A LbuCas13a modified protein and its editing system

Abstract

The present invention discloses a kind of LbuCas13a modified protein and its editing system, and its transformation is included in the introduction of the following mutations in the hairpin loop responsible for binding to substrate RNA near the LbuCas13a nuclease active center: V411T, N414K and V421T, and its mutation site is amino acid sequence 407-424 region, to enhance the electropositivity of the hairpin loop and the affinity with RNA. The present invention significantly enhances the binding ability of LbuCas13a to target RNA and collateral cleavage activity by carrying out directed point mutation and structural repetition design in conjunction with its substrate RNA hairpin loop, and experiments show that the enzyme activity of mutant LbuCas13a-V411T-N414K-V421T is improved by 36.7% compared with wild type, and the LbuCas13a-V411T-N414K-V421T-loopplus activity of repeated design is improved by 168.6%. This technology is of great significance to the use of LbuCas13a for molecular diagnosis, rapid screening of pathogens and public health monitoring.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing and molecular diagnosis, and in particular to an LbuCas13a modified protein and a CRISPR / LbuCas13a gene editing system of the modified protein. Background Art

[0002] The CRISPR-Cas13a system is an adaptive immune system widely found in prokaryotes, used to defend against the invasion of foreign nucleic acids. Among them, Cas13a protein, as an important member of the CRISPR-Cas system, has RNA targeting cleavage activity and has shown great application potential in biotechnology and medical fields, especially in RNA editing and detection. For example, the SHERLOCK system developed by Zhang Feng's team uses Cas13a to detect RNA viruses. However, existing technologies mostly focus on Leptotrichia wadei LwaCas13a from the source, not involved in more sensitive nucleic acid detection Leptotrichia buccalis Cas13a (LbuCas13a).

[0003] In order to improve the sensitivity of Cas13a detection, researchers have made many attempts. In the reported studies, Yang et al. introduced different RNA binding proteins into Leptotrichia wadei Cas13a (LwaCas13a) cleaves the loop near the active center, which greatly improves the detection sensitivity of LwaCas13a. However, this type of research is only carried out on LwaCas13a, and previous research reports have shown that Leptotrichia buccalis Cas13a (LbuCas13a) has a higher sensitivity in nucleic acid detection, making it a highly promising detection tool. However, currently, there are no reports or patents on optimizing LbuCas13a substrate binding and catalytic efficiency through protein engineering. Given the advantages of LbuCas13a and the current research gaps, developing targeted modification methods for LbuCas13a and applying them to the highly sensitive detection of RNA viruses has important scientific significance and practical application value. Summary of the Invention

[0004] The main purpose of the present invention is to propose a LbuCas13a modified protein and its editing system, aiming to provide a structural design method to improve the detection sensitivity of LbuCas13a, and to improve the substrate sensitivity of enzyme nucleic acid detection by the strategy of loop point mutation and repetition of the nuclease active center.

[0005] To achieve the above object, the present invention proposes a LbuCas13a modified protein, wherein the modification includes introducing the following mutations into the hairpin loop responsible for binding to the substrate RNA near the LbuCas13a nuclease active center: V411T, N414K and V421T, and the amino acid sequence of the modified protein is shown in SEQ ID NO: 1.

[0006] Preferably, the modification further includes designing a double loop structure in the amino acid sequence 407-424 region, wherein the double loop structure is connected between N413 and N414 through a flexible structure. The amino acid sequence of the modified protein after the double loop structure design is shown in SEQ ID NO: 5.

[0007] The present invention also provides a nucleic acid molecule encoding the LbuCas13a modified protein as described above, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:6.

[0008] The present invention also provides a recombinant expression vector comprising the nucleic acid molecule described above.

[0009] Preferably, the nucleic acid molecule carries a histidine tag and a SUMO tag coding sequence.

[0010] Preferably, the vector is the prokaryotic expression vector pET-11a.

[0011] Preferably, the vector comprises a nucleic acid sequence encoding a single-stranded guide RNA that can be used in conjunction with the LbuCas13a modified protein, and the single-stranded guide RNA comprises a scaffold sequence and a CRISPR spacer sequence.

[0012] The present invention also provides a host cell, which comprises the recombinant expression vector described above.

