LbuCas13a modified protein and editing system thereof

Abstract

The invention discloses an LbuCas13a modified protein and an editing system thereof, the modification of the LbuCas13a modified protein comprises the following mutations: V411T, N414K and V421T which are introduced into a hairpin loop near an LbuCas13a nuclease active center and are responsible for being combined with a substrate RNA (Ribonucleic Acid), and the mutation sites are amino acid sequence 407-424 regions so as to enhance the electropositivity of the hairpin loop and the affinity of the hairpin loop with the RNA. According to the LbuCas13a-V411T-N414K-V421T mutant disclosed by the invention, directional point mutation and structural repeated design are carried out on a substrate RNA (Ribonucleic Acid) binding hairpin loop, so that the binding capacity of the LbuCas13a and a target RNA and the para-line cleavage activity are remarkably enhanced, and an experiment shows that the enzyme activity of the mutant LbuCas13a-V411T-N414K-V421T is improved by 36.7% compared with that of a wild type, and the activity of the repeatedly designed LbuCas13a-V411T-N414K-V421T-loop is improved by 168.6%. The technology has important significance on application of the LbuCas13a in molecular diagnosis, rapid screening of pathogens and public health monitoring.

Description

Technical Field

[0001] The present invention relates to the cross - technical field of gene editing and molecular diagnosis, and particularly to a modified LbuCas13a protein and a CRISPR / LbuCas13a gene editing system using the modified protein. Background Art

[0002] The CRISPR - Cas13a system is an adaptive immune system widely existing in prokaryotes for defending against the invasion of foreign nucleic acids. Among them, the Cas13a protein, as an important member of the CRISPR - Cas system, has RNA - targeted cleavage activity and shows great application potential in the fields of biotechnology and medicine, especially in aspects such as RNA editing and detection. For example, the SHERLOCK system developed by the Zhang Feng team uses Cas13a to achieve the detection of RNA viruses. However, existing technologies mostly focus on Leptotrichia wadei LwaCas13a from a certain source and do not involve LbuCas13a which has higher sensitivity in nucleic acid detection. Leptotrichia buccalis Cas13a (LbuCas13a).

[0003] In order to improve the sensitivity of Cas13a detection, researchers have made many attempts. In the reported studies, researchers such as Yang introduced different RNA - binding proteins near the loop of the collateral cleavage active center of Leptotrichia wadei Cas13a (LwaCas13a), greatly improving the detection sensitivity of LwaCas13a. However, such studies only focus on LwaCas13a. Previous research reports show that Leptotrichia buccalis Cas13a (LbuCas13a) has higher sensitivity in nucleic acid detection, making it a very promising detection tool. However, currently in the prior art, there are no reports and patented technologies on optimizing the substrate binding and catalytic efficiency of LbuCas13a by protein engineering means. Given the advantages of LbuCas13a and the current research gap, developing a directed modification method for LbuCas13a and applying it to the highly sensitive detection of RNA viruses has important scientific significance and practical application value. Summary of the Invention

[0004] The main objective of the present invention is to propose a modified LbuCas13a protein and its editing system, aiming to provide a structural design method for improving the detection sensitivity of LbuCas13a. By means of point mutation and repetition of the loop at the nuclease active center, the substrate sensitivity of enzyme nucleic acid detection is improved.

[0005] To achieve the above object, the present invention provides a modified LbuCas13a protein, the modification of which includes introducing the following mutations into the hairpin loop responsible for binding to the substrate RNA near the nuclease active center of LbuCas13a: V411T, N414K, and V421T. The amino acid sequence of the modified protein is shown in SEQ ID NO:1.

[0006] Preferably, the modification further includes designing a double-loop structure in the region of amino acid sequence 407-424. The double-loop structure is connected between N413 and N414 through a flexible structure. The amino acid sequence of the modified protein after the double-loop structure design is shown in SEQ ID NO:5.

[0007] The present invention also provides a nucleic acid molecule encoding the modified LbuCas13a protein as described above, and the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:6.

