpose of preventing and treating diseases.
[0114] Examples
[0115] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. If no specific conditions are specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If no manufacturer of the reagent or instrument is specified, it is a conventional product that can be obtained by purchase.
[0116] 1 Materials and Methods
[0117] 1.1 Raw materials:
[0118] Table 1 Experimental raw materials
[0119]
[0120] 1.2 Animal experimental design:
[0121] 60 healthy male BALB / c mice (6 weeks old, 20 g) were raised under the conditions of 12 h light / dark cycle, 25±2℃ temperature, 55%-65% humidity, and free access to sterile water and normal feed during the whole experiment. After one week of adaptive feeding, they were randomly divided into 6 groups, 10 in each group, namely blank group (K), constipation model group (M), positive control group (Y), high-dose 6'-SL group (H6), medium-dose 6'-SL group (M6), and low-dose 6'-SL group (L6). Except for the blank group, the mice in other groups were given loperamide 10 mg / kg bw by gavage once a day at 9 am, and the blank group was given the same volume of normal saline by gavage, for 7 days. On the 8th day, the K group was given normal saline by gavage every day, while the rest of the groups were given loperamide 10 mg / kg·bw. Two hours after the loperamide gavage, the M group was given normal saline by gavage, the Y group was given mosapride 2.5 mg / kg·bw by gavage, and the H6, M6, and L6 groups were given 6'-SL 500 mg / kg·bw, 300 mg / kg·bw, and 100 mg / kg·bw, respectively. On the 29th day, the mice were fasted (with free access to water) for 12 h, and the contents of the colon and cecum were taken and collected in sterile centrifuge tubes for subsequent microbiota sequencing analysis. The remaining animal tissues were frozen at -80℃ in a ultra-low temperature freezer for later use.
[0122] Table 2 Experimental grouping
[0123]
[0124] 1.3 Health index
[0125] During the feeding of the mice, the defecation, activity, and death of the mice were observed every day. In addition, the body weight, water intake, and food intake of the mice were recorded at the same time every day.
[0126] 1.4 Determination of constipation-related indicators
[0127] Fecal water content: feces were collected at 14 d and 28 d of feeding, and the feces were dried until the weight was constant to obtain the dry weight and water content of the feces. At the same time, the fecal samples collected at 28 d were stored at -80℃ for analysis of short-chain fatty acids and intestinal microbiota. The fresh mouse feces obtained were weighed and recorded as wet weight. Then, the feces were dried at 105℃ for 5 h until the weight was constant, and then weighed and recorded as dry weight:
[0128] Fecal water content = (wet weight - dry weight) / dry weight × 100%
[0129] Measurement of defecation time: On day 28, all mice were fasted overnight for 12 h, then gavaged with active charcoal solution (10% active charcoal, 0.5% carboxymethylcellulose suspension), and then placed in metabolic cages, respectively. The time between active charcoal intake and defecation of dark feces was recorded for each mouse.
[0130] Gastrointestinal transit rate: On day 29, active charcoal solution was gavaged. After 30 min, all mice were euthanized by cervical dislocation and dissected to collect the small intestine. The distance from the pylorus to the active charcoal boundary was considered as the migration distance. After measuring the length, the gastrointestinal transit rate was calculated using the following formula:
[0131] Gastrointestinal transit rate = active charcoal migration distance / small intestine total length x 100%
[0132] Total mRNA was extracted from the colon of mice using an RNA extraction kit, and cDNA was synthesized using a reverse transcription kit according to the manufacturer's instructions. PCR was performed using SYBR Green Master Mix. The genes detected included SCF and C-kit of the colon tissue.
[0133] SCF-F: AGCTTGACTACTCTTCTGGACA (SEQ ID NO: 1)
[0134] SCF-R: TGGCCTCTTCGGAGATTCTTTT (SEQ ID NO: 2)
[0135] C-kit-F: GGCCTCACGAGTTCTATTTACG (SEQ ID NO: 3)
[0136] C-kit-R: GGGGAGAGATTTCCCATCACAC (SEQ ID NO: 4)
[0137] Actin-F: GATATCGCTGCGCTGGTCG (SEQ ID NO: 5)
[0138] Actin-R: CATTCCCACCATCACACCCT (SEQ ID NO: 6)
[0139] 1.5 High-throughput analysis of colon content flora
[0140] After the mice in each group were sacrificed by cervical dislocation, the intestinal contents of the mice were collected in sterile cryogenic tubes, quickly placed in liquid nitrogen for preservation, and then stored in a -80°C refrigerator. First, total DNA was extracted from the samples using a DNA kit and quality detection was performed. After passing the quality detection, the 16S rDNA hypervariable region (V3-V4 region) was sequenced. According to the 16S rDNA similarity of the microbial population, a MiSeq library was constructed and the 16S rDNA sequencing process was completed by the sequencing company. Then, the raw data was subjected to bioinformatics analysis, and the effective tags obtained after filtering were subjected to clustering analysis to obtain the representative sequences of the Operational Taxonomic Units (OTU). The OTU sequences were annotated to obtain the corresponding microbial species, and the abundance and structural changes of the intestinal flora species of the mice in each group at the phylum and genus levels were analyzed. LEfSe analysis was used to find the differences in species.
