Target section and double-stranded RNA for preventing and controlling propagation of tomato brown crinkled fruit virus through tomato seeds and application of target section and double-stranded RNA

Abstract

The invention discloses a target segment and double-stranded RNA for preventing and controlling propagation of tomato brown crinkled fruit virus through tomato seeds and application of the target segment and the double-stranded RNA. Wherein the nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or a sequence which is as shown in SEQ ID NO.3, has at least 90% of homology and has coded amino acid as shown in SEQ ID NO.4 is substituted. The invention further discloses double-stranded RNA of the target interference target section, the double-stranded RNA is used for single isolation treatment or batch treatment of germinated tomato seeds, and the infection rate of the tomato brown crinkled fruit virus on germinated tomato seedlings can be effectively reduced under the condition that the germination rate of the tomato seeds is not affected. The method for preventing and controlling propagation of the tomato brown crinkled fruit virus through the tomato seeds by using the double-stranded RNA is safe and harmless, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biological control, and particularly relates to a target segment, double-stranded RNA for preventing and controlling the transmission of tomato brown rugose fruit virus through tomato seeds, and applications thereof. Background Art

[0002] Tomato brown rugose fruit virus (ToBRFV) was included in the List of Plant Quarantine Pests Subject to Inspection for Entry into the People's Republic of China by the Ministry of Agriculture and Rural Affairs of China in 2021. Its natural hosts in the field are mainly tomatoes and peppers, and it is an important quarantine plant virus. After the virus infects tomatoes, the main symptoms are mosaic, dark green protrusions, narrow leaves, yellowing of leaf veins, etc. on the leaves of infected plants, necrosis in severe cases, while yellow or brown patches appear on the fruits, the fruits become smaller and wrinkled, and fruit stalk necrosis occurs in severe cases, and the number of flowers and fruits decreases. The virus is widely distributed and seriously harmful in the field, but currently there is a lack of effective virus prevention and control means and no effective disease-resistant varieties.

[0003] ToBRFV belongs to the genus Tobamovirus of the family Virgaviridae. The virus genome consists of a single-stranded positive-sense RNA molecule containing about 6,400 nucleotides, and contains 4 open reading frames (ORFs). Among them, open reading frame 1 (ORF1) encodes a 126 kDa protein, open reading frame 2 (ORF2) and ORF1 jointly encode an 186 kDa protein (P183) through a readthrough protein. This protein contains an RNA-dependent RNA polymerase domain (RdRP) at the C-terminus. Open reading frame 3 (ORF3) encodes a movement protein of about 30 kDa, and open reading frame 4 (ORF4) encodes a coat protein with a size of about 17.5 kDa.

[0004] Since the virus particles of ToBRFV are very stable and easy to infect, the transmission methods are diverse. Currently known transmission methods include contact transmission, seed transmission, soil and water body transmission, host transmission such as weeds, and insect transmission, etc. Among them, seed transmission is the main way for the long-distance transmission of the virus. Under laboratory conditions, 100% of the seeds harvested from virus-infected fruits carry the virus, and the virus-carrying rate of germinated seedlings can be as high as 30%-50%. Therefore, currently, more than 20 countries (or regions) including China, Australia, New Zealand, and the United States have issued control measures for this virus, requiring the detection of ToBRFV in tomato and pepper seeds.

[0005] RNA interference (RNAi) is a highly conserved biological mechanism in eukaryotes. It induces post-transcriptional gene silencing (PTGS) through double-stranded RNA (dsRNA) and is currently recognized as the most important antiviral innate immune mechanism. Activating the organism's own RNAi antiviral immune mechanism by the method of exogenous application of double-stranded RNA has important application prospects in the precise prevention and control of diseases. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a target segment, double-stranded RNA and its application for preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds. The present invention selects the C-terminal region of the P183 protein of Tomato brown rugose fruit virus as the target segment, and uses RNAi technology to target and interfere with this target segment by exogenous use of double-stranded RNA, so as to reduce the virus-carrying rate of tomato seedlings after tomato seed germination, and achieve the purpose of preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a target segment for preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds. The nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or a sequence with at least 90% homology to the sequence shown in SEQ ID NO.3 after substitution and encoding an amino acid as shown in SEQ ID NO.4.

[0009] The second aspect of the present invention provides a double-stranded RNA that targets and interferes with the above target segment. The double-stranded RNA is synthesized by using SEQ ID NO.5 and SEQ ID NO.6 as primers, amplifying with the target segment as a template, and then using in vitro transcription.