[0008] The present invention also provides a recombinant expression vector, which contains the nucleic acid molecule as described above.

[0009] Preferably, the nucleic acid molecule carries the coding sequences of a histidine tag and a SUMO tag.

[0010] Preferably, the vector is the prokaryotic expression vector pET-11a.

[0011] Preferably, the vector contains a nucleic acid sequence encoding a single-stranded guide RNA that can be used in combination with the modified LbuCas13a protein. The single-stranded guide RNA includes a scaffold sequence and a CRISPR spacer sequence.

[0012] The present invention also provides a host cell, which includes the recombinant expression vector as described above.

[0013] The present invention also provides a method for preparing the modified LbuCas13a protein as described above, including the following steps: S1. Transform the recombinant expression vector into Escherichia coli BL21(DE3) cells, spread the transformed cells on a plate, and culture overnight to obtain transformed clones. S2. Prepare a fermentation seed solution from the transformed clones, transfer the seed solution into a self-inducing medium, shake culture, ferment, centrifuge, and lyse the cells, and purify the tagged protein by chromatography. S3. Remove the tag and then purify the target protein for the second time.

[0014] Preferably, the fluorescently labeled RNA reporter molecule is FAM-UUUUUU-BHQ1.

[0015] The present invention also provides a gene editing system, and the CRISPR-Cas13a gene editing system includes the modified LbuCas13a protein, a specific crRNA, and a target gene as described above.

[0016] The present invention also provides an application of the gene editing system as described above, which is applied to gene editing breeding and drug research and development.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) In the technical solution provided by the present invention, with the design of the loop of the active center of LbuCas13a as the core, hydrophobic amino acids on the loop responsible for binding to the substrate RNA near the active center of the LbuCas13a collateral nuclease are mutated into polar or basic amino acids. For the hydrophobic residues (V411, V421) in the substrate-binding hairpin loop (407-424), they are replaced with polar residues (T), and N414 is replaced with a positively charged lysine (K). Through these mutations, the local positive charge is increased, which can enhance the electrostatic interaction with negatively charged RNA. Point mutations of amino acid residues are introduced on this loop, improving the electropositivity and polarity of the probe RNA-binding loop. In this way, the recognition and binding ability of LbuCas13a to the substrate RNA are enhanced, thereby improving its cleavage efficiency and specificity.

[0018] (2) On the basis of the mutation, a repetitive loop structure is inserted, and flexible peptides GGGGS are added to the amino terminus and carboxyl terminus respectively. The substrate capture efficiency is improved through the synergistic action of the double binding sites, and the structural stability is maintained by using a flexible linker.

[0019] (3) Through the directed point mutation and structural repetition design of its substrate RNA-binding hairpin loop, the binding ability of LbuCas13a to the target RNA and its collateral cleavage activity are significantly enhanced. Experiments show that the enzyme activity of the mutant LbuCas13a-V411T-N414K-V421T is increased by 36.7% compared with the wild type, while the activity of the repetitively designed LbuCas13a-V411T-N414K-V421T-loopplus is increased by up to 168.6%. This technology is of great significance for the application of LbuCas13a in molecular diagnosis, rapid screening of pathogens, and public health monitoring. Description of the Drawings

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other relevant drawings can also be obtained based on these drawings.

