Tyrosine sulfation modified high-activity recombinant hirudin, saccharomyces cerevisiae engineering bacteria and application
By introducing TPST1 and related enzyme systems into the Saccharomyces cerevisiae engineering bacteria, the efficient sulfation modification of the hirudin Tyr63 site was solved, and the problem of low activity of recombinant hirudin was achieved, low-cost, efficient large-scale production and excellent antioxidant effects were achieved, and its application in the fields of medicine and beauty and skin care was expanded.
Patent Information
- Application Number
- CN202510726597.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-03
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-06-03
AI Technical Summary
The existing recombinant hirudin expression system cannot achieve sulfation modification of tyrosine 63 site, resulting in its activity being only one-tenth of that of natural hirudin, and its natural hirudin production is low and its extraction cost is high, limiting its wide application in the fields of medicine and beauty and skin care.
By introducing tyrosine protein sulfonate transferase (TPST1) and related enzymes and transport systems (MET3, MET14, SLL) into Saccharomyces cerevisiae engineered bacteria, recombinant hirudin expressing tyrosine sulfation modification, improving its anticoagulant activity and antioxidant effect.
It significantly improves the activity of recombinant hirudin, achieves low-cost and efficient large-scale production, has excellent antioxidant effects, and is suitable for the pharmaceutical and cosmetic fields.
Smart Images

Figure CN120230658A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of genetic engineering and synthetic biology, and particularly relates to a highly active recombinant hirudin with tyrosine sulfation modification, a Saccharomyces cerevisiae engineering bacterium and applications thereof. Background Art
[0002] Hirudin is a natural active polypeptide isolated and purified from the salivary gland of leeches. It consists of 65 - 66 amino acid residues, has the characteristics of non-glycosylation and an acidic single-chain structure, and is the most effective natural thrombin inhibitor known. It is widely used in the clinical treatment of cardiovascular diseases.
[0003] The tyrosine (Tyr63) sulfation of hirudin is a key modification in its structure and function, which is catalyzed by tyrosine protein sulfotransferase (TPST). TPST transfers a sulfate group from 3'-phosphoadenosine-5'-phosphosulfate (PAPS) to the tyrosine residue at position 63. After Tyr63 sulfation, the specific binding of the C-terminal region of hirudin (including Tyr63) to the anion-binding exosite I of thrombin is significantly enhanced, increasing its ability to inhibit thrombin by 10 times. However, the low yield and high extraction cost of natural hirudin severely limit its application.
[0004] Currently, the Escherichia coli or yeast engineering bacterium expression system is the main expression system for the production of recombinant hirudin. Among them, Saccharomyces cerevisiae as a host system for expressing hirudin has multiple significant advantages: ① It has a clear genetic background and is easy to operate, suitable for efficient gene editing and hirudin expression; ② It has a natural secretion system, which can efficiently secrete hirudin into the culture medium, simplifying the downstream purification process; ③ It has the ability to form disulfide bonds, which can ensure the correct folding of the N-terminal functional domain of hirudin. In addition, Saccharomyces cerevisiae grows rapidly, has a low culture cost, and high safety (GRAS certification), is suitable for high-density fermentation and large-scale production, and is an environmentally friendly and highly resource-utilized expression system. These advantages make it an ideal choice for the efficient production of high-quality and highly active hirudin, providing important technical support for the medical and beauty skincare fields. However, as an expression host, Escherichia coli or Saccharomyces cerevisiae lacks the post-translational modification function mediated by TPST and cannot complete the Tyr63 sulfation modification, resulting in the pharmacological effect of the recombinant hirudin expressed by it being only one-tenth of that of natural hirudin. Therefore, developing an efficient expression system capable of achieving Tyr63 sulfation modification is of great significance for enhancing the activity of recombinant hirudin and promoting its wide application in the medical field.
[0005] In addition, as a natural antithrombin active substance, hirudin has been widely studied in the field of pharmacology and has shown remarkable effects especially in anticoagulation, antithrombosis, blood pressure reduction, blood lipid reduction, etc. However, its application research in the field of beauty and skin care is relatively less. Research shows that it has multiple effects such as antioxidant, anti-aging, whitening, anti-inflammatory, repair, improvement of microcirculation, oil control and pore shrinking, and it has high safety and no irritation. These characteristics make it a highly potential functional skin care ingredient and are expected to be widely used in high-end skin care products for anti-aging, whitening, repair, etc. With the in-depth research and the progress of production technology, the application prospect of hirudin in the cosmetics field will be broader. Summary of the Invention
[0006] In order to overcome the deficiencies and drawbacks of the prior art, the primary object of the present invention is to provide a Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification.
[0007] Another object of the present invention is to provide a method for constructing the above-mentioned Saccharomyces cerevisiae engineering bacterium.
[0008] Another object of the present invention is to provide a highly active recombinant hirudin with tyrosine sulfation modification.
[0009] The fourth object of the present invention is to provide a preparation method for the above-mentioned highly active recombinant hirudin with tyrosine sulfation modification.
[0010] The fifth object of the present invention is to provide the application of the above-mentioned Saccharomyces cerevisiae engineering bacterium or highly active recombinant hirudin with tyrosine sulfation modification.
[0011] The object of the present invention is achieved by the following technical solutions:
[0012] A Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification is obtained by the following method:
[0013] Using Saccharomyces cerevisiae as the starting strain, integrating the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element and TPST1 gene expression element into the chromosome of Saccharomyces cerevisiae to obtain a Saccharomyces cerevisiae engineering bacterium introducing a tyrosine sulfation modification system; then transferring a recombinant plasmid containing a recombinant hirudin gene expression element into the Saccharomyces cerevisiae engineering bacterium introducing a tyrosine sulfation modification system to obtain a Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification;
[0014] The Saccharomyces cerevisiae strain is preferably CEN.PK2-1D.
[0015] The recombinant hirudin gene expression element comprises rHirudin gene, promoter TEF1p and terminator ADH1t, wherein the rHirudin gene is composed of AGA2 secretory peptide nucleic acid sequence, His tag nucleic acid sequence, enterokinase cleavage nucleic acid sequence and truncated Hirudin gene sequence connected in sequence, and the nucleotide sequence of the rHirudin gene is shown in SEQ ID No: 1.
[0016] The recombinant plasmid containing the recombinant hirudin gene expression element is obtained by inserting the recombinant hirudin gene expression element into the free plasmid pRS416.
[0017] The MET3Δ gene expression element includes a MET3 gene functional region coding sequence (amino acid sequence of positions 1-393 of MET3) derived from Saccharomyces cerevisiae and its promoter and terminator (MET3p and MET3t). The nucleotide sequence of the gene expression element is shown in SEQ ID No: 2.
[0018] The MET14 gene expression element includes a MET14 gene coding sequence derived from Saccharomyces cerevisiae and its promoter and terminator (MET14p and MET14t). The nucleotide sequence of the gene expression element is shown in SEQ ID No:3.
[0019] The SLL gene expression element includes the SLL gene coding sequence, the Saccharomyces cerevisiae promoter TDH3p and the terminator CYC1t. The nucleotide sequence of the SLL gene coding sequence is shown in SEQ ID No:4.
[0020] The TPST1 gene expression element includes the coding sequence of the TPST1 gene, the saccharomyces cerevisiae promoter PGK1p and the terminator PDC1t.
[0021] The TPST1 gene is hTPST1 (derived from humans) gene, bTPST1 (derived from cattle) gene or eTPST1 (derived from nematodes) gene. The coding sequences of the hTPST1 gene and the bTPST1 gene are shown in SEQ ID No: 5 or 6.