[0010] Preferably, the double-stranded RNA is composed of the nucleotide sequence shown in SEQ ID NO.7 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.7.

[0011] The third aspect of the present invention provides an application of the above double-stranded RNA in preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds.

[0012] Preferably, the prevention and control of the transmission of Tomato brown rugose fruit virus through tomato seeds includes reducing the infection rate of Tomato brown rugose fruit virus on germinated tomato seedlings without affecting the germination rate of tomato seeds.

[0013] The fourth aspect of the present invention provides a biological drug for preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds. The active ingredient of the biological drug contains at least the above double-stranded RNA.

[0014] The fifth aspect of the present invention provides a method for preventing and controlling the transmission of Tomato brown rugose fruit virus through tomato seeds. By targeting and interfering with the above-mentioned target segment, the infection rate of Tomato brown rugose fruit virus on germinated tomato seedlings can be reduced without affecting the germination rate of tomato seeds.

[0015] Preferably, the method is to treat germinating tomato seeds with a solution containing the above double-stranded RNA or the above biological drug.

[0016] Preferably, the treatment of germinating tomato seeds includes single-seed isolation treatment and / or batch treatment of germinating tomato seeds.

[0017] The beneficial effects of the present invention are as follows: The present invention provides a target segment that can effectively prevent and control the transmission of Tomato brown rugose fruit virus through tomato seeds, and double-stranded RNA of this target segment. After treating tomato seeds with double-stranded RNA, the virus-carrying rate of tomato seedlings after germination can be effectively reduced. The present invention innovatively applies double-stranded RNA to tomato seeds to cut off the seed transmission route of the virus. This method is safe, efficient, and harmless, providing a new way for the biological prevention and control of Tomato brown rugose fruit virus. Description of the Drawings

[0018] In order to make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0019] Figure 1 It is a schematic diagram of the genomic location of the target segment in ToBRFV in the embodiment of the present invention;

[0020] Figure 2 It is an agarose gel electrophoresis detection diagram of the double-stranded RNA of the synthesized target segment in the embodiment of the present invention;

[0021] Figure 3 It is a detection result diagram of the germination situation and virus-carrying rate after germination of tomato seeds treated with double-stranded RNA single-seed (A: Germination situation of tomato seeds treated with double-stranded RNA single-seed; B: Statistical chart of germination rate; C: Statistical chart of virus-carrying rate detection of seedlings after germination; among them, dsGFP represents double-stranded RNA of GFP, and ds183 represents double-stranded RNA of the target segment). Detailed Embodiments

[0022] In order to make the objectives and technical solutions of the present invention clearer and more complete, the present invention will be further described in detail below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Those skilled in the art who make modifications or equivalent replacements on the basis of understanding the technical solutions of the present invention, without departing from the spirit and scope of the technical solutions of the present invention, fall within the scope of protection of the present invention.

[0023] Unless otherwise specified, the reagents and materials involved in the embodiments of the present invention are commercially available products and can all be obtained through commercial channels. The various processes and methods not described in detail in the embodiments of the present invention are conventional methods well known in the art.

[0024] Term Explanation:

[0025] EPPO PM 7 / 146(1): It is the diagnostic protocol standard for Tomato brown rugose fruit virus issued by the European and Mediterranean Plant Protection Organization (EPPO).

[0026] Example 1 Cloning of Target Region and Synthesis of Double-stranded RNA

[0027] It should be noted that as Figure 1 shown, the target region in this example is located in the C-terminal region of the P183 protein. Total RNA was extracted from frozen diseased tomato leaves infected with ToBRFV, and 1 μg of total RNA was reverse transcribed into cDNA. The reverse transcription system was 10 μL. The cDNA reaction solution was diluted 10-fold (9.8 μL was diluted into 89.2 μL of double-distilled water) as a template. Through specific primers ToBRFV-P183-F (SEQ ID NO.1) and ToBRFV-P183-R (SEQ ID NO.2), a specific target region was amplified by polymerase chain reaction (PCR). The primer sequences are as follows:

[0028] ToBRFV-P183-F: GTTGCAGCACCAAAGACTGG (SEQ ID NO.1);

[0029] ToBRFV-P183-R: GCACAGTGGAACTCGTTCTG (SEQ ID NO.2).