[0021] Figure 1 This is the design diagram of the loop mutant on the LbuCas13a substrate RNA probe binding groove in Example 1 provided by the present invention. Figure (A) is the protein band model of wild-type LbuCas13a, Figure (B) is the protein band model of the mutant V411T-N414K-V421T, Figure (C) is the surface charge display model of wild-type LbuCas13a protein (red is electronegative, blue is electropositive), and Figure (D) is the surface charge display model of the mutant V411T-N414K-V421T protein; Figure 2 This is the repeated design of the LbuCas13a substrate RNA probe loop mutant in Example 2 provided by the present invention. Figure (A) is the protein band model, and Figure (B) is the surface charge display model of the protein (red is electronegative, blue is electropositive); Figure 3 This is the construction process of the recombinant expression vector in Example 3 provided by the present invention. Figure 4Expression and purification diagrams of LbuCas13a wild type and mutants in Example 5 provided by the present invention. 1 and 8 are protein markers; 2 is the eluate after nickel column purification of LbuCas13a-WT, 3 is the protein after dialysis of the eluted protein of LbuCas13a-WT into SUMO protease cleavage buffer, 4 is LbuCas13a-WT after SUMO protease cleavage for 12 h, 5 is the protein after dialysis into the nickel column purification equilibration buffer after cleavage, 6 is the flow-through of the second nickel column purification (finally purified LbuCas13a-WT, 138.5 kDa); 7 is the uncleaved protein and miscellaneous proteins bound to the nickel column during the second nickel column purification, 9 is the eluate after nickel column purification of LbuCas13a-V411T-N414K-V421T, 10 is the protein after dialysis of the eluted protein of LbuCas13a-V411T-N414K-V421T into SUMO protease cleavage buffer, 11 is LbuCas13a-V411T-N414K-V421T after SUMO protease cleavage for 12 h, 12 is the flow-through of the second nickel column purification (finally purified LbuCas13a-V411T-N414K-V421T, 138.5 kDa), 13 is the uncleaved protein and miscellaneous proteins bound to the nickel column during the second nickel column purification, 14 is the eluate after nickel column purification of LbuCas13a-V411T-N414K-V421T-loopplus, 15 is the protein after dialysis of the eluted protein of LbuCas13a-V411T-N414K-V421T-loopplus into SUMO protease cleavage buffer, 16 is LbuCas13a-V411T-N414K-V421T-loopplus after SUMO protease cleavage for 12 h, 17 is the flow-through of the second nickel column purification (finally purified LbuCas13a-V411T-N414K-V421T-loopplus, 140.5 kDa), 18 is the uncleaved protein and miscellaneous proteins bound to the nickel column during the second nickel column purification; Figure 5 Diagram of LbuCas13a detecting coronavirus ORF7a gene in Example 6 provided by the present invention. Figure (A) is a graph of fluorescence intensity changing with time (signals are collected every two minutes), and Figure (B) is the fluorescence after removing the background, showing the collateral nuclease activities of LbuCas13a-WT, LbuCas13a-V411T-N414K-V421T, and LbuCas13a-V411T-N414K-V421T-loopplus.

[0022] The realization, functional features, and advantages of the objectives of the present invention will be further described in conjunction with the embodiments and with reference to the accompanying drawings. Detailed implementation manners

[0023] The present invention will be further described in detail below through specific preferred embodiments, but the present invention is not limited to the following embodiments.

[0024] It should be noted that unless otherwise specified, the chemical reagents involved in the present invention are all purchased through commercial channels.

[0025] Example 1 Design of loop mutants at the active center of LbuCas13a Based on the analysis of the resolved crystal structure of LbuCas13a (PDB: 5XWY), it was determined that the hydrophobic amino acids on the substrate RNA-binding loop (407 - 424) of the collateral cleavage active center were mutated to polar or basic amino acids, which was beneficial to enhancing the binding strength between the loop and RNA. Specifically, point mutations introducing three amino acid residues were made on this loop, namely V411T, N414K, and V421T (the amino acid sequence of the LbuCas13a protein after mutation is shown in SEQ ID NO:1). The three-dimensional structure of the mutated loop was simulated by the SWISS-MODEL program, and it was confirmed that the mutation from Val411 to Thr did not cause a change in the secondary structure of the loop; the mutation from Asn414 to Lys could enhance the electropositivity of the loop (as Figure 1 shown). This design was named LbuCas13a-V411T-N414K-V421T.