[0022] The eTPST1 gene is a wild-type eTPST1 gene or a mutant eTPST1 gene; the coding sequence of the wild-type eTPST1 gene is shown in SEQ ID No: 7; the mutant eTPST1 gene is eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H ;eTPST1Q113R 、eTPST1 Q113K 、eTPST1 Q113H The corresponding mutation sites are 337 - 339 bp, and the corresponding mutated nucleotide sequences are AGA, AAA, and CAT respectively; eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H The corresponding mutation sites are 601 - 603 bp, and the corresponding mutated nucleotide sequences are AGA, AAA, and CAT respectively.
[0023] The nucleotide sequence of the promoter TDH3p is shown as positions 9954286 to 9955085 of the NCBI database sequence accession number CP029160.1; the nucleotide sequence of the promoter PGK1p is shown as positions 124102 to 124853 of the NCBI database sequence accession number CP135951.1; the nucleotide sequence of the promoter TEF1p is shown as positions 707052 to 707481 of the NCBI database sequence accession number CP029160.1. The nucleotide sequence of the terminator CYC1t is shown as positions 1301 to 1607 of the NCBI database sequence accession number KC879308.1; the nucleotide sequence of the terminator PDC1t is shown as positions 3660519 to 3660915 of the NCBI database sequence accession number CP029160.1; the nucleotide sequence of the terminator ADH1t is shown as positions 4671969 to 4672126 of the NCBI database sequence accession number CP029160.1.
[0024] The method for constructing the Saccharomyces cerevisiae engineering bacteria expressing highly active recombinant hirudin with tyrosine sulfation modification comprises the following steps:
[0025] Ⅰ. Using Saccharomyces cerevisiae CEN.PK2 - 1D as the starting strain, inserting the MET3Δ gene expression element and the MET14 gene expression element into the yeast chromosome through homologous recombination to obtain the engineering strain ZR - 01;
[0026] Ⅱ. Using the engineering strain ZR - 01 obtained in step Ⅰ as the object, inserting the SLL gene expression element through gene editing to obtain the engineering strain ZR - 02;
[0027] Ⅲ. Using the engineered strain ZR-02 obtained in step II as the object, the TPST1 gene expression element is inserted through gene editing to obtain engineered strains (ZR-03, ZR-04, ZR-05, ZR-05 / 01-ZR-05 / 06) containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element and TPST1 gene expression element; among them, the hTPST1 gene expression element is inserted into the corresponding engineered strain ZR-03, the bTPST1 gene expression element is inserted into the corresponding engineered strain ZR-04, the wild-type eTPST1 gene expression element is inserted into the corresponding engineered strain ZR-05, and the mutant eTPST1 gene expression element is inserted into the corresponding engineered strains ZR-05 / 01-ZR-05 / 06;
[0028] Ⅳ. Using the engineered strains obtained in step III as the object, recombinant plasmids containing the recombinant hirudin gene expression element are respectively transferred into them by the lithium acetate method to obtain strains ZR-07~09, ZR-10~15, which are the Saccharomyces cerevisiae engineered bacteria expressing highly active recombinant hirudin with tyrosine sulfation modification.
[0029] The engineered strain ZR-01 described in step I is preferably prepared by the following method:
[0030] Design and synthesize a nucleic acid sequence, which includes: GAL7 UP、 MET3Δ gene expression element (MET3p-MET3Δ-MET3t), MET14 gene expression element (MET14p-MET14-MET14t), LEU2p-LEU2 and GAL7 DOWN fragment, and at the same time transform the above fragment into Saccharomyces cerevisiae by the lithium acetate method, and screen positive clones with LEU auxotrophic medium to obtain strain ZR-01.
[0031] The GAL7 UP and GAL7 DOWN are fragments located at the Gal7 locus of the Saccharomyces cerevisiae genome, and their nucleotide sequences are as shown in SEQ ID No: 8-9.
[0032] The engineered strain ZR-02 described in step II is preferably prepared by the following method:
[0033] (1) Design and synthesize a nucleic acid sequence, which includes: GAL1 UP , SLL gene expression element and GAL1 DOWN , and set restriction enzyme sites at the upstream and downstream respectively;
[0034] (2) Insert the sequence synthesized in step (1) into the pUC57 plasmid by restriction enzyme digestion and ligation to construct the recombinant plasmid pUC57-GAL1UP -TDH3p-SLL-CYC1t-GAL1 DOWN ;
[0035] (3)Amplify the recombinant plasmid pUC57-GAL1 in Escherichia coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN , and obtain GAL1 by double digestion UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment;
[0036] (4)Transform the gene editing plasmid and the GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment into the strain ZR-01 by the lithium acetate method, screen for positive transformants, and obtain the engineered strain ZR-02.
[0037] The GAL1 UP and GAL1 DOWN are fragments located at the Gal1 locus of the Saccharomyces cerevisiae genome, and their nucleotide sequences are as shown in SEQ ID No: 10-11.
[0038] The engineered strain containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element described in step III is preferably prepared by the following method:
[0039] (1)Design and synthesize a nucleic acid sequence, which includes: HO UP sequence, TPST1 gene expression element, and HO DOWN sequence, and set restriction enzyme sites at the upstream and downstream respectively;
[0040] (2)Insert the sequence synthesized in step (1) into the pUC57 plasmid by restriction enzyme digestion and ligation to construct the recombinant plasmid pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN ;
[0041] (3)Amplify the recombinant plasmid pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN , and obtain HO by double digestion UP -PGK1p-TPST1-PDC1t-HO DOWN fragment;
[0042] (4)Transform the gene editing plasmid and the HO UP -PGK1p-TPST1-PDC1t-HODOWN The fragment was transformed into strain ZR-02 by the lithium acetate method, and positive transformants were screened to obtain the target engineering strain.
[0043] The said HO UP and HO DOWN are homologous arm fragments located at the HO gene of Saccharomyces cerevisiae, and their nucleotide sequences are shown in SEQ ID No: 12-13.
[0044] The starting plasmid of the said gene editing plasmid is pRS416; the said gene editing plasmid is based on the plasmid pRS416 and inserts the following components: a Cas9 expression element and a gRNA expression element, wherein the Cas9 expression element encodes a Cas9 nuclease for targeting and cleaving a target DNA sequence, as well as a promoter and a terminator; the gRNA expression element includes a guide RNA sequence targeting a target Saccharomyces cerevisiae genomic locus, a gRNA scaffold sequence, a promoter and a terminator; the said gRNA expression element is preferably a GAL1 sgRNA expression element or HO sgRNA expression element.
[0045] The recombinant plasmid containing the recombinant hirudin gene expression element in step IV is preferably prepared by the following method:
[0046] (1) Artificially synthesize the recombinant hirudin gene expression element (TEF1p-rHirudin-ADH1t) and set restriction enzyme sites at the upstream and downstream respectively;
[0047] (2) Insert the sequence synthesized in step (1) into the pUC57 plasmid by restriction enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t;
[0048] (3) Amplify the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t in Escherichia coli, and obtain the TEF1p-rHirudin-ADH1t fragment by double enzyme digestion;
[0049] (4) Connect the TEF1p-rHirudin-ADH1t fragment to the pRS416 vector through the restriction enzyme site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.
[0050] The construction method of the Saccharomyces cerevisiae engineering bacteria expressing tyrosine-sulfated modified recombinant hirudin preferably further includes the following steps:
[0051] Design and synthesize a fusion gene expression element including an rDNA homologous arm fragment (rDNA UP -PGK1p-KanMX4-P2A-eTPST1 T201K-PDC1t-rDNA DOWN ), and the nucleic acid sequence of the expression element includes: rDNA UP、 PGK1p, KanMX4, P2A, TPST1, PDC1t, rDNA DOWN ; This element was transformed into the engineering strain ZR-02 by the lithium acetate method, and strains containing the high-copy TPST1 gene were screened with G418; A recombinant plasmid (pRS416-pTEF-rHirudin-ADH1t) containing the recombinant hirudin gene expression element was transferred into the strains containing the high-copy TPST1 gene to obtain a Saccharomyces cerevisiae engineering bacterium expressing tyrosine-sulfated modified recombinant hirudin.