[0013] The present invention also proposes a method for preparing the LbuCas13a modified protein as described above, comprising the following steps:

[0014] S1. Transform the recombinant expression vector into Escherichia coli BL21 (DE3) cells, plate the transformed cells, and culture them overnight to obtain transformed clones;

[0015] S2. Preparing fermentation seed liquid from the transformed clones, transferring the seed liquid into an autoinduction medium for shaker culture, fermentation, centrifugation, and disruption, and chromatographic purification of the tagged protein;

[0016] S3. After removing the tag, secondary purification is performed to obtain the target protein.

[0017] Preferably, the fluorescently labeled RNA reporter molecule is FAM-UUUUUU-BHQ1.

[0018] The present invention also proposes a gene editing system, wherein the CRISPR-Cas13a gene editing system comprises the LbuCas13a modified protein as described above, a specific crRNA and a target gene.

[0019] The present invention also proposes an application of the above gene editing system, which is applied in gene editing breeding and drug research and development.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) In the technical solution provided by the present invention, the design of the LbuCas13a active center loop is the core. The hydrophobic amino acids on the loop responsible for binding to the substrate RNA near the active center of the LbuCas13a paralogous nuclease are mutated into polar or basic amino acids. The hydrophobic residues (V411, V421) in the substrate binding hairpin loop (407-424) are replaced with polar residues (T), and N414 is replaced with a positively charged lysine (K). Through these mutations, the local positive charge is increased, which can enhance the electrostatic interaction with the negatively charged RNA. The introduction of amino acid residue point mutations on the loop improves the electropositivity and polarity of the probe RNA binding loop. In this way, the recognition and binding ability of LbuCas13a to the substrate RNA is enhanced, thereby improving its cleavage efficiency and specificity.

[0022] (2) The present invention inserts a repeating loop structure based on the mutation and adds the flexible peptide GGGGS at its amino and carboxyl ends respectively. The substrate capture efficiency is improved through the synergistic effect of the dual binding sites, while the flexible linker is used to maintain the structural stability.

[0023] (3) The present invention significantly enhances the binding ability of LbuCas13a to target RNA and its paralogous cleavage activity by performing targeted point mutagenesis and structural repetitive design on its substrate RNA binding hairpin loop. Experiments show that the enzyme activity of the mutant LbuCas13a-V411T-N414K-V421T is 36.7% higher than that of the wild type, while the activity of the repetitively designed LbuCas13a-V411T-N414K-V421T-loopplus is increased by 168.6%. This technology is of great significance for the application of LbuCas13a in molecular diagnosis, rapid screening of pathogens and public health monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The design diagram of the loop mutant on the LbuCas13a substrate RNA probe binding groove in Example 1 provided by the present invention, Figure (A) is a LbuCas13a wild-type protein band model, Figure (B) is a mutant V411T-N414K-V421T protein band model, Figure (C) is a LbuCas13a wild-type protein surface charge display model (red is electronegative, blue is electropositive), and Figure (D) is a mutant V411T-N414K-V421T protein surface charge display model;

[0026] Figure 2 The repeated design of the LbuCas13a substrate RNA probe loop mutant in Example 2 provided by the present invention, Figure (A) is a protein strip model, and Figure (B) is a protein surface charge display model (red is electronegative and blue is electropositive);

[0027] Figure 3 This is the construction process of the recombinant expression vector in Example 3 provided by the present invention;

[0028] Figure 4The expression and purification diagram of the wild type and mutant LbuCas13a in Example 5 provided by the present invention, 1 and 8 are protein markers; 2 is the eluate after LbuCas13a-WT nickel column purification, 3 is the protein after the LbuCas13a-WT eluted protein is dialyzed into SUMO protease cleavage buffer, 4 is LbuCas13a-WT after SUMO protease cleavage for 12 h, 5 is dialyzed into the nickel column purification equilibrium solution after cleavage, 6 is the column fluid of the second nickel column purification (final purified LbuCas13a-WT, 138.5 kDa); 7 is the uncleaved protein and miscellaneous protein bound to the nickel column during the second nickel column purification, 9 is the eluate after LbuCas13a-V411T-N414K-V421T nickel column purification, 10 is the protein after the LbuCas13a-V411T-N414K-V421T eluted protein is dialyzed into SUMO protease cleavage buffer, 11 is the protein after SUMO protease cleavage 12 h after purification, 12 is the flow-through of the second nickel column purification (final purified LbuCas13a-V411T-N414K-V421T, 138.5 kDa), 13 is the uncleaved protein and impurity protein bound to the nickel column during the second nickel column purification, 14 is the eluate after LbuCas13a-V411T-N414K-V421T-loopplus nickel column purification, 15 is the protein after the eluted protein of LbuCas13a-V411T-N414K-V421T-loopplus was dialyzed into SUMO protease cleavage buffer, and 16 is the protein after SUMO protease cleavage of 12. h after LbuCas13a-V411T-N414K-V421T-loopplus, 17 is the flow-through of the second nickel column purification (final purified LbuCas13a-V411T-N414K-V421T-loopplus, 140.5 kDa), 18 is the uncleaved protein and impurity proteins bound to the nickel column during the second nickel column purification;