[0141] V3-V4 region amplification primer-F: ACTCCTACGGGAGGCAGCA (SEQ ID NO: 7)
[0142] V3-V4 region amplification primer-R: GGACTACHVGGGTWTCTAAT (SEQ ID NO: 8)
[0143] 1.6 Determination of fecal short-chain fatty acid content
[0144] A gas chromatograph and mass spectrometer (GC-MS) were used to analyze and determine the levels of acetic acid, propionic acid, butyric acid, and valeric acid in the feces of mice. Briefly, 100 mg of fecal sample was homogenized with 1 mL of 0.5% phosphoric acid and centrifuged at 12000 x g for 10 min. The collected supernatant was mixed with 500 μL of ethyl acetate, and then analyzed by a 0.22 μm PVDF membrane. SCFAs were separated using a gas chromatograph-mass spectrometer system equipped with an Agilent DB-WAX capillary column (30 m x 0.25 mm ID x 0.25 μm, 0.25 μm film thickness, 5% phenylmethylsiloxane). Helium was used as the carrier gas (99.999%) at a rate of 1.00 mL / min. The column temperature was initially set to 90°C, gradually increased to 150°C at 10°C / min, then gradually increased to 230°C at 20°C / min, and finally maintained for 3 min. The ion source temperature, forward sample orifice temperature, and interface temperature were set to 230, 250, and 280°C, respectively. The detector was operated in electron impact ionization mode (electron energy 70 eV) with a scan range of 30−250 m / z.
[0145] 1.7 Statistical analysis:
[0146] Experimental data are expressed as mean ± standard deviation. Statistical analysis was performed using SPSS 26.0 software. One-way ANOVA was used, and the Turkey test was employed to compare differences between groups. P < 0.05 was considered statistically significant, and P > 0.05 was considered not statistically significant.
[0147] 2 Experimental Results
[0148] 2.1 Effects of human milk oligosaccharides on constipation indices in mice
[0149] The characteristics of mouse feces are one of the important indicators for successfully establishing a constipation model. For example... Figure 1 As shown in Figure A, the feces of the control group mice were cylindrical and smooth. Compared with the control group mice, the feces of the model group mice were dull, hard, dry, and granular. Figure 1 (B). Compared with the model group, the feces of mice in the positive drug group were moist, cylindrical, and the length of the feces was similar to that of the blank group. Figure 1 (C). Fecal water content is one of the important indicators reflecting the degree of constipation in mice. The effect of human milk oligosaccharides on the fecal water content of mice is shown in Table 3. Compared with group K, the fecal water content of mice in group M was significantly reduced (P<0.05), indicating that the administration of loperamide caused the feces to become dry and hard. Compared with group M, the fecal water content of mice in group Y was significantly increased (P<0.05). After intervention with different doses of 6'-SL, the fecal water content was significantly higher than that of group M (P<0.05). The time to first black stool can reflect the peristaltic ability of the entire gastrointestinal tract. The longer the time to first black stool, the weaker the peristaltic ability of the mouse's gastrointestinal tract. As shown in Table 3, the time to first black stool in group M was significantly higher than that in group K. Compared with group M, the time to first black stool in group Y was significantly reduced (P<0.05), indicating that mosapride can effectively improve the peristaltic ability of the gastrointestinal tract. Compared with group M, the time to first black stool was significantly reduced after intervention with different doses of 6'-SL (P<0.05). Intestinal transit rate reflects the peristaltic capacity of the entire gastrointestinal tract and is an important indicator for evaluating constipation. The faster the intestinal transit rate, the more conducive it is to the excretion of feces. As shown in Table 3, compared with group K, the intestinal transit rate of M mice was significantly reduced (P<0.05), similar to the results of the time to first black stool and fecal water content, indicating that the constipation model had been successfully established. Compared with group M, the intestinal transit rate of mice was significantly increased after intervention with positive control drugs and different doses of 6'-SL (P<0.05). These results indicate that 6'-SL can significantly improve constipation induced by loperamide in mice.