[0052] The TPST1 gene is preferably eTPST1 T201R .
[0053] The rDNA UP and rDNA DOWN are fragments located in the rDNA of Saccharomyces cerevisiae, where the nucleotide sequences of rDNA UP and rDNA DOWN are shown in SEQ ID No: 14-15. The nucleotide sequence of the KanMX4 resistance gene is shown in SEQ ID No: 16, and the nucleotide sequence of the P2A self-cleaving peptide is shown in SEQ ID No: 17.
[0054] A highly active recombinant hirudin with tyrosine sulfation modification is obtained by expressing the Saccharomyces cerevisiae engineering bacterium expressing the highly active recombinant hirudin with tyrosine sulfation modification.
[0055] The preparation method of the highly active recombinant hirudin with tyrosine sulfation modification includes the following steps:
[0056] Ferment the Saccharomyces cerevisiae engineering bacterium expressing the highly active recombinant hirudin with tyrosine sulfation modification, collect the supernatant of the fermentation broth, and purify it to obtain the highly active recombinant hirudin with tyrosine sulfation modification.
[0057] The application of the highly active recombinant hirudin with tyrosine sulfation modification or the Saccharomyces cerevisiae engineering bacterium in the preparation of antithrombin products.
[0058] The application of the highly active recombinant hirudin with tyrosine sulfation modification or the Saccharomyces cerevisiae engineering bacterium in the preparation of anticoagulant, antithrombotic, antihypertensive or hypolipidemic drugs.
[0059] The application of the highly active recombinant hirudin with tyrosine sulfation modification or the Saccharomyces cerevisiae engineering bacterium in the field of beauty and skin care, and the application includes but is not limited to antioxidant.
[0060] The technical principle of the present invention:
[0061] Sulfate adenylyltransferase (MET3) and adenosine-5'-phosphosulfate kinase (MET14) are related synthases for the donor 3'-phosphoadenosine-5'-phosphosulfate (PAPS) of tyrosine sulfation modification. PAPS is transported to the Golgi apparatus by the 3'-phosphoadenosine 5'-phosphosulfate transporter (SLL). Under the catalysis of tyrosylprotein sulfotransferase (TPST1), the sulfate group of PAPS is transferred to the tyrosine residue at position 63 of hirudin, thus completing tyrosine sulfation. Based on the above mechanism, in order to introduce a protein tyrosine sulfation modification system into the Saccharomyces cerevisiae expression system, the present invention selects Saccharomyces cerevisiae as the starting strain and integrates the MET3Δ (MET3 functional region) gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element into the yeast chromosome to obtain an engineered bacterium with an introduced tyrosine sulfation modification system. Among them:
[0062] The proteins expressed by the MET3Δ gene expression element and the MET14 gene expression element are sulfate adenylyltransferase and adenosine 5'-phosphosulfate anhydride kinase respectively, both of which are derived from Saccharomyces cerevisiae. The introduction of the two can increase the level of the sulfation modification donor 3'-phosphoadenosine-5'-phosphosulfate (PAPS) in the expression strain; the protein expressed by the SLL gene expression element is the 3'-phosphoadenosine 5'-phosphosulfate transporter, which is derived from Drosophila. It is reported that the introduction of it can increase the PAPS level in the Golgi apparatus of Saccharomyces cerevisiae by 5.6 times (Shin Kamiyama et al. J Biol Chem 2003 Jul 11); the protein expressed by the TPST1 gene expression element is tyrosylprotein sulfotransferase 1, and the introduction of it can directly catalyze the sulfation of recombinant hirudin at Tyr63. In summary, the present invention finally realizes the sulfation modification of hirudin Tyr63 by increasing the levels of the PAPS-related synthases MET3 and MET14 and introducing SLL and TPST1, thereby significantly enhancing the anticoagulant activity of hirudin.
[0063] In the process of constructing a Saccharomyces cerevisiae engineered bacterium expressing recombinant hirudin with tyrosine sulfation modification, the present invention first studied the effects of TPST1 genes from different sources on the expression level of recombinant hirudin and the level of tyrosine sulfation modification of recombinant hirudin at Tyr63. After fermentation screening and comparison of the engineered strains ZR-06~09, the expression levels of recombinant hirudin in the strains ZR-06~09 were not much different ( Figure 1 ), the level of tyrosine sulfation modification of recombinant hirudin expressed by ZR-09 was higher ( Figure 1 ), and the activity of recombinant hirudin expressed by the strain ZR-09 measured by thrombin titration was also higher ( Figure 2). On this basis, the present invention selects to further mutate and optimize the activity of eTPST1. Through αfold3 simulated docking, the Q113 and T201 of eTPST1 are less than 3.5 Å from the hirudin binding region ( Figure 3 ), and the hirudin binding region is rich in negatively charged E, so the two amino acids are mutated to be positively charged. The eTPST1 mutants include eTPST1 Q113R , eTPST1 Q113K , eTPST1 Q113H , eTPST1 T201R , eTPST1 T201K and eTPST1 T201H . The corresponding engineered bacteria are numbered ZR-10 to 15. The construction method of strains ZR-10 to 15 is the same as that of ZR-09, that is, the mutant recombinant plasmid with the homologous arm mutant TPST1 gene expression element fragment (the mutant recombinant plasmid is obtained by site-directed mutagenesis PCR) and the recombinant hirudin expression plasmid gene are edited into strain ZR-02. After fermentation screening and comparison of strains ZR-10 to 15, on the basis of the same expression level ( Figure 3 ), the recombinant hirudin expressed by strain ZR-13 has higher activity ( Figure 4 ). The present invention further optimizes the copy number of eTPST1 T201R and further constructs the engineered strain ZR-16.
[0064] The present invention has the following advantages and effects compared with the prior art:
[0065] (1) The present invention uses Saccharomyces cerevisiae as the chassis cell. Through genetic engineering transformation, tyrosine protein sulfotransferase (TPST1) and related enzymes and transport systems (MET3, MET14, SLL) are introduced to achieve efficient sulfation modification of the Tyr63 site of hirudin, significantly enhancing its anticoagulant activity.
[0066] (2) The present invention significantly improves the activity of recombinant hirudin through the selection of TPST1 genes from different sources, the directed mutation of the eTPST1 gene, and the integration of high-copy eTPST1 T201R through rDNA.
[0067] (3) The present invention overcomes the limitations of the high extraction cost of natural hirudin and the lack of modification function in existing recombinant technologies. In addition, sulfated hirudin exhibits excellent antioxidant effects in the field of beauty and skin care. Experiments prove that its antioxidant activity is equivalent to that of natural hirudin, and it has the potential for both medical and cosmetic applications.
[0068] (4)The recombinant hirudin expression system provided by the present invention exhibits significant advantages in terms of production cost, biological safety, production efficiency, convenience of genetic manipulation, product activity, etc., providing an innovative solution for the low-cost and large-scale production of highly active hirudin and opening up a new way for the research and development and production of recombinantly modified highly active polypeptides. Description of the Drawings
[0069] Figure 1 It is a Western blot result diagram of the expression of recombinant hirudin and Tyr63 sulfation modification in strains ZR-06~09.
[0070] Figure 2 It is an analysis diagram of the activity comparison results of recombinant hirudin expressed by strains ZR-06~09.
[0071] Figure 3 It is a display diagram of the αfold3 simulated docking of eTPST1 and hirudin binding.
[0072] Figure 4 It is an analysis diagram of the Western blot results of recombinant hirudin expressed by strains ZR-10~15.
[0073] Figure 5 It is an analysis diagram of the activity comparison results of recombinant hirudin expressed by strains ZR-10~15.