[0029] Figure 5 The LbuCas13a in Example 6 provided by the present invention detects the coronavirus ORF7a gene map. Figure (A) is a graph showing the change in fluorescence intensity over time (the signal is collected every two minutes), and Figure (B) shows the fluorescence after background removal, showing the paralogous nuclease activity of LbuCas13a-WT, LbuCas13a-V411T-N414K-V421T, and LbuCas13a-V411T-N414K-V421T-loopplus.

[0030] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below through specific preferred embodiments, but the present invention is not limited to the following embodiments.

[0032] It should be noted that, unless otherwise specified, all chemical reagents involved in the present invention were purchased through commercial channels.

[0033] Example 1 Design of LbuCas13a active center loop mutant

[0034] According to the analysis of the solved LbuCas13a crystal structure (PDB: 5XWY), it was determined that the hydrophobic amino acids on the mutated paralogous cleavage active center substrate RNA binding loop (407-424) were polar or basic amino acids, which is beneficial to increase the strength of the loop binding to RNA. The specific mutation is to introduce point mutations of three amino acid residues on the loop, namely V411T, N414K and V421T (the amino acid sequence of the LbuCas13a protein after mutation is shown in SEQ ID NO: 1). The three-dimensional structure simulation of the mutated loop was performed using the SWISS-MODEL program, confirming that the mutation of Val411 to Thr will not cause changes in the secondary structure of the loop; the mutation of Asn414 to Lys can enhance the electropositivity of the loop (such as Figure 1 The design was named LbuCas13a-V411T-N414K-V421T.

[0035] Example 2 Repeated design of the hairpin loop in the active center of LbuCas13a

[0036] Based on three-dimensional structural analysis, the specific location of the mutant loop was determined. The amino acid residues Arg407 and Glu424 at the beginning and end of the hairpin loop are spatially separated by 6.5 Å (α carbon atom). The main structure of the mutant loop (R405-E424) was determined to be inserted between N413 and N414 at the loop tip. The flexible peptide GGGGS was added to the amino and carboxyl ends of the aforementioned mutant loop to ensure that both loops could basically maintain their original spatial structure (such as Figure 2 The design was named LbuCas13a-V411T-N414K-V421T-loopplus (its amino acid sequence is shown in SEQ ID NO: 5).

[0037] Example 3 Construction of a recombinant expression vector for LbuCas13a mutants

[0038] The LbuCas13a-V411T-N414K-V421T mutant gene was obtained by PCR amplification. The specific operation process is as follows. First, PCR amplification of the gene fragment at the 5' end of the mutation region, the primers are: Lbu13a-NF: taaCATATGgccatatggctagctggagcc and 411-414-421MU-R: cgccagaGGTgtacttctcctcgcccttTttgttcttGGTggtcttgccg; Secondly, PCR amplification of the gene fragment at the 3' end of the mutation region, the primers are: 411-414-421MU-F: cggcaagaccACCaagaacaaAaagggcgaggagaagtacACCtctggcg and Lbu13a-CR: taaCTCGAGgcctcgagtgcggccttagttctcggac; finally, PCR amplified the full-length gene fragment of LbuCas13a-V411T-N414K-V421T (using the above two PCR products as templates), the primers were: Lbu13a-NF: taaCATATGgccatatggctagctggagcc and Lbu13a-CR: taaCTCGAGgcctcgagtgcggccttagttctcggac.