[0026] Example 2 Repeated design of the hairpin loop at the active center of LbuCas13a Based on the three-dimensional structure analysis, the specific position of the mutant loop was determined. The start and end amino acid residues Arg407 and Glu424 of the hairpin loop were 6.5 Å apart in space (α-carbon atoms). It was determined that the main structure of the mutant loop (R405 - E424) was inserted between N413 and N414 at the tip of the loop, and flexible peptides GGGGS were added to the amino-terminal and carboxyl-terminal ends of the aforementioned mutant loop respectively to ensure that both loops could basically maintain their original spatial structures (as Figure 2 shown). This design was named LbuCas13a-V411T-N414K-V421T-loopplus (its amino acid sequence is shown in SEQ ID NO:5).

[0027] Example 3 Construction of a recombinant expression vector for the LbuCas13a mutant The LbuCas13a-V411T-N414K-V421T mutant gene was obtained by PCR amplification. The specific operation process is as follows. First, the gene fragment at the 5' end of the mutation region was amplified by PCR, and the primers were: Lbu13a-N-F: taaCATATGgccatatggctagctggagcc and 411-414-421MU-R: cgccagaGGTgtacttctcctcgcccttTttgttcttGGTggtcttgccg; Second, the gene fragment at the 3' end of the mutation region was amplified by PCR, and the primers were: 411-414-421MU-F: cggcaagaccACCaagaacaaAaagggcgaggagaagtacACCtctggcg and Lbu13a-C-R: taaCTCGAGgcctcgagtgcggccttagttctcggac; Finally, the full-length gene fragment of LbuCas13a-V411T-N414K-V421T was amplified by PCR (using the above two PCR products as templates), and the primers were: Lbu13a-N-F: taaCATATGgccatatggctagctggagcc and Lbu13a-C-R: taaCTCGAGgcctcgagtgcggccttagttctcggac.

[0028] The loop (407 - 424) encoding gene fragment was obtained by gene synthesis (its gene sequence SEQ ID NO:7 is: Agaaatatcctggagacagaaaacgagaatgacatcacaggcaggatgcgcggcaagaccgtgaagaacggcggcggcggcagccgcggcaagaccgtgaagaacaataagggcgaggagaagtacgtgtctggcgagggcggcggcggcagcaataagggcgaggagaagtacgtgtctggcgaggtggataagatctacaacgagaacaagaagaatgaggtg), and it was inserted between N413 and N414 by overlap PCR. The specific operation process is as follows. (1) PCR amplify the Loopplus gene fragment, and the primers are: Loopplus-F: agaaatatcctggagacagaaaac and Loopplus-R: cacctcattcttcttgttctcgtt; (2) PCR amplify the gene fragment at the 5' end of Loop, and the primers are: Lbu13a-N-F: taaCATATGgccatatggctagctggagcc and loopplus-N-R: gcctgtgatgtcattctcgttttc; (3) PCR amplify the gene fragment at the 3' end of Loop, and the primers are: loopplus-C-F: gtggataagatctacaacgag and Lbu13a-C-R: taaCTCGAGgcctcgagtgcggccttagttctcggac; (4) PCR amplify the full-length gene fragment of LbuCas13a-V411T-N414K-V421T-loopplus (the gene sequence encoding LbuCas13a-V411T-N414K-V421T-loopplus is shown in SEQ ID NO:6, using the above 3 pcr products as templates), and the primers are: Lbu13a-N-F: taaCATATGgccatatggctagctggagcc and Lbu13a-C-R: taaCTCGAGgcctcgagtgcggccttagttctcggac.

[0029] The histidine tag sequence and SUMO tag sequence were successively introduced at the 5' end of the aforementioned LbuCas13a mutant genes (LbuCas13a-V411T-N414K-V421T and LbuCas13a-V411T-N414K-V421T-loopplus); the fusion genes were inserted into the prokaryotic expression vector pET-11a by restriction endonucleases Nde1 and BamH1. The recombinant plasmids were named pET-11a-LbuCas13a-V411T-N414K-V421T and pET-11a-LbuCas13a-V411T-N414K-V421T-loopplus (as Figure 3 shown), and the nucleotide sequences of pET-11a-LbuCas13a-V411T-N414K-V421T, pET-11a-LbuCas13a-V411T-N414K-V421T-loopplus, and pET-11a-LbuCas13a-wt are shown in SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.