[0150] The SCF / C-kit pathway plays a crucial role in the treatment of constipation. SCF / C-kit signal is essential for the development, differentiation and phenotype maintenance of interstitial cells of Cajal (ICC). Abnormalities in the SCF / C-kit signaling pathway can lead to impaired ICC number and function, which in turn affects the conduction of intestinal neural signals and the motor function of intestinal smooth muscle, resulting in a slower transport of intestinal contents and triggering constipation symptoms. The present application studies the effect of 6'-SL on the mRNA expression of SCF and C-kit in the colon tissue of constipated mice by RT-qPCR, and the results are shown in Table 4. Compared with the blank K group, the mRNA relative expression of SCF and C-kit in the M group of mice after loperamide intervention was significantly reduced (P<0.05). Compared with the model M group, the mRNA expression of C-kit in the colon tissue of mice treated with different doses of 6'-FL was significantly increased (P<0.05). After treatment with different doses of 6'-SL, the mRNA expression of C-kit in the colon tissue of mice was significantly increased (P<0.05). After treatment with high and medium doses of 6'-SL, the mRNA expression of SCF in the colon tissue of mice was significantly increased (P<0.05). These results show that 6'-SL can significantly regulate the mRNA expression level of SCF / C-kit, thereby relieving loperamide-induced constipation.
[0151] Table 3 Effect of milk oligosaccharides on defecation indicators of mice
[0152]
[0153] Note: * compared with the blank control K group P<0.05; # Compared with the model M group P<0.05
[0154] Table 4 Effect of milk oligosaccharides on the mRNA relative expression of SCF and C-kit in the colon tissue of mice
[0155]
[0156] Note: * compared with the blank control K group P<0.05; # Compared with the model M group P<0.05
[0157] 2.2 Intestinal flora:
[0158] 2.2.1 Effect of 6'-SL on intestinal flora of constipated mice
[0159] (1) Analysis of intestinal flora alpha diversity of mice in each group intervened by different doses of 6'-SL
[0160] Alpha diversity (α diversity) refers to the microbial species diversity in a specific region or ecosystem, and is a comprehensive index reflecting the richness and evenness of microbial species. Chao1 index and Observed species index are commonly used to evaluate the species richness of microorganisms. The greater the Chao1 index and Observed species index, the higher the species richness. Simpson index and Shannon index are commonly used to evaluate the species diversity of microorganisms. The greater the Simpson index and Shannon index, the higher the species diversity.
[0161] In the present application, Chao1 index and Observed species index are used to represent the richness of species, and Shannon index and Simpson index are used to represent the diversity of species. The effect of breast milk oligosaccharide 6'-SL on the alpha diversity of intestinal flora of constipated mice is shown in Figure 2 The Chao1 index, Observed species index, Shannon index and Simpson index of the constipation model group (M) were significantly lower than those of the K group (P<0.05), indicating that constipation had a negative impact on the species richness and diversity of intestinal flora in mice. Different doses of breast milk oligosaccharide 6'-SL intervention alleviated this negative impact to different degrees (P>0.05), and the species richness and diversity of intestinal flora in constipated mice were improved. Among them, as shown in Figure 2 A and Figure 2 D of The Chao1 index of the L6 group, the M6 group and the H6 group was 691.45, 774 and 857.79, respectively. The Observed species index of the L6 group, the M6 group and the H6 group was 650.75, 737 and 811.25, respectively. With the increase of the dose of breast milk oligosaccharide 6'-SL, the Chao1 index and the Observed species index also increased (P>0.05), which showed a certain dose-dependent effect. The alpha diversity results showed that breast milk oligosaccharide 6'-SL could alleviate the changes in the species richness and diversity of intestinal flora caused by constipation, and the high-dose 6'-SL group (H6) had the best effect.