[0039] A gene fragment encoding the loop (407-424) (SEQ ID NO: 7: Agaaatatcctggagacagaaaacgagaatgacatcacaggcaggatgcgcggcaagaccgtgaagaacggcggcggcggcagccgcggcaagaccgtgaagaacaataagggcgaggagaagtacgtgtctggcgagggcggcggcggcagcaataagggcgaggagaagtacgtgtctggcgaggtggataagatctacaacgagaacaagaagaatgaggtg) was obtained by gene synthesis and inserted between N413 and N414 by overlapping PCR. The specific operation process is as follows. (1) PCR amplification of the Loopplus gene fragment, primers are: Loopplus-F: agaaatatcctggagacagaaaac and Loopplus-R: cacctcattcttcttgttctcgtt; (2) PCR amplification of the gene fragment at the 5' end of the Loop, primers are: Lbu13a-NF: taaCATATGgccatatggctagctggagcc and loopplus-NR: gcctgtgatgtcattctcgttttc; (3) PCR amplification of the gene fragment at the 3' end of the Loop, primers are: loopplus-CF: gtggataagatctacaacgag and Lbu13a-CR: taaCTCGAGgcctcgagtgcggccttagttctcggac; (4) PCR amplification of the full-length gene fragment of LbuCas13a-V411T-N414K-V421T-loopplus (the gene sequence encoding LbuCas13a-V411T-N414K-V421T-loopplus is shown in SEQ ID NO:6, with the above three PCR products as templates), primers are: Lbu13a-NF: taaCATATGgccatatggctagctggagcc and Lbu13a-CR: taaCTCGAGgcctcgagtgcggccttagttctcggac.

[0040] A histidine tag sequence and a SUMO tag sequence were sequentially introduced into the 5' end of the aforementioned LbuCas13a mutant genes (LbuCas13a-V411T-N414K-V421T and LbuCas13a-V411T-N414K-V421T-loopplus); the fusion genes were inserted into the prokaryotic expression vector pET-11a by restriction endonucleases Nde1 and BamH1. The recombinant plasmids were named: pET-11a-LbuCas13a-V411T-N414K-V421T and pET-11a-LbuCas13a-V411T-N414K-V421T-loopplus (as Figure 3 The nucleotide sequences of pET-11a-LbuCas13a-V411T-N414K-V421T, pET-11a-LbuCas13a-V411T-N414K-V421T-loopplus, and pET-11a-LbuCas13a-wt are shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0041] Example 4 Recombinant expression plasmid transformation and fermentation culture

[0042] The mutant recombinant plasmid wild type (LbuCas13a-WT) and mutant were transformed into Escherichia coli BL21 (DE3) cells using the heat shock method. The transformed cells were plated onto LB plates containing ampicillin and cultured at 37°C overnight. Transformed clones were picked to prepare fermentation seed liquid. The seed liquid was added to the autoinduction medium at a ratio of 1:50. After shaking culture at 37°C for 3 hours, the temperature was lowered to 16°C and the shaking culture was continued for 24 hours. For specific methods, please refer to: Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005 May;41(1):207-34.

[0043] Example 5: Collecting cultured cells, disrupting cells and purifying proteins

[0044] After the fermentation is completed, collect the cells by centrifugation at 5000-8000 rpm for 10 minutes at 4°C. Use an ultrasonic disruptor or a high-pressure homogenizer to break the cells in an ice bath. Centrifuge the broken cell suspension at 12000 rpm for 30 minutes to remove cell debris. Collect the supernatant for subsequent protein purification. Use a buffer containing a low concentration of imidazole to equilibrate the nickel column. Load the supernatant onto the nickel column to allow the histidine-tagged protein to bind to the nickel ions. Use a buffer containing different concentrations of imidazole for gradient elution to collect the target protein. The purified fusion protein was dialyzed in a solution of pH 8, and an appropriate amount of SUMO protease was added for reaction. Enzyme digestion was performed at 4°C for 24 hours. After the enzyme digestion is completed, the LbuCas13a protein (such as Figure 4 The purified recombinant protein was concentrated to 0.25 mg / ml and stored in aliquots at -80°C.

[0045] Example 6 LbuCas13a and its mutant enzyme activity assay

[0046] Preparation of ORF7a_crRNA. Primers ORF7a-F (TAATACGACTCACTATAGGGGACCACCCCAAAAATGAAGGGGACTAAAACTGCCC) and ORF7a-R (GAGCTATACCACTATCAAGAATGTGTAAGGGGCAGTTTTAGTCCCCTTCATTTTT) containing the T7 promoter were synthesized. These two primers were annealed and extended in PCR to form a double-stranded DNA template for transcription of ORF7a_crRNA. In vitro transcription was performed using the T7 Quick High Yield RNA Transcription Kit (Shanghai Biotech R7016S) using the double-stranded DNA as a template. Transcription reaction system (20 μL): T7 Reaction Buffer (10X) 2 μL, T7 RNA Polymerase 2 μL, NTP Mix 1.6 μL, DNA template 1 μg, RNase-free ddH2O to make up the system to 20 μL. The obtained ORF7a_crRNA sequence is: GGGGACCACCCCAAAAAUGAAGGGGACTAAAACTGCCCCUUACACAUUCUUGAUAGUGGUAUAGCUC, and the Nanodrop determination concentration is 100 ng / μL (adjusted to this concentration by adding RNase-free ddH2O).