[0074] Figure 6 It is an analysis diagram of the results of the expression situation (A) and activity comparison (B) of recombinant hirudin in strains ZR-13 and ZR-16.
[0075] Figure 7 It is an analysis diagram of the results of the antioxidant efficacy evaluation of recombinant hirudin expressed by strain ZR-16. Detailed Embodiments
[0076] The present invention will be further described in detail below in conjunction with the embodiments and the drawings, but the embodiments of the present invention are not limited thereto.
[0077] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art unless otherwise specified. In the embodiments, the processes and methods not described in detail are conventional methods well known in the art. The reagents used in the embodiments are purchased through ordinary commercial channels, and the experimental operations and experimental conditions not specified refer to the conventional operations and conventional conditions in the art.
[0078] The YPD medium was prepared in the following order: 10 g of yeast extract, 20 g of peptone, 20 g of glucose, 20 g of agar (added for solid medium), and supplemented with ddH2O to 1 L. The SC-Ura medium was prepared in the following order: 6.7 g of yeast nitrogen base (YNB), 0.77 g of amino acid mixture (without uracil), 20 g of glucose, 20 g of agar (added for solid medium), and supplemented with ddH2O to 1 L. The SC-Leu medium was prepared in the following order: 6.7 g of yeast nitrogen base (YNB), 0.77 g of amino acid mixture (without leucine), 20 g of glucose, 20 g of agar (added for solid medium), and supplemented with ddH2O to 1 L. The Tris-HCl buffer was prepared in the following order: 121.14 g of Tris, supplemented with ddH2O to 1 L, and the pH was adjusted to 7.4 with HCl. The 500 mM imidazole elution buffer was prepared in the following order: 68.08 g of imidazole, 2.42 g of Tris, 29.22 g of NaCl, supplemented with ddH2O to 1 L, and the pH was adjusted to 8.0 with HCl.
[0079] The yeast genomic DNA extraction kit (product number: DP307) and plasmid mini-prep kit (product number: DP105) in the examples were purchased from Tiangen Biochemical Technology Co., Ltd.; restriction endonucleases such as Kpn I (product number: R3142V), Hind III (product number: R0104V), EcoRI (product number: R0101S), Bam H I (product number: R3136S), and T4 ligase (product number: M0202) were purchased from NEB; the gel extraction kit (product number: B518131-0100) was purchased from Sangon Biotech (Shanghai) Co., Ltd. The pRS416 free plasmid in the examples was purchased from Biofeng.
[0080] Example 1 Construction of Engineering Strains ZR-01 to 02
[0081] I. Construction of Engineering Strain ZR-01
[0082] 1. Artificially synthesize the sequence of the MET3Δ gene expression element + MET14 gene expression element + LEU2p-LEU2 element with homologous arms (GAL7 UP -MET3p-MET3Δ-MET3t-MET14p-MET14-MET14t-LEU2p-LEU2-GAL7 DOWNFragment), the synthetic fragment was transferred into strain CEN.PK2-1D by the lithium acetate method. The addition order and volume of the system were as follows: 240 μL of 50% PEG 3350, 36 μL of 1 M LiAc, 10 μL of ssDNA, 1 μg of DNA fragment, and 50 μL of CEN.PK2-1D competent cells. The cells were cultured in SC-Leu medium for 2-3 days, positive clones were screened, and the insertion of the expression element was verified by PCR to obtain the engineered strain ZR-01 containing the MET3Δ gene expression element and the MET14 gene expression element. Among them, LEU2p-LEU2 is the " Addgene: pESC-LEU (V5 and HA) Sequences " of "LEU2", with a total of 1095 bp, https: / / www.addgene.org / 222486 / sequences / .
[0083] MET3p-MET3Δ-MET3t sequence:
[0084]
[0085] MET14p-MET14-MET14t sequence:
[0086]
[0087] GAL7 UP The nucleotide sequence of GAL7 is as follows:
[0088] TTGACGCTTATTGTCAAGGCTTTTCATCCCGATTCCAATATTACATTAGAAGTTTTAAGTACAGAGCCAACTTATCAATTTTATACCGGTGATTTCTTGTCTGCTGGTTACGAAGCAAGACAAGGTTTTGCAATTGAGCCTGGTAGATACATTGATGCTATCAATCAAGAGAACTGGAAAGATTGTGTAACCT
[0089] GAL7 DOWN The nucleotide sequence of GAL7 is as follows:
[0090] GGGTCCAAGATTGTCTACAGATTTTCCTGATTTGCCAGCTTACTATCCTTCTTGAAAATATGCACTCTATATCTTTTAGTTCTTAATTGCAACACATAGATTTGCTGTATAACGAATTTTATGCTATTTTTTAAATTTGGAGTTCAGTGATAAAAGTGTCACAGCGAATTTCCTCACATGTAGGGACCGAATTG
[0091] II. Construction of Engineering Strain ZR-02
[0092] 1. Construction of GAL1 Gene Editing Vector, the steps are as follows:
[0093] (1) Artificially synthesize the sequences of the Cas9 expression element and the GAL1 sgRNA expression element and insert them into the pUC57 plasmid. Transfer the recombinant plasmid into Escherichia coli DH5α for amplification, and extract the plasmid using a plasmid mini-prep kit; then perform double digestion with Kpn I and Hind III. The addition order and volume of the digestion system are as follows: 1.5 μL of Kpn I, 1.5 μL of Hind III, 5 μL of 10× cutsmart buffer, and 32 μL of the pUC57-TEF1p-Cas9-CYCt-SNR52p-GAL1 sgRNA -SUP4t plasmid. Among them, the Cas9 expression element and GAL1 sgRNAThe sequence of the expression element is 3617 - 8836 bp in Addgene: pYZ463 Sequences (https: / / www.addgene.org / browse / sequence / 403781 / ), and the targeting sequence TGAGTTCAATTCTAGCGCAA is inserted after 8737 bp.
[0094] (2)After the digestion system is subjected to 2% agarose gel electrophoresis, the gel block with a target size of approximately 5200 bp is cut out and recovered using a gel recovery kit to obtain the TEF1p-Cas9-CYCt-SNR52p-GAL1 sgRNA -SUP4t fragment.
[0095] (3)The pRS416 free plasmid is transferred into Escherichia coli DH5α for amplification, and the plasmid is extracted using a plasmid mini-prep kit; then it is double-digested with Kpn I and Hind III. The addition order and volume of the digestion system are as follows: Kpn I 1.5 μL, HindIII 1.5 μL, 10×cutsmart buffer 5 μL, pRS416 free plasmid 32 μL.
[0096] (4)After the digestion system is subjected to 2% agarose gel electrophoresis, the gel block with a target size of approximately 4800 bp is cut out and recovered using a gel recovery kit to obtain the digested pRS416 fragment.
[0097] (5)The TEF1p-Cas9-CYCt-SNR52p-GAL1 sgRNA -SUP4t fragment and the digested pRS416 fragment are ligated with T4 ligase to obtain the recombinant plasmid pRS416-TEF1p-Cas9-CYCt-SNR52p-GAL1 sgRNA -SUP4t, which is the GAL1 gene editing plasmid. The addition order and volume of the ligation system are as follows: T4 DNA Ligase Buffer (10×) 2 μL, TEF1p-Cas9-CYCt-SNR52p-GAL1 sgRNA -SUP4t fragment 2 μL, digested pRS416 fragment 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.
[0098] (6)The GAL1 gene editing plasmid is transferred into Escherichia coli DH5α for amplification, and the plasmid is extracted using a plasmid mini-prep kit for standby.
[0099] 2. Obtaining the SLL gene expression element fragment with homologous arms, the steps are as follows:
[0100] (1) Entrusted Suzhou Hongxun Biotechnology Co., Ltd. to artificially synthesize the SLL gene expression element (GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment) and set restriction enzyme sites (EcoR I and Bam HI) at the upstream and downstream respectively. After double digestion with EcoR I and Bam H I, it was inserted into the pUC57 plasmid; the recombinant plasmid was transferred into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid miniprep kit; then double digestion was performed with EcoR I and Bam H I, and the addition order and volume of the digestion system were as follows: EcoR I 1.5 μL, BamH I 1.5 μL, 10×cutsmart buffer 5 μL, pUC57-GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN plasmid 32 μL.
[0101] (2) After the digested system was subjected to 2% agarose gel electrophoresis, the gel block with a target size of approximately 2900 bp was cut off and recovered using a gel recovery kit to obtain the GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN DNA fragment.
[0102] 3. Construction of engineering strain ZR-02, the steps are as follows:
[0103] (1) The GAL1 gene editing plasmid and GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN DNA fragment were introduced into strain ZR-01 by the lithium acetate method. The addition order and volume of the required addition system were as follows: 50% PEG 3350 240 μL, 1M LiAc 36 μL; ssDNA 10 μL, GAL1 gene editing plasmid 500 ng, GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment 1 μg, competent cells 50 μL.
[0104] (2) After the system was mixed, it was incubated at 30 °C for 30 min, incubated at 42 °C for 20 min, treated with 5 mM CaCl2 for 8 min, spread on an SC-Ura plate and cultured at 30 °C to screen for positive colonies. After the positive colonies were cultured for 2-3 generations, a point-to-point streak was performed on the SC-Ura plate and the YPD plate to screen out the positive colonies that had lost the gene editing plasmid, and then PCR was performed to verify the insertion of the SLL gene element, thus obtaining the engineering strain ZR-02 containing the MET3Δ gene expression element, MET14 gene expression element and SLL gene expression element.
[0105] The nucleotide sequence of TDH3p-SLL-CYC1t is shown below:
[0106]
[0107] GAL1 UP The nucleotide sequence of GAL1 is as follows:
[0108] TATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACC
[0109] GAL1 DOWN The nucleotide sequence of GAL1 is as follows:
[0110] AGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGGATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGATTTTGATATGCTTTGCGCCGTCAAAG
[0111] Example 2 Construction of Engineered Bacteria ZR-03 to 05
[0112] 1. Construction of HO gene editing vector, the steps are as follows:
[0113] (1) Artificially synthesize the sequences of Cas9 expression element and HO sgRNA expression element and insert them into the pUC57 plasmid. Transfer the recombinant plasmid into Escherichia coli DH5α for amplification, and extract the plasmid using a plasmid mini-prep kit; then perform double digestion with Kpn I and Hind III. The addition order and volume of the digestion system are as follows: 1.5 μL of Kpn I, 1.5 μL of Hind III, 5 μL of 10× cutsmart buffer, 32 μL of pUC57-TEF1p-Cas9-CYCt-SNR52p-HO sgRNA -SUP4t plasmid. Among them, the sequences of Cas9 expression element and HO sgRNA expression element are 3617 - 8836 bp in Addgene: pYZ463 Sequences, and the targeting sequence TCACCCACTAGTACTACCAT is inserted after 8737 bp.
[0114] (2) After the digested system was subjected to 2% agarose gel electrophoresis, the gel block with a target size of approximately 5200 bp was cut out and recovered using a gel extraction kit to obtain the TEF1p-Cas9-CYCt-SNR52p-HO sgRNA -SUP4t fragment.
[0115] (3) The pRS416 free plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid mini-prep kit; then, double digestion was performed with Kpn I and Hind III. The addition order and volume of the system were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10× cutsmart buffer 5 μL, pRS416 free plasmid 32 μL.
[0116] (4) After the digested system was subjected to 2% agarose gel electrophoresis, the gel blocks with a target size of approximately 4800 bp were cut out respectively and recovered using a gel extraction kit to obtain the pRS416 digested fragment.
[0117] (5) The TEF1p-Cas9-CYCt-SNR52p-HO sgRNA -SUP4t fragment and the pRS416 digested fragment were ligated with T4 ligase to obtain the recombinant plasmid pRS416-TEF1p-Cas9-CYCt-SNR52p-HO sgRNA -SUP4t, which is the HO gene editing plasmid. The addition order and volume of the required ligation system were as follows: T4 DNA Ligase Buffer (10×) 2 μL, TEF1p-Cas9-CYCt-SNR52p-HO sgRNA -SUP4t fragment 2 μL, pRS416 digested fragment 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.
[0118] (6) The HO gene editing plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid mini-prep kit for standby.
[0119] 2. Obtaining the TPST1 gene expression element fragment with homologous arms, the steps are as follows:
[0120] (1) Synthesize the TPST1 gene element (hTPST1, bTPST1 or eTPST1) fragment with homologous arms artificially and set restriction enzyme sites (EcoR I and BamH I) at the upstream and downstream respectively. After double digestion with EcoR I and BamH I, it is ligated and inserted into the pUC57 plasmid. The recombinant plasmid is transferred into Escherichia coli DH5α for amplification, and the plasmid is extracted using a plasmid miniprep kit; then double digestion is carried out with EcoR I and BamH I, and the addition order and volume of the digestion system are as follows: EcoR I 1.5 μL, BamH I 1.5 μL, 10× cutsmart buffer 5 μL, pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN Plasmid 32 μL.
[0121] (2) After the digested system is subjected to 2% agarose gel electrophoresis, cut out the gel blocks with the target sizes of approximately 2600 bp (hTPST1), 2600 bp (bTPST1), and 2700 bp (eTPST1), and recover them using a gel recovery kit to obtain the HO UP -PGK1p-TPST1-PDC1t-HO DOWN DNA fragment.
[0122] 3. Construction of engineering bacteria ZR-03~05, the steps are as follows:
[0123] (1) Use the lithium acetate method to introduce the HO gene editing plasmid and the HO UP -PGK1p-TPST1-PDC1t-HO DOWN DNA fragment into the strain ZR-02. The addition order and volume of the required addition system are as follows: 50% PEG 3350 240 μL, 1M LiAc 36 μL; ssDNA 10 μL, HO gene editing plasmid 500 ng, HO UP -PGK1p-TPST1-PDC1t-HO DOWN fragment 1 μg, competent cells 50 μL.
[0124] (2) After the system is mixed evenly, incubate at 30 °C for 30 min, incubate at 42 °C for 20 min, treat with 5 mM CaCl2 for 8 min, spread on the SC-Ura plate and culture at 30 °C to screen for positive colonies. After the positive colonies are cultured for 2-3 generations, perform point-to-point streaking on the SC-Ura plate and the YPD plate to screen out the positive colonies that have lost the gene editing plasmid, and then perform PCR verification for the insertion of the TPST1 gene expression element to obtain the engineering strains ZR-03 (hTPST1), ZR-04 (bTPST1) and ZR-05 (eTPST1).
[0125] Taking the hTPST1 gene element as an example, its nucleotide sequence is as follows (the underlined part is HO UP and HO DOWN ):
[0126] TTACAGAAAGGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACGAAATAAACCTATGG TTTACGAAATGATCCACGAAAATCATGTTATTATTTACATCAACATATCGCGAAAATTCATGTCATGTCCACATTA ACATCATTGCAGAGCAACAATTCATTTTCATAGAGAAATTTGCTACTATGGTACCTACTACTTTGAATTGTACTACCGCTGGGCGTTAT TAGGTGTGAAACCACGAAAAGTTCACCATAACTTCGAATAAAGTCGCGGAAAAAAGTAAACAGCTATTGCTACTCAA ATGAGGTTTGCAGAAGCTTGTTGAAGCATGATGAAGCGTTCTAAACGCACTATTCATCATTAAATATTTAAAGCTCA TAA
[0127] The coding sequence of the bTPST1 gene is shown below:
[0128]
[0129] The coding sequence of the eTPST1 gene is shown as follows:
[0130]
[0131] Example 3 Construction of Recombinant Hirudin-Expressing Engineering Bacteria ZR-06~09
[0132] 1. Construction of the recombinant hirudin expression vector pRS416-TEF1p-rHirudin-ADH1t, the required steps are as follows:
[0133] (1) Obtaining the TEF1p-rHirudin-ADH1t gene expression element: Manually synthesize the TEF1p-rHirudin-ADH1t DNA fragment and set restriction enzyme sites (EcoR I and BamH I) at the upstream and downstream respectively. After double digestion with EcoR I and BamH I, it is ligated and inserted into the pUC57 plasmid. The recombinant plasmid is transferred into Escherichia coli DH5α for amplification, and the plasmid is extracted using a plasmid mini-prep kit; then double digestion is performed with EcoR I and BamH I. The addition order and volume of the digestion system are as follows: EcoR I 1.5 μL, BamH I 1.5 μL, 10× cutsmart buffer 5 μL, pUC57-TEF1p-rHirudin-ADH1t plasmid 32 μL.
[0134] TEF1p-rHirudin-ADH1t DNA fragment:
[0135] TEF1p- ATGCAGTTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTAGCA CATCACCAT GACGACGACGACAAGGTTGTTTACACTGATTGTACCGAAAGTGGCCAAAATTTATGCTTATGCGAAGGTAGCAAC GTCTGTGGTCAAGGAAACAAATGCATATTAGGTAGCGACGGTGAGAAAAATCAGTGCGTTACTGGAGAAGGAACAC CAAAACCTCAATCACATAACGATGGTGACTTTGAAGAGATCCCAGAAGAATATCTGCAATAA ADH1t
[0136] Note: The underlined part is the nucleic acid sequence of the AGA2 secretion peptide, the non-underlined part is the nucleic acid sequence of the His tag, the dotted underlined part is the nucleic acid sequence of enterokinase cleavage, and the thick line part is the Hirudin gene sequence.
[0137] (2) After 1% agarose gel electrophoresis, cut out the gel block with a target size of about 900 bp and recover it using a gel extraction kit to obtain the TEF1p-rHirudin-ADH1t DNA fragment.
[0138] 2. Obtaining the digested fragment of the pRS416 vector, the steps are as follows:
[0139] (1) Transfer the pRS416 free plasmid into Escherichia coli DH5α for amplification, extract the plasmid using a plasmid mini-prep kit, and perform double digestion with EcoR I and BamH I. The addition order and volume are as follows: EcoR I endonuclease 1.5 μL, BamH I endonuclease 1.5 μL, 10× cutsmart buffer 5 μL, pRS416 plasmid 32 μL.
[0140] (2) After the digested system was subjected to 2% agarose gel electrophoresis, the gel block with a target size of approximately 4,800 bp was cut out and recovered using a gel recovery kit to obtain the digested fragment of the pRS416 vector.
[0141] (3) The TEF1p-rHirudin-ADH1t DNA fragment and the digested fragment of the pRS416 vector were ligated by T4 to obtain a ligation mixture. The addition order and volume of the required ligation system were as follows: T4 DNA Ligase Buffer (10×) 2 μL, TEF1p-rHirudin-ADH1t DNA fragment 2 μL, digested fragment of pRS416 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.
[0142] 3. Screening for positive strains of the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t, the steps are as follows:
[0143] The above ligation mixture was transformed into DH5α, spread on an ampicillin-resistant LB plate, and cultured overnight at 37°C. Strains were picked for expanded culture, and plasmids were extracted using a plasmid mini-prep kit and verified by PCR and sequencing to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.
[0144] 4. Construction of engineering strains ZR-06~09, the steps are as follows:
[0145] (1) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was respectively transformed into the strain CEN.PK2-1D (as a control) and the engineering strains ZR-03~05 constructed in Example 2 using the lithium acetate method. The addition order and volume of the required addition system were as follows: 50% PEG 3350 240 μL, 1M LiAc 36 μL; ssDNA 10 μL, pRS416-TEF1p-rHirudin-ADH1t plasmid 1 μg, competent cells 50 μL.
[0146] (2) After the system was mixed evenly, it was incubated at 30°C for 30 min, incubated at 42°C for 20 min, treated with 5 mM CaCl2 for 8 min, and spread on an SC-Ura plate and cultured at 30°C to screen for positive colonies, obtaining engineering strains ZR-06 (control, only expressing rHirudin), ZR-07 (MET3Δ+MET14+SLL+hTPST1+rHirudin), ZR-08 (MET3Δ+MET14+SLL+bTPST1+rHirudin), and ZR-09 (MET3Δ+MET14+SLL+eTPST1+rHirudin) respectively.
[0147] Example 4 Screening for Engineering Strains with Higher Recombinant Hirudin Activity among ZR-07 to ZR-09
[0148] 1. Strain Fermentation: Separate single colonies of engineering strains ZR-06 to ZR-09 were picked and inoculated into YPD liquid medium, cultured overnight at 30 °C and 200 rpm. The overnight culture was transferred to fresh YPD liquid medium at a ratio of 1:50 (V:V) and cultured for 48 h to ensure sufficient protein expression and sulfation modification.
[0149] 2. Centrifugation and Detection: Centrifuge at 4 °C and 5000 rpm for 10 min to collect the supernatant of the culture medium. Take a part of the supernatant for boiling and perform Western blot to detect the expression of recombinant hirudin protein and Tyr63 sulfation modification (the primary antibody for protein expression is anti-his, product number DTH01; the primary antibody for Tyr63 sulfation is Sulfo-1C-A2, product number: ab136481; the secondary antibody is goat anti-mouse IgG, product number: ab205719, and the above antibodies are purchased from Abcam, UK). The remaining fermentation supernatant was freeze-dried for later use.
[0150] 3. Activity Detection: Determine the activity of relevant recombinant hirudin according to the thrombin titration method in "Pharmacopoeia of the People's Republic of China: 2020 Edition". The specific method is as follows: Take 1 g of the freeze-dried powder to be tested (prepared in step 2), accurately weigh it, accurately add 5 mL of 0.9% sodium chloride solution by mass percentage, stir well, extract for 30 min, and shake constantly. Centrifuge, accurately weigh 100 μL of the supernatant and place it in a test tube. Add 200 μL of tris(hydroxymethyl)aminomethane hydrochloride buffer solution (prepared temporarily) containing 0.5% (bovine) fibrinogen (calculated as the coagulum), shake well, incubate in a water bath at 37 °C for 5 min, and add thrombin solution containing 40 units per 1 mL (add 5 μL each time, once every 1 min, and shake gently while adding) until coagulation occurs. Each group has 3 parallels, and record the volume of thrombin solution consumed.
[0151] 4. Activity Calculation: Calculate the activity of recombinant hirudin according to the formula U = C1V1 / C2V2, where U is the thrombin activity unit per 1 g (U / g); C1 is the concentration of the thrombin solution (U / mL); C2 is the concentration of the test sample solution (g / mL); V1 is the volume of the thrombin solution consumed (μL); V2 is the volume of the test sample solution added (μL).
[0152] It can be seen from Figure 1 that the expression levels of recombinant hirudin in strains ZR-06 to ZR-09 are not much different ( Figure 1 ), but the level of Tyr63 sulfation modification of recombinant hirudin expressed by strain ZR-09 is higher. After thrombin titration and calculation comparison, it was measured that the activity of recombinant hirudin expressed by strain ZR-09 is also higher (Figure 2 ).
[0153] Example 5 Construction of Recombinant Hirudin-Expressing Engineering Bacteria ZR-10~15
[0154] (1) To obtain recombinant hirudin with a higher level of Tyr63 sulfation modification, based on Examples 3 and 4 above, in this study, the wild-type eTPST1 protein was used as the research object to study its interaction with hirudin. Through αfold3 simulated docking (https: / / alphafoldserver.com / ), it was found that the binding regions of Q113 and T201 of the eTPST1 protein with the hirudin-binding region were less than 3.5 Å, and the binding region of hirudin with the eTPST1 protein was rich in negatively charged E( Figure 3 ), so these two amino acids of the eTPST1 protein were mutated to be positively charged, and the specific mutation sites are shown in Table 1.
[0155] (2) Using the recombinant plasmid pUC57-HO UP -PGK1p-eTPST1-PDC1t-HO DOWN constructed in Example 2 as a template, a site-directed mutation sequence was constructed by one-step PCR method according to the conventional method. After phosphorylation, a recombinant plasmid pUC57-HO UP -PGK1p-eTPST1 Q113R -PDC1t-HO DOWN containing a mutant eTPST1 gene expression element fragment with homologous arms was obtained. The required primers are shown in Table 2, or a mutant eTPST1 gene expression element with homologous arms can be directly synthesized manually with reference to Example 2.
[0156] (3) Referring to Example 2, the mutant eTPST1 gene expression element fragment with homologous arms was digested and recovered, and then introduced into the engineering bacteria ZR-02 together with the HO gene editing plasmid by the lithium acetate method. Positive clones were screened, the gene editing plasmid was discarded, and PCR was performed to verify the insertion of the mutant TPST1 gene expression element, obtaining engineering strains ZR-05 / 01~ZR-05 / 06 with the mutant eTPST1 gene expression element inserted at the corresponding position.
[0157] (4) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transferred into the positive strain obtained in step (3). The specific method was the same as that in Example 3, obtaining eTPST1 mutants eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K 、eTPST1 T201H, corresponding to strains ZR-10 to 15 in sequence.
[0158] (3) Screen engineering strains with higher recombinant hirudin expression activity among ZR-10 to 15: The fermentation, purification and activity detection methods are the same as in Example 4.
[0159] The results are shown in Figure 4 , as can be seen from the figure, the levels of recombinant hirudin expression of the 6 mutants are comparable. By thrombin titration and calculation to compare the activities of recombinant hirudin expressed by each strain of ZR-10 to 15, the results are shown in Figure 5 , eTPST1 T201R mutation can significantly improve the activity of recombinant hirudin.
[0160] Table 1 Mutation sites of eTPST1 protein
[0161] Table 2 Primer sequences (the bold part is the mutated nucleic acid)
[0162] Example 6 High-copy eTPST1 T201R Construction of engineering strain ZR-16
[0163] 1. Artificially synthesize the fusion gene expression element rDNA including the rDNA homologous arm fragment up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNA down , transfer it into engineering strain ZR-02 by the lithium acetate method with reference to the foregoing example, culture on a YPD plate containing 500 μg / mL G418 for 2-3 days to screen positive clones, and then streak the positive clones onto YPD plates containing gradient concentrations of G418 (1000 μg / mL, 2000 μg / mL, 4000 μg / mL, 8000 μg / mL, 16000 μg / mL) and culture for 2-3 days respectively to screen high-copy eTPST1 T201R positive clones.
[0164] 2. Transfer the recombinant plasmid pRS416-pTEF-rHirudin-ADH1t into the positive clones screened in step 1 by the lithium acetate method with reference to the foregoing example, plate it onto an SC-Ura plate and culture for 2-3 days to screen positive clones to obtain engineering strain ZR-16.
[0165] 3. With reference to Example 4, perform fermentation, purification and activity detection methods on engineering strains ZR-13 and ZR-16, and compare their recombinant hirudin expression activities and sulfation levels ( Figure 5 ).
[0166] The activities of ZR-13 and ZR-16 strains expressing recombinant hirudin are as Figure 6 shown. The results show that ZR-16 strain expresses highly active rHirudin with a higher level of sulfated modification.
[0167] The fusion gene expression element rDNA up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNA down nucleotide sequence:
[0168] ATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGT ATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGA GTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACG GAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCC CCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTT CCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCG CAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAG TCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAA CCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGAT CTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTG ATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTC - GCTACTAACTTCTCTTTGTTGA AGCAAGCTGGTGACGTTGAAGAAAACCCAGGTCCA -eTPST1 T201R
[0169] Note: The lowercase letters are rDNA respectively UP and rDNA DOWN , the horizontal line part is the nucleotide sequence of the KanMX4 resistance gene, and the dotted underlined part is the nucleotide sequence of the P2A self-cleaving peptide
[0170] Application Example Application of Recombinant Hirudin with Tyrosine Sulfation Modification in the Field of Medical Cosmetology
[0171] 1. Evaluation of the Antioxidant Activity of Highly Active rHirudin
[0172] (1) Preparation of 2',7'-dichlorofluorescein diacetate (DCFH-DA) solution: Weigh 0.0049 g of DCFH-DA drug precisely, dissolve it thoroughly with 1 mL of methanol, dispense it (100 μL / tube), and store it in the dark at -20 °C. The preparation process needs to be carried out in a sterile environment and in the dark. When using, precisely pipette 2.5 μL of the DCFH-DA stock solution, add 1 mL of serum-free DMEM medium and mix well thoroughly, and prepare it immediately before use
[0173] (2) Preparation of highly active rHirudin solution: Precisely weigh 1 g of highly active rHirudin freeze-dried powder (the ZR-16 expression product in Example 6), mix it thoroughly with 100 mL of distilled water, filter and sterilize it with a 0.22 μm filter membrane to prepare a mother liquor with a concentration of 10 g / L. When using, dilute it with H2O2 solution (0.2 mmol / L) to prepare concentration gradients of 50, 100, 150, 200, and 250 mg / L
[0174] (3) Preparation of natural Hirudin (CAS number: 113274-56-9) solution: The same as above
[0175] (4) Preparation of vitamin C solution: Precisely weigh 200.0 mg of vitamin C sample, mix it thoroughly with distilled water, make the volume up to 10 mL, filter and sterilize it with a 0.22 μm filter membrane to prepare a vitamin C mother liquor with a concentration of 20 mg / mL, store it in the dark at 2-8 °C, and the storage time does not exceed 3 months. When using, dilute it with H2O2 solution (0.2 mmol / L) to prepare concentration gradients of 0.2, 0.4, 0.6, 0.8, and 1 mg / mL
[0176] (5) Cell culture: Place Hacat cells (commercially available) in a cell culture flask, add 5 mL of cell culture medium (90% DMEM medium + 10% fetal bovine serum), culture it in an incubator at 37 °C and 5% CO2, observe the cell growth situation under an inverted microscope. When the cells grow to 80%-90% of the culture flask, carry out cell seeding
[0177] (6) Cell seeding: Take cells in the logarithmic growth phase and seed them into a 24-well plate at a seeding density of 1×10 5 cells / mL and culture for 24 h.
[0178] (7) Evaluation system: Set up a blank control group (Group 1), an oxidative control group (Group 2), a high-activity rHirudin group (Group 3), a natural Hirudin group (Group 4), and a positive control group (Group 5). The evaluation system is shown in Table 3: Table 3 ; Note: In this experiment, all washing steps are operated with a pipette. Each time, 0.5 - 1 mL of PBS buffer is aspirated, and the blowing and sucking force is gentle and slow. The wells are washed column by column. The samples in the table refer to high-activity rHirudin or natural Hirudin.
[0179] After adding the DCFH-DA solution to the evaluation system, incubate at 37 °C in the dark for 30 min, wash the cells 3 times with PBS buffer, and measure the fluorescence intensity (MFI) with an excitation wavelength of 485 nm and an emission wavelength of 538 nm using a fluorescence analyzer. After gently removing the PBS buffer in each well, immediately lyse the cells to extract the total cellular protein, and detect the total cellular protein content using the BCA detection kit method. ROS is expressed as the fluorescence intensity per mg of protein, i.e., MFI / mg protein.