[0162] (2) β diversity analysis of intestinal flora of mice in each group intervened with different doses of 6'-SL
[0163] Beta diversity is commonly visualized using techniques such as PCoA (Polymeric Propagation-Coefficient of Ambient Occurrence) and NMDS (Non-Mass Difference-Based Distance). Both PCoA and NMDS reflect the similarity of gut microbiota structure among samples, but NMDS focuses more on the ranking of values in the distance matrix, downplaying absolute differences. The effects of different doses of human milk oligosaccharide 6'-SL on beta diversity of gut microbiota in constipated mice are shown below. Figure 3 As shown. PCoA analysis of mice in each group is as follows. Figure 3 As shown in Figure A, PC1 contributed 24.8%, and PC2 contributed 19.2%. The sum of the contributions of PC1 and PC2 was greater than 30%, indicating that the constipation model was successfully established in this experiment. The PCoA plot showed a significant difference in the gut microbiota between the K and M groups. The data points of the L6, M6, and H6 groups were between the K and M groups, with the H6 group being closest to the K group. Figure 3 As shown in Figure B, NMDS analysis also revealed similar results, with significant differences in gut microbiota between groups K and M. After intervention with different doses of human milk oligosaccharide 6'-SL, the data points converged towards group K. These results indicate that the beta diversity of gut microbiota in constipated mice induced by lopidine was altered, and different doses of human milk oligosaccharide 6'-SL alleviated the alteration of beta diversity in the gut microbiota of constipated mice to varying degrees, with the high-dose group (H6) showing the best alleviating effect.
[0164] (3) Differences in gut microbiota at the phylum level among mice in different groups treated with different doses of 6'-SL
[0165] The composition of the gut microbiota at the phylum level in each group of mice is as follows: Figure 4 As shown, a total of 10 major bacterial groups were detected, including Bacteroidetes, Firmicutes, Actinobacteria, Proteobacteria, TM7, Verrucomicrobia, Tenericulates, Deferribacteres, Cyanobacieria, and Acidobacteria. These 10 phyla accounted for more than 99% of the total intestinal flora in all groups of mice, with Bacteroidetes and Firmicutes having the highest relative abundance and dominating in number. The intestinal flora structure of mice in different groups treated with different doses of 6'-SL was similar, but the proportion of each phylum varied. Figure 4 As shown:
[0166] ① The average relative abundance of Bacteroidetes in the intestinal contents of mice in group K was 61.31%, while in group M it was 47.36%. Compared with group K, the relative abundance of Bacteroidetes in the intestinal contents of mice in group M was significantly reduced (P < 0.05). In addition, after low, medium and high doses of 6'-SL intervention (L6, M6 and H6 groups), the relative abundance of Bacteroidetes showed different degrees of increase (P > 0.05), accounting for 55.54%, 54.53% and 58.42%, respectively. Furthermore, compared with the blank group K, the relative abundance of Firmicutes in the intestinal flora of the constipation model group (M) induced by loperamide was significantly increased (P < 0.05), increasing by 14.78%, and the ratio of Firmicutes to Bacteroidetes was significantly increased (P < 0.05), from 0.52 to 1.02. Compared with group M, after intervention with different doses of 6'-SL, the relative abundance of Firmicutes and the ratio of Firmicutes to Bacteroidetes decreased, showing a certain dose-dependent effect (P > 0.05). Notably, the relative abundance of Firmicutes and the ratio of Firmicutes to Bacteroidetes in the gut microbiota of mice in the high-dose 6'-SL intervention group were significantly lower than those in group M (P < 0.05), and there was no significant difference compared with group K (P > 0.05).
[0167] ② Compared to group K, the relative abundance of verrucous microbes increased to varying degrees after low, medium, and high dose 6'-SL intervention (L6, M6, and H6 groups), with the proportion increasing from 0% to 0.2%, 1.62%, and 3.22%, respectively. Compared to group M, the proportion of verrucous microbes increased from 0.38% to 1.62% and 3.22% after medium and high dose 6'-SL intervention (M6 and H6 groups), respectively. Therefore, the proportion of verrucous microbes significantly increased after medium and high dose 6'-SL intervention (P<0.05).
[0168] (4) Differences in gut microbiota at the genus level among mice in different groups treated with different doses of 6'-SL.
[0169] At the genus level, this study selected the top 20 genera in terms of relative abundance and plotted a genus-level relative abundance map by classifying them.
[0170] like Figure 5 As shown in A, compared with group K, the species composition of mice in group M differed at the genus level, indicating that constipation leads to changes in the gut microbiota structure of mice.
[0171] The relative abundance of Lactobacillus, Bacteroides, Akkermansia, Adlercreutzia, and Parabacterodes was significantly improved after 6'-SL intervention.