[0047] Preparation of target RNA. Using a laboratory-stored pET-11a-ORF7a plasmid (in which the ORF7a gene is under the T7 promoter) as a template, in vitro transcription was performed using the T7 Quick High Yield RNA Transcription Kit (Shanghai Biyuntian R7016S). The transcription reaction system (20 μL) consisted of 2 μL of T7 Reaction Buffer (10X), 2 μL of T7 RNA Polymerase, 1.6 μL of NTP Mix, 1 μg of DNA template, and RNase-free ddH2O to make up the total volume to 20 μL. The target RNA concentration, as determined by Nanodrop assay, was 100 ng / μL (adjusted to this concentration by adding RNase-free ddH2O).

[0048] The substrate is: FAM-UUUUUU-BHQ1.

[0049] Cas13a 2.5 cleavage buffer (10x): 200 mM HEPES, pH 7.0, 500 mM KCl, 50mM MgCl2, 50% glycerol.

[0050] The CRISPR-LbuCas13a detection system is as follows: 2 μl LbuCas13a or mutant; 2 μl crRNA (100 ng / μl); 2 μl target RNA (100 ng / μl); 2 μl reporter (20 μM); 2 μl RNase inhibitor RNase Inhibitor (Shanghai Biyuntian R0102-2kU); RNase-free ddH2O.

[0051] After mixing, place the mixture in a LightCycler 96 real-time fluorescence quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, select the FAM channel, set the excitation wavelength to 490 nm, and the emission wavelength to 520 nm. Collect the fluorescence signal every 2 minutes and monitor the fluorescence intensity changes in real time (e.g. Figure 5 ), by Figure 5It can be seen that the activity of LbuCas13a-V411T-N414K-V421T is 36.7% higher than that of LbuCas13a-WT, the activity of LbuCas13a-V411T-N414K-V421T-loopplus is 168.6% higher than that of LbuCas13a-WT, and the activity of LbuCas13a-V411T-N414K-V421T-loopplus is 96.4% higher than that of LbuCas13a-V411T-N414K-V421T.

[0052] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A LbuCas13a modified protein, characterized in that The modification includes introducing the following mutations into the hairpin loop responsible for binding to the substrate RNA near the active center of the LbuCas13a nuclease: V411T, N414K and V421T. The amino acid sequence of the modified protein is shown in SEQ ID NO:

1.

2. The LbuCas13a engineered protein according to claim 1, wherein The modification also includes designing a double loop structure in the amino acid sequence 407-424 region, wherein the double loop structure is connected between N413 and N414 via a flexible structure. The amino acid sequence of the modified protein after the double loop structure design is shown in SEQ ID NO:

5.

3. A nucleic acid molecule encoding the LbuCas13a modified protein as claimed in claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

6.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid molecule according to claim 3.

5. The recombinant expression vector according to claim 4, characterized in that The nucleic acid molecule carries a histidine tag and a SUMO tag coding sequence.

6. The recombinant expression vector according to claim 5, characterized in that The vector is a prokaryotic expression vector pET-11a.

7. The recombinant expression vector according to claim 6, characterized in that The vector comprises a nucleic acid sequence encoding a single-stranded guide RNA that can be used in conjunction with the LbuCas13a modified protein, and the single-stranded guide RNA comprises a scaffold sequence and a CRISPR spacer sequence.

8. A host cell, characterized in that The host cell comprises the recombinant expression vector according to any one of claims 4 to 7.

9. A method for preparing the LbuCas13a modified protein according to any one of claims 1 to 2, characterized in that The following steps are involved: S1. Transform the recombinant expression vector into Escherichia coli BL21 (DE3) cells, plate the transformed cells, and culture them overnight to obtain transformed clones; S2. Preparing fermentation seed liquid from the transformed clones, transferring the seed liquid into an autoinduction medium for shaker culture, fermentation, centrifugation, and disruption, and chromatographic purification of the tagged protein; S3. After removing the tag, secondary purification is performed to obtain the target protein.

10. A CRISPR-Cas13a gene editing system, characterized in that Comprising the LbuCas13a modified protein according to any one of claims 1 to 2, a specific crRNA and a target gene.

Images