[0030] After that, the amplified product was ligated onto the pMD-19T vector, replicated and screened, and sequenced. The nucleotide sequence is as shown in SEQ ID NO.3, and the encoded amino acid sequence is as shown in SEQ ID NO.4. The cloned plasmid with correct sequencing was extracted and stored at -20 °C for later use.

[0031] GTTGCAGCACCAAAGACTGGAGATATCTCAGATATGCAATTTTACTATGATAAGTGTCTCCCAGGTAATAGCACCATGTTAAATAACTATGATGCTGTTACCATGAGGTTGACTGACATTTCTCTTAATGTCAAAGATTGCATATTGGATTTCTCTAAGTCTGTGGCTGCACCGAAGGATCCGATCAAACCACTGATTCCGATGGTACGAACGGCGGCAGAAATGCCACGCCAGACTGGACTATTGGAAAATTTGGTGGCGATGATCAAAAGAAACTTTAATTCACCGGAGTTATCAGGAATAATCGACATTGAGAATACTGCATCTTTAGTAGTAGATAAATTTTTTGATAGTTACTTGCTTAAAGAAAAAAGAAAACCAAATAAAAATGTTTCTTTATTTTGTAGAGAGTCTCTCAATAGATGGTTAGAGAAGCAGGAGCAAGTGACCATTGGTCAGCTTGCAGATTTTGATTTTGTGGATCTTCCTGCCGTTGATCAGTACAGGCATATGATTAAAGCGCAACCTAAGCAGAAGCTGGATACATCAATTCAAAGCGAATATCCGGCCTTGCAGACGATTGTGTATCATTCGAAAAAGATCAACGCAATCTTCGGTCCTTTGTTCAGTGAGCTCACAAGGCAAATGCTCGAAAGCATAGACTCAAGTAAGTTTTTGTTCTTTACAAGGAAGACGCCAGCTCAAATTGAGGATTTCTTCGGAGATCTCGATAGCCATGTCCCTATGGATATCTTGGAGTTGGATATTTCGAAGTATGACAAATCTCAGAACGAGTTCCACTGTGC(SEQ ID NO.3)

[0032] VAAPKTGDISDMQFYYDKCLPGNSTMLNNYDAVTMRLTDISLNVKDCILDFSKSVAAPKDPIKPLIPMVRTAAEMPRQTGLLENLVAMIKRNFNSPELSGIIDIENTASLVVDKFFDSYLLKEKRKPNKNVSLFCRESLNRWLEKQEQVTIGQLADFDFVDLPAVDQYRHMIKAQPKQKLDTSIQSEYPALQTIVYHSKKINAIFGPLFSELTRQMLESIDSSKFLFFTRKTPAQIEDFFGDLDSHVPMDILELDISKYDKSQNEFHC(SEQ ID NO.4)

[0033] Using the pMD-19T plasmid containing the specific target segment as a template, PCR amplification was performed using the specific primers dsP183-F (SEQ ID NO.5) and dsP183-R (SEQ ID NO.6) with a T7 promoter at the N-terminus. Subsequently, using the PCR product with the T7 promoter as a template, double-stranded RNA was synthesized using the MEGAscript T7 in vitro transcription kit. The double-stranded RNA consists of two reverse complementary nucleotide sequences, and one of the nucleotide sequences is shown in SEQ ID NO.7. Meanwhile, double-stranded RNA of GFP (dsGFP) was synthesized as a control using the above method. The upstream primer of dsGFP with the T7 promoter was dsGFP-F (SEQ ID NO.8), the downstream primer sequence was dsGFP-R (SEQ ID NO.9), and the template was the DNA sequence of the green fluorescent protein GFP gene. The specific primer sequences are as follows:

[0034] dsP183-F: TAATACGACTCACTATAGGGCCACTGATTCCGATGGTACG(SEQ ID NO.5);

[0035] dsP183-R: TAATACGACTCACTATAGGGGTGAGCTCACTGAACAAAGG(SEQ ID NO.6).

[0036] dsGFP-F: TAATACGACTCACTATAGGGAGAACAAGTTCTCCGTTCCGGC(SEQ ID NO.8);

[0037] dsGFP-R: TAATACGACTCACTATAGGGAGATGGTTCCTTGATGCCGTTCT(SEQ ID NO.9).