[0172] ① For example Figure 5 B- Figure 5 As shown in Figure C, compared with group K mice, the relative abundance of *Lactobacillus* and *Bacteroides* was significantly decreased in group M mice (P < 0.05). After intervention with human milk oligosaccharide 6'-SL, the relative abundance of *Lactobacillus* in group M6 mice was significantly higher than that in group M (P < 0.05). The relative abundance of *Lactobacillus* in group H6 mice was 7.56% higher than that in group M, but the difference was not statistically significant (P > 0.05). The relative abundance of *Bacteroides* in group H6 was significantly higher than that in group M (P < 0.05). In particular, the relative abundance of *Bacteroides* in group H6 was significantly higher than that in groups L6 and M6 (P < 0.05).
[0173] ② For example Figure 5 As shown in D, compared with group K, the relative abundance of Akkermansia increased to varying degrees after intervention with different doses of human milk oligosaccharide 6'-SL (P>0.05), with the highest relative abundance of Akkermansia in group H6 at 3.22%.
[0174] ③ The relative abundance of *Adlercreutzia* in each group of mice is as follows: Figure 5 As shown in Figure E, the relative abundance of *Adelknez* spp. in group M mice was higher than that in group K (P > 0.05). After intervention with different doses of human milk oligosaccharide 6'-SL, the relative abundance of *Adelknez* spp. showed varying degrees of decrease (P > 0.05). Among them, the relative abundance of *Adelknez* spp. in group H6 was the lowest at 0.77%.
[0175] ④ For example Figure 5 As shown in F, the relative abundance of *Parabacteroides* in group M mice was significantly decreased compared to group K (P < 0.05). Compared to group M mice, the relative abundance of *Parabacteroides* showed varying degrees of increase after low, medium, and high doses of 6'-SL intervention (L6, M6, and H6 groups). The relative abundance of *Parabacteroides* in groups L6 and M6 were 1.48% and 1.42%, respectively, significantly higher than that in group M (P < 0.05).
[0176] The above results show that 6'-SL can effectively alleviate constipation by regulating the relative abundance of intestinal flora at the genus level in constipated mice. It is worth noting that high-dose 6'-SL intervention is more effective in regulating the relative abundance of Bacteroides, Akkermansia, and Alistipes.
[0177] (5) LEfSe species difference analysis of intestinal flora of mice in each group intervened by different doses of 6'-SL
[0178] Further LEfSe analysis was used to explore the key difference microorganisms of the intestinal flora of each group of mice. LDA linear discriminant analysis was used to analyze the size of the influence of the difference in species abundance on the difference between groups, and the LDA critical value was set to 3. As shown in Table 2, at the genus level: Figure 6
[0179] ① Lactobacillus and Streptococcus were significantly enriched in the K group;
[0180] ② [Ruminococcus], Allobaculum, Coprococcus, and Turicibacter were significantly enriched in the M group;
[0181] ③ Bacteroides, Anaerotruncus, and Corynebacterium were significantly enriched in the L6 group;
[0182] ④ Anaeroplasma and Anaerostipes were significantly enriched in the M6 group, and Akkermansia was significantly enriched in the H6 group.
[0183] Among them, Bacteroides, Anaerotruncus, Anaeroplasma, and Anaerostipes are producers of short-chain fatty acids (SCFAs), which can regulate energy homeostasis, sugar / lipid metabolism, inflammation, and even immunity to improve the health of the host. Akkermansia has an important role in the intestinal tract, especially in participating in the metabolism of the intestinal mucus layer and promoting the health of intestinal epithelial cells. This helps to maintain the integrity of the intestinal barrier and prevent the invasion of pathogenic bacteria. The results show that different doses of 6'-SL intervention can improve the symptoms of loperamide-induced constipation by increasing the relative abundance of some beneficial bacterial genera in the intestine.
[0184] 2.3 Short-chain fatty acids:
[0185] Short-chain fatty acids are short-chain fatty acid substances produced by intestinal flora fermentation of dietary fiber and other carbohydrates, mainly including acetic acid, propionic acid, butyric acid and valeric acid, etc. Short-chain fatty acids play an important role in maintaining the integrity of the intestinal barrier and the balance of the intestinal environment. Acetic acid is mainly involved in the metabolism of the brain, heart, kidney and muscle in the body; propionic acid can inhibit the synthesis of liver cholesterol and reduce the serum cholesterol level; butyric acid has the effects of protecting intestinal mucosa, anti-inflammation, enhancing gastrointestinal function, inhibiting tumor cell proliferation, inducing differentiation and apoptosis. In addition, the production of short-chain fatty acids can promote intestinal peristalsis, thereby relieving constipation.