[0030] Example 4 Transformation and Fermentation Culture of Recombinant Expression Plasmids The mutant recombinant plasmid wild type (LbuCas13a-WT) and mutants were transformed into Escherichia coli BL21(DE3) cells using the heat shock method, and the transformed cells were spread on LB plates containing ampicillin and cultured overnight at 37°C. Transformed clones were picked to prepare fermentation seed liquor, and the seed liquor was inoculated into the auto-induction medium at a ratio of 1:50. After culturing on a shaker at 37°C for 3 hours, the temperature was reduced to 16°C and continued to be cultured on a shaker for 24 hours. The specific method refers to: Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005 May;41(1):207-34.

[0031] Example 5 Collection of Cultured Cells, Cell Disruption and Protein Purification After fermentation, the cells were collected by centrifugation at 5000 - 8000 rpm for 10 minutes at 4°C. The cells were disrupted using an ultrasonic cell disruptor or a high-pressure homogenizer in an ice bath. The disrupted cell suspension was centrifuged at 12000 rpm for 30 minutes to remove cell debris. The supernatant was collected for subsequent protein purification. The nickel column was equilibrated with a buffer containing low-concentration imidazole. The supernatant was loaded onto the nickel column to allow the histidine-tagged protein to bind to nickel ions. Gradient elution was performed using buffers containing different concentrations of imidazole to collect the target protein. The purified fusion protein was dialyzed in a solution with pH 8, and an appropriate amount of SUMO protease was added for reaction, and digestion was carried out at 4°C for 24 hours. After digestion was completed, the LbuCas13a protein after excision of the SUMO tag was separated by passing through the nickel column again (as Figure 4 shown). The purified recombinant protein was concentrated to 0.25 mg / ml and aliquoted and stored frozen at -80°C.

[0032] Example 6 Determination of the enzyme activity of LbuCas13a and its mutants Preparation of ORF7a_crRNA. Primers ORF7a-F (TAATACGACTCACTATAGGGGACCACCCCAAAAATGAAGGGGACTAAAACTGCCC) and ORF7a-R (GAGCTATACCACTATCAAGAATGTGTAAGGGGCAGTTTTAGTCCCCTTCATTTTT) containing the T7 promoter were synthesized. The above two primers were annealed and extended in PCR to form a double-stranded DNA template for transcribing ORF7a_crRNA. Using the double-stranded DNA as a template, in vitro transcription was carried out using the T7 Quick High Yield RNA Transcription Kit (R7016S, Beyotime, Shanghai). Transcription reaction system (20 μL): 2 μL of T7 Reaction Buffer (10X), 2 μL of T7 RNA Polymerase, 1.6 μL of NTP Mix, 1 μg of DNA template, and RNase-free ddH2O was used to make up the system to 20 μL. The obtained ORF7a_crRNA sequence was: GGGGACCACCCCAAAAAUGAAGGGGACTAAAACTGCCCCUUACACAUUCUUGAUAGUGGUAUAGCUC, and the concentration measured by Nanodrop was 100 ng / μl (adjusted to this concentration by adding RNase-free ddH2O).

[0033] Preparation of Target RNA. Using the pET-11a-ORF7a plasmid stored in the laboratory as a template (the ORF7a gene in this plasmid is under the T7 promoter), in vitro transcription was carried out using the T7 Quick High Yield RNA Transcription Kit (R7016S, Beyotime, Shanghai). Transcription reaction system (20 μL): 2 μL of T7 Reaction Buffer (10X), 2 μL of T7RNA Polymerase, 1.6 μL of NTP Mix, 1 μg of DNA template, and RNase-free ddH2O was used to make up the system to 20 μL. The concentration of the target RNA obtained by Nanodrop measurement was 100 ng / μl (adjusted to this concentration with RNase-free ddH2O).