[0038] Finally, the synthesized double-stranded RNA was detected using 1% agarose gel ( Figure 2 ), and it was found that the size was consistent with the expected target fragment, indicating that the double-stranded RNA (ds183) targeting the target segment was successfully synthesized in vitro and stored at -80 °C for later use. One of the nucleotide sequences of the synthesized double-stranded RNA is as follows:

[0039] CCACUGAUUCCGAUGGUACGAACGGCGGCAGAAAUGCCACGCCAGACUGGACUAUUGGAAAAUUUGGUGGCGAUGAUCAAAAGAAACUUUAAUUCACCGGAGUUAUCAGGAAUAAUCGACAUUGAGAAUACUGCAUCUUUAGUAGUAGAUAAAUUUUUUGAUAGUUACUUGCUUAAAGAAAAAAGAAAACCAAAUAAAAAUGUUUCUUUAUUUUGUAGAGAGUCUCUCAAUAGAUGGUUAGAGAAGCAGGAGCAAGUGACCAUUGGUCAGCUUGCAGAUUUUGAUUUUGUGGAUCUUCCUGCCGUUGAUCAGUACAGGCAUAUGAUUAAAGCGCAACCUAAGCAGAAGCUGGAUACAUCAAUUCAAAGCGAAUAUCCGGCCUUGCAGACGAUUGUGUAUCAUUCGAAAAAGAUCAACGCAAUCUUCGGUCCUUUGUUCAGUGAGCUCAC (SEQ ID NO.7)

[0040] Example 2 Treatment of germinating tomato seeds with single-particle isolation of double-stranded RNA

[0041] At room temperature, tomato seeds were soaked in water for one hour. Meanwhile, a 24-well plate was prepared, and filter paper was placed in each well. The filter paper was completely soaked with the double-stranded RNA solution synthesized in Example 1, and about 100 μL of the double-stranded RNA solution was used for each small well. After soaking, the seeds were blotted with absorbent paper to remove excess water and quickly placed on the filter paper soaked with the double-stranded RNA solution. The lid was covered to prevent water evaporation, and the seeds were placed in a warm and dark place for germination.

[0042] On the third day of germination, 50 μL of the double-stranded RNA solution was supplemented for each seed. The germination of the seeds was recorded on the 4th day of germination. The results showed that there was no significant difference between the treatment group and the control group ( Figure 3 A and B in

[0043] Example 3 Detection of virus-carrying rate after single-seed isolation germination of seeds

[0044] Using the tomato seedlings germinated in Example 2, on the 5th day after germination, the tomato seedlings were collected for quantitative detection of Tomato brown rugose fruit virus. The quantitative detection method used was the RT-qPCR (TaqMan method) recommended by the European Union (EPPO) PM 7 / 146(1). The specific primers used were:

[0045] CaTa28-F: GGTGGTGTCAGTGTCTGTTT (SEQ ID NO.10);

[0046] CaTa28-R: GCGTCCTTGGTAGTGATGTT (SEQ ID NO.11).

[0047] The results of virus quantitative detection showed that the virus-carrying rate of the tomato seedlings germinated from the double-stranded RNA treatment group (ds183 group) in the target region was significantly lower than that of the control group (dsGFP group) ( Figure 3 C in).

[0048] Example 4 Detection of the germination rate of tomato seeds and the virus-carrying rate of germinated seedlings by batch treatment with double-stranded RNA

[0049] At room temperature, the tomato seeds were soaked in water for one hour. At the same time, a petri dish with a diameter of about 12 cm was taken, lined with a filter paper with a diameter of 10 cm, and 4 ml of the double-stranded RNA solution synthesized in Example 1 was added to moisten the filter paper. 50 soaked seeds were taken, the excess water was blotted off with absorbent paper, and quickly spread out on the filter paper moistened with the double-stranded RNA solution so that each seed was in contact with the filter paper and there was no overlap between the seeds. The lid of the petri dish was covered to prevent water evaporation, and the petri dish was placed in a warm and dark place for germination. On the 3rd day of germination, about 2 ml of the double-stranded RNA solution was supplemented using a spray bottle.

[0050] On the 5th day of germination, the germination situation of each seed was recorded, and the germinated tomato seedlings were taken for virus quantitative detection. The detection method was the same as that in Example 3. The virus detection results showed that there was no significant difference in the germination rate between the tomato seeds (ds183 group) batch-treated with double-stranded RNA in the target region and the control group (dsGFP group), while the infection rate of ToBRFV in the germinated seedlings was significantly lower than that of the control group (Table 1).

[0051] Table 1 Detection of the germination and virus-carrying rates of tomato seeds batch-treated with double-stranded RNA

[0052]

[0053] It should be noted that the double-stranded RNA of the target segