Enzymatic synthesis method of carbonyl reductase mutant and montelukast sodium intermediate
By developing carbonyl reductase mutants and using enzyme catalytic methods, the problem of chiral carbonyl reduction in the synthesis of montelukast sodium intermediate in the prior art was solved, and efficient synthesis of montelukast sodium intermediate under mild conditions was achieved, which improved yield and optical purity and reduced waste generation.
Patent Information
- Application Number
- CN202510705364.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-05-29
AI Technical Summary
In the existing synthesis method of Montelukast sodium intermediate, the reduction of chiral carbonyl groups is difficult, the catalytic activity is low, and extreme conditions such as high temperature and high pressure are required. The use of harmful catalysts to generate a large amount of waste.
A carbonyl reductase mutant was developed, and asymmetric reduction reaction was carried out through enzyme catalytic method to prepare the R-configured chiral alcohol Montelukast sodium intermediate. This method uses crude enzyme solution of carbonyl reductase mutant, coenzyme NADP+, coenzyme circulating hydrogen donor isopropanol, cosolvent isopropanol and buffer PB buffer for biocatalytic reactions.
It has achieved efficient synthesis of montelukast sodium intermediate under mild conditions, which reduces harm to people and the environment, reduces waste generation, improves yield and optical purity of products, and has good industrialization potential.
Smart Images

Figure CN120230730A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biopharmaceuticals, and specifically to a carbonyl reductase mutant and an enzymatic catalytic synthesis method of montelukast sodium intermediate. Background Art
[0002] Montelukast Sodium (the structural formula is shown below) was first developed by Merck Frosst Canada Inc., and is an important leukotriene receptor antagonist, widely used in the treatment of asthma and allergic rhinitis. The research progress of its synthesis method mainly focuses on the optimization of the synthesis route, the improvement of reaction conditions, and the selection of intermediates (such as Patent EP737186B1, Patent US5565473A).
[0003] Currently, the reduction of the chiral carbonyl of montelukast sodium intermediate (the structural formula is shown below) is crucial. Due to the relatively complex substrate structure, poor water solubility, low substrate binding rate in the enzyme pocket, and low catalytic activity. Therefore, further mutation and optimization are urgently needed.
[0004] Summary of the Invention
[0005] The first object of the present invention is to provide a carbonyl reductase mutant.
[0006] The second object of the present invention is to provide an enzymatic catalytic synthesis method of montelukast sodium intermediate, using an enzymatic catalytic method to carry out an asymmetric reduction reaction to prepare R-configured chiral alcohol.
[0007] To achieve the above object, the present invention provides the following technical solutions: A carbonyl reductase mutant, whose amino acid sequence is shown in any one of SEQ ID NO: 6-8. The nucleotide sequence is shown in any one of SEQ ID NO: 2-4. The amino acid sequence of the wild-type carbonyl reductase is shown in SEQ ID NO: 5, and the nucleotide sequence is shown in SEQ ID NO: 1.
[0008] An enzymatic catalytic synthesis method of montelukast sodium intermediate, specifically: using compound II as a substrate, in the presence of the crude enzyme solution of the carbonyl reductase mutant of the present invention, coenzyme, coenzyme recycling hydrogen donor, cosolvent and buffer solution, through a biocatalytic reaction to generate montelukast sodium intermediate, that is, compound I; the specific synthesis route is as follows: ; Among them, the preparation method of the crude enzyme solution of the carbonyl reductase mutant is as follows: After the sequence of the carbonyl reductase mutant is synthesized by DNA sequence, PCR amplification is carried out, and then it is introduced into an expression vector to obtain a recombinant expression vector. Then the recombinant expression vector is transformed into Escherichia coli to obtain a cloned strain, which is cultured and centrifuged to collect, and the crude enzyme solution of the carbonyl reductase mutant is obtained by ultrasonic disruption.
[0009] Among them, the coenzyme is NADP+.
[0010] Among them, the coenzyme cycle hydrogen donor is isopropanol.
[0011] Among them, the cosolvent is isopropanol.
[0012] Among them, the mass-volume ratio of the compound II to the crude enzyme solution of the carbonyl reductase mutant is 0.5 g:10 mL.
[0013] Among them, the buffer solution is PB buffer solution.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: Compared with the method of synthesizing montelukast sodium intermediate (compound I) by a pure chemical route in the prior art, the method of the present invention does not require extreme catalytic environments such as high temperature and high pressure. At the same time, it can reduce the use of catalysts harmful to humans and the environment, reduce the generation of waste, and is environmentally friendly. Moreover, because the carbonyl reductase mutant of the present invention has excellent stereoselectivity, it can effectively improve the yield and the optical purity of the product, and has excellent industrialization potential. Description of the Drawings
[0015] Figure 1 It is a recombinant expression plasmid map. Detailed Embodiments
[0016] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention. The reagents and biological materials involved in the present invention are all commercially available products without special instructions.
[0017] Example 1 Preparation of Carbonyl Reductase After the initial carbonyl reductase sequence and mutant sequence are synthesized by DNA sequence, PCR amplification is carried out (the DNA sequences are shown in SEQ ID NO: 1-4), and the primer sequences are shown in SEQ ID NO: 9-10.
[0018] F: CCCATATGACCGACCGTCTGAAACACAAAGTTG R: CCGCTCGAGTTACTGAGCGGTGTAACCAC Then, it was introduced into the NdeI and XhoI restriction enzyme sites of the expression vector pET-30a(+) (purchased from Shanghai Sangon Biotech Co., Ltd.) to obtain the recombinant expression vector. As Figure 1 shown, it was transformed into Escherichia coli BL21(DE3) (purchased from Shanghai Sangon Biotech Co., Ltd.). After screening by spreading on an antibiotic-resistant plate, the cloned strain was obtained. After verifying the success of the recombination, the obtained strain was activated overnight in LB medium (purchased from Shanghai Sangon Biotech Co., Ltd.) at 37°C, and then added to 200 mL of fermentation broth (LB medium). It was cultured until the OD 600 value reached 0.6 - 0.8. IPTG with a final concentration of 0.5 mM was added and the culture was continued for 20 h (20 - 25°C). Then, the strain was collected by centrifugation and washed with 0.2 M PBS buffer with a pH value of 7.0. After collection, 10 mL of 0.2 M PB buffer with a pH of 7.0 was added to each gram of wet cells and sonicated to obtain the crude enzyme solution of carbonyl reductase.
[0019] Example 2 Preparation of Montelukast Sodium Intermediate In a 250 ml conical flask, 60 mL of PB buffer (0.2 mM, pH 7.5) was added. Then, 10 mL of the original crude enzyme solution (KRED-WT, amino acid sequence SEQ ID NO: 5), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of the substrate were added in sequence. After mixing, the reaction was stirred overnight at 33°C to obtain Compound I. The reaction result was detected by HPLC, and the conversion rate was 69.1% and the ee value was 99.9%.
[0020] Example 3 Preparation of Montelukast Sodium Intermediate In a 250 ml conical flask, 60 mL of PB buffer (0.2 mM, pH 7.5) was added. Then, 10 mL of the mutant crude enzyme solution (KRED-T16A, amino acid sequence SEQ ID NO: 6), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of the substrate were added in sequence. After mixing, the reaction was stirred overnight at 33°C to obtain Compound I. The reaction result was detected by HPLC, and the conversion rate was 98.7% and the ee value was 99.9%.
[0021] Example 4 Preparation of Montelukast Sodium Intermediate In a 250 ml conical flask, add 60 mL of PB buffer (0.2 mM, pH 7.5). Then, successively add 10 mL of the crude mutant enzyme solution (KRED-T104L, amino acid sequence as shown in SEQ ID NO: 7), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of the substrate. After mixing, stir the reaction overnight at 33 °C to obtain Compound I. The reaction result was detected by HPLC, with a conversion rate of 75.1% and an ee value of 100%.
[0022] Example 5 Preparation of Montelukast Sodium Intermediate In a 250 ml conical flask, add 60 mL of PB buffer (0.2 mM, pH 7.5). Then, successively add 10 mL of the crude mutant enzyme solution (KRED-T104L+T16A, amino acid sequence as shown in SEQ ID NO: 8), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of the substrate. After mixing, stir the reaction overnight at 33 °C to obtain Compound I. The reaction result was detected by HPLC, with a conversion rate of 99.2% and an ee value of 100%.
[0023] Although the embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A carbonyl reductase mutant, characterized in that: The amino acid sequence of the carbonyl reductase mutant is shown in any one of SEQ ID NO: 6-8.
2. The carbonyl reductase mutant according to claim 1, wherein: The nucleotide sequence of the carbonyl reductase mutant is shown in any one of SEQ ID NO: 2-4.
3. An enzymatic catalytic synthesis method of montelukast sodium intermediate, characterized in that: Using compound II as a substrate, in the presence of the crude enzyme solution of the carbonyl reductase mutant, coenzyme, coenzyme cycle hydrogen donor, cosolvent and buffer solution, montelukast sodium intermediate, namely compound I, is generated through biocatalytic reaction; The specific synthesis route is as follows: ; Among them, the preparation method of the crude enzyme solution of the carbonyl reductase mutant is: after the sequence of the carbonyl reductase mutant described in claim 1 or 2 is synthesized by DNA sequence, PCR amplification is carried out, and then the recombinant expression vector is obtained by introducing it into the expression vector. Then the recombinant expression vector is transformed into Escherichia coli to obtain a cloned strain, which is cultured and centrifuged to collect, and the crude enzyme solution of the carbonyl reductase mutant is obtained through ultrasonic disruption.
4. The enzymatic catalytic synthesis method of the montelukast sodium intermediate according to claim 3, wherein: The coenzyme is NADP+.
5. The enzymatic catalytic synthesis method of the montelukast sodium intermediate according to claim 3, characterized in that: The coenzyme cycle hydrogen donor is isopropanol.
6. The enzymatic catalytic synthesis method of the montelukast sodium intermediate according to claim 3, wherein: The cosolvent is isopropanol.
7. The enzymatic catalytic synthesis method of the montelukast sodium intermediate according to claim 3, characterized in that: The mass-volume ratio of the compound II to the crude enzyme solution of the carbonyl reductase mutant is 0.5 g: 10 mL.
8. The enzymatic catalytic synthesis method of the montelukast sodium intermediate according to claim 3, characterized in that: The buffer solution is PB buffer solution.
Citation Information
Patent Citations
Method for preparing ticagrelor intermediate through enzymatic preparation
CN109112166A
Enzyme-catalyzed preparation method of (S) -N-Boc-3-hydroxypiperidine
CN109182410A
Carbonyl reductase mutant and application thereof in preparation of rosuvastatin chiral intermediate
CN114410599A
Ketoreductase and application thereof in preparation of (S)-1-(4-pyridyl)-1, 3-propylene glycol
CN115537406A
Improved ketoreductase and application thereof in preparation of montelukast sodium intermediate
CN119955750A