[0186] The present application studies the influence of different doses of 6'-SL on the levels of short-chain fatty acids including acetic acid, propionic acid, butyric acid and valeric acid in the intestinal contents of constipated mice. The results are shown in Table 5. Compared with the normal mice of the blank K group, the acetic acid, propionic acid, butyric acid and valeric acid in the intestinal contents of the model M group mice intervened by loperamide were significantly reduced (P<0.05). Compared with the model M group mice, the contents of propionic acid and butyric acid in the intestinal contents of the mice intervened by high, medium and low doses of 6'-SL were significantly improved (P<0.05). The results show that 6'-SL has the effect of restoring the content of short-chain fatty acids in the intestines of constipated mice.
[0187] Table 5 Influence of nutrients on the content of short-chain fatty acids in the feces of mice
[0188]
[0189] Note: *P<0.05 compared with the blank control K group; # P<0.05 compared with the model M group.
Claims
1. Use of a human milk oligosaccharide for the preparation of a food product for improving constipation, characterized in that, the human milk oligosaccharide is 6'-sialyllactose; the constipation is functional constipation; the improvement of constipation comprises the following improvements: (a) increasing fecal water content; (b) improving intestinal peristalsis; (c) regulating SCF / C-kit signaling pathway; (d) increasing intestinal flora abundance and diversity; and (e) modulating gut microbiota structure, including reducing the ratio of Firmicutes ( Firmicutes ) and Bacteroidetes ( Bacteroidetes ). the regulation of SCF / C-kit signaling pathway comprises increasing transcription level of SCF and / or C-kit in colon tissue; The increasing gut microbiota abundance and diversity includes increasing the relative abundance of Lactobacillus (Lactobacillus spp.) Lactobacillus ), Bacteroides (Bacteroides spp.) Bacteroides ), Akkermansia (Akkermansia spp.) Akkermansia ), Parabacteroides (Parabacteroides spp.) Parabacterodes ), and Corynebacterium (Corynebacterium spp.) Corynebacterium ).
2. Use according to claim 1, characterized in that, the improvement of constipation further comprises the following improvement: restoring short-chain fatty acid content in the intestine.
3. Use according to claim 2, characterized in that, the restoration of short-chain fatty acid content in the intestine comprises increasing content of at least one of acetic acid, propionic acid, butyric acid and valeric acid.
4. Use of a human milk oligosaccharide for the preparation of a food product for improving the gut flora environment, characterized in that, the human milk oligosaccharide is 6'-sialyllactose; the intestinal flora environment is intestinal flora environment under functional constipation condition; the improvement of intestinal flora environment comprises increasing intestinal flora abundance and diversity, and regulating intestinal flora structure; The modulating the gut microbiota structure comprises reducing the ratio of Firmicutes ( Firmicutes ) and Bacteroidetes ( Bacteroidetes ). The increasing gut microbiota abundance and diversity includes increasing the relative abundance of Lactobacillus (Lactobacillus spp.) Lactobacillus ), Bacteroides (Bacteroides spp.) Bacteroides ), Akkermansia (Akkermansia spp.) Akkermansia ), Parabacteroides (Parabacteroides spp.) Parabacterodes ), and Corynebacterium (Corynebacterium spp.) Corynebacterium ).
5. Use according to claim 4, characterized in that, The increasing gut microbiota abundance and diversity includes increasing the relative abundance of Verrucomicrobia (phylum). Verrucomicrobia The increasing gut microbiota abundance and diversity includes increasing the relative abundance of Verrucomicrobia (phylum).
6. Use according to any one of claims 1 to 5, characterized in that, the food is an oral preparation; the oral preparation comprises at least one of tablet, pill, granule, powder, tea, capsule and oral liquid.
7. Use according to any one of claims 1 to 5, characterized in that, the food is candy, beverage, dairy product, baked food, special dietary food or dietary supplement.
8. Use according to any one of claims 1 to 5, characterized in that, in the food, the mass content of the human milk oligosaccharide is at least 0.05%.
Citation Information
Patent Citations
Nutritional composition containing 2FL and LNnT
CN107847509B
Breast milk oligosaccharide composition for improving intestinal flora abundance and fecal odor of infants and application thereof
CN110839702A
Breast milk oligosaccharide for regulating butyric acid and improving intestinal microenvironment health and application thereof
CN114568504A
Application of oligosaccharide in preparation of product for regulating intestinal flora
CN115836733A
Application of breast milk oligosaccharide to improvement of intestinal flora of mothers and infants
CN119138609A