[0180] (8) Calculation of ROS inhibition rate: I ROS (%)=(1-(ROS S -ROS B ) / (ROS H -ROS B ))×100%, where I ROS represents the ROS inhibition rate; ROS S represents the ROS value of the sample group (Groups 3 - 5); ROS B represents the ROS value of the blank control group; ROS H represents the ROS value of the oxidative group.
[0181] Draw a curve as Figure 7 . The results show that the high-activity recombinant hirudin with Tyr63 sulfation expressed by ZR-16 has antioxidant ability comparable to that of natural hirudin, indicating that the structure of the high-activity recombinant hirudin with Tyr63 sulfation expressed by ZR-16 is already close to that of natural hirudin.
[0182] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification, characterized in that Obtained by the following method: Using Saccharomyces cerevisiae as the starting strain, integrating the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element into the chromosome of Saccharomyces cerevisiae to obtain a Saccharomyces cerevisiae engineering bacterium with a tyrosine sulfation modification system introduced; then transferring a recombinant plasmid containing a recombinant hirudin gene expression element into the Saccharomyces cerevisiae engineering bacterium with the tyrosine sulfation modification system introduced to obtain a Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification; The TPST1 gene expression element includes the coding sequence of the TPST1 gene; the TPST1 gene is the hTPST1 gene, bTPST1 gene, or eTPST1 gene, and the coding sequences of the hTPST1 gene and bTPST1 gene are as shown in SEQ ID No: 5 or 6; The eTPST1 gene is a wild-type eTPST1 gene or a mutant eTPST1 gene; The coding sequence of the wild-type eTPST1 gene is shown in SEQ ID No:7; the mutant eTPST1 gene is eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H ; eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H The corresponding mutation sites are 337-339bp, and the corresponding mutant nucleotide sequences are AGA, AAA, CAT respectively; eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H The corresponding mutation sites are 601-603bp, and the corresponding mutant nucleotide sequences are AGA, AAA, CAT respectively.
2. The construction method of the engineered Saccharomyces cerevisiae for expressing highly active recombinant hirudin with tyrosine sulfation modification as claimed in claim 1, characterized in that Comprising the following steps: Ⅰ. Using Saccharomyces cerevisiae CEN.PK2-1D as the starting strain, inserting the MET3Δ gene expression element and MET14 gene expression element into the yeast chromosome through homologous recombination to obtain the engineering strain ZR-01; Ⅱ. Using the engineering strain ZR-01 obtained in step 1 as the object, inserting the SLL gene expression element through gene editing to obtain the engineering strain ZR-02; Ⅲ. Using the engineering strain ZR-02 obtained in step 2 as the object, inserting the TPST1 gene expression element through gene editing to obtain an engineering strain containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element; Ⅳ. Using the engineering strain obtained in step 3 as the object, transferring the recombinant plasmid containing the recombinant hirudin gene expression element through the lithium acetate method to obtain a Saccharomyces cerevisiae engineering bacterium expressing highly active recombinant hirudin with tyrosine sulfation modification.
3. The method for constructing the Saccharomyces cerevisiae engineering bacterium according to claim 2, wherein: The engineering strain ZR-01 in step Ⅰ is prepared by the following method: Design and synthesize a nucleic acid sequence, GAL7 UP、 MET3p-MET3Δ-MET3t, MET14p-MET14-MET14t, LEU2p-LEU2 and GAL7 DOWN Fragment, and at the same time transform the above fragments into Saccharomyces cerevisiae by the lithium acetate method, screen positive clones in the LEU auxotrophic medium to obtain strain ZR-01.
4. The method for constructing the Saccharomyces cerevisiae engineering bacterium according to claim 2, wherein: The engineering strain ZR-02 in step Ⅱ is prepared by the following method: (1) Design and synthesize a nucleic acid sequence, which includes: GAL1 UP , SLL gene expression element and GAL1 DOWN , and set restriction enzyme sites at the upstream and downstream respectively; (2) Insert the sequence synthesized in step (1) into the pUC57 plasmid by enzymatic digestion and ligation to construct the recombinant plasmid pUC57-GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN ; (3) Amplify recombinant plasmid pUC57-GAL1 in Escherichia coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN , and obtain GAL1 by double digestion UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment; (4) Transform the gene editing plasmid and the GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment into the strain ZR-01 by the lithium acetate method, screen for positive transformants, and obtain the engineered strain ZR-02.
5. The method for constructing the Saccharomyces cerevisiae engineering bacterium according to claim 2, wherein: The engineering strain containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element in step Ⅲ is prepared by the following method: (1) Design and synthesize a nucleic acid sequence, which includes: HO UP sequence, TPST1 gene expression element and HO DOWN sequence, and set restriction enzyme sites at the upstream and downstream respectively; (2) Insert the sequence synthesized in step (1) into the pUC57 plasmid by enzymatic digestion and ligation to construct the recombinant plasmid pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN ; (3)Amplify the recombinant plasmid pUC57-HO in Escherichia coli UP -PGK1p-TPST1-PDC1t-HO DOWN , and obtain HO by double digestion UP -PGK1p-TPST1-PDC1t-HO DOWN fragment; (4) Transform the gene editing plasmid and the HO UP -PGK1p-TPST1-PDC1t-HO DOWN fragment into strain ZR-02 by the lithium acetate method, screen positive transformants to obtain the target engineered strain.
6. The method for constructing the engineered Saccharomyces cerevisiae according to claim 4 or 5, characterized in that Further comprising the following steps: The starting plasmid of the gene editing plasmid is pRS416; the gene editing plasmid is based on the plasmid pRS416 and inserts the following components: Cas9 expression element and gRNA expression element.
7. The method for constructing the Saccharomyces cerevisiae engineering bacterium according to claim 2, wherein: The recombinant plasmid containing the recombinant hirudin gene expression element in step Ⅳ is prepared by the following method: (1)Synthesize recombinant hirudin gene expression elements and set restriction enzyme sites at the upstream and downstream respectively; (2)Insert the sequence synthesized in step (1) into the pUC57 plasmid by restriction enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t; (3)Amplify the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t in Escherichia coli and obtain the TEF1p-rHirudin-ADH1t fragment by double enzyme digestion; (4)Ligate the TEF1p-rHirudin-ADH1t fragment to the pRS416 vector through the restriction enzyme site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t of the recombinant hirudin gene expression element.
8. A highly active recombinant hirudin with tyrosine sulfation modification, characterized in that It is expressed by the Saccharomyces cerevisiae engineering bacteria expressing highly active recombinant hirudin with tyrosine sulfation modification described in claim 1.
9. Use of the Saccharomyces cerevisiae engineering bacteria described in claim 1 or the highly active recombinant hirudin with tyrosine sulfation modification described in claim 8 in the preparation of antithrombin products.
10. Use of the Saccharomyces cerevisiae engineering bacteria described in claim 1 or the highly active recombinant hirudin with tyrosine sulfation modification described in claim 8 in the preparation of anticoagulant, antithrombotic, antihypertensive, hypolipidemic drugs or in the field of beauty and skin care.
Citation Information
Patent Citations
Construction of recombinant eukaryotic hansenula engineering bacterial strains containing medical hirudin genes and production process of recombinant hirudin
CN102373216A
Saccharomyces cerevisiae engineering strain for producing p-coumaroyl-coenzyme A as well as construction method and application of saccharomyces cerevisiae engineering strain
CN118048252A
Tyrosine sulfated recombinant hirudin as well as preparation method and application thereof
CN119462906A
Production of polypeptides by use of novel protease deficient yeast strains
US6103515A
Saccharomyces cerevisiae engineering bacteria for improving gene expression level and construction method and application thereof
WO2024067774A1