[0034] The substrate was: FAM-UUUUUU-BHQ1.

[0035] Cas13a 2.5 cleavage buffer (10x): 200 mM HEPES, pH 7.0, 500 mM KCl, 50 mM MgCl2, 50% glycerol.

[0036] The CRISPR-LbuCas13a detection system was as follows: 2 μl of LbuCas13a or mutant; 2 μl of crRNA (100 ng / μl); 2 μl of Target RNA (100 ng / μl); 2 μl of Reporter (20 μM); 2 μl of Rnaseinhibitor RNase Inhibitor (R0102-2kU, Beyotime, Shanghai); RNase-free ddH2O.

[0037] After mixing, it was placed in a LightCycler 96 real-time fluorescence quantitative PCR instrument for fluorescence detection. Incubate at 37 °C for 60 min, select the FAM channel, the excitation light wavelength is 490 nm, the emission light wavelength is 520 nm, and the fluorescence signal was collected every 2 min to monitor the change of fluorescence intensity in real time (as Figure 5 shown), by Figure 5It can be seen that the activity of LbuCas13a-V411T-N414K-V421T is increased by 36.7% compared with that of LbuCas13a-WT, the activity of LbuCas13a-V411T-N414K-V421T-loopplus is increased by 168.6% compared with that of LbuCas13a-WT, and the activity of LbuCas13a-V411T-N414K-V421T-loopplus is increased by 96.4% compared with that of LbuCas13a-V411T-N414K-V421T.

[0038] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the patent protection scope of the present invention.

Claims

1. An engineered LbuCas13a protein, characterized in that, The modification includes introducing the following mutations into the hairpin loop responsible for binding to the substrate RNA near the active center of the LbuCas13a nuclease: V411T, N414K, and V421T. The amino acid sequence of the modified protein is shown in SEQ ID NO:

1.

2. The modified LbuCas13a protein according to claim 1, wherein The modification also includes designing a double-loop structure in the region of amino acid sequence 407-424. The double-loop structure is connected between N413 and N414 through a flexible structure. The amino acid sequence of the modified protein after the double-loop structure design is shown in SEQ ID NO:

5.

3. A nucleic acid molecule encoding the modified LbuCas13a protein as claimed in claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

6.

4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleic acid molecule as described in claim 3.

5. The recombinant expression vector according to claim 4, wherein The nucleic acid molecule carries the coding sequences of a histidine tag and a SUMO tag.

6. The recombinant expression vector according to claim 5, wherein, The vector is the prokaryotic expression vector pET-11a.

7. The recombinant expression vector according to claim 6, wherein The vector contains a nucleic acid sequence encoding a single-stranded guide RNA capable of being used in combination with the modified LbuCas13a protein. The single-stranded guide RNA contains a scaffold sequence and a CRISPR spacer sequence.

8. A host cell, characterized in that, The host cell includes the recombinant expression vector as described in any one of claims 4 to 7.

9. A method for preparing the modified LbuCas13a protein according to any one of claims 1 to 2, characterized in that, It includes the following steps: S1. Transform the recombinant expression vector into Escherichia coli BL21(DE3) cells, spread the transformed cells on a plate, and culture overnight to obtain transformed clones. S2. Prepare a fermentation seed solution from the transformed clones, transfer the seed solution into a self-inducing medium, culture it in a shaker, ferment, centrifuge, and lyse the cells, and purify the tagged protein by chromatography. S3. Remove the tag and then purify it a second time to obtain the target protein.

10. A CRISPR-Cas13a gene editing system, characterized in that, It contains the modified LbuCas13a protein as described in any one of claims 1 to 2, a specific crRNA, and a target gene.

11. Use of a gene editing system as described in claim 10, characterized in that, It is applied in gene editing breeding and drug research and development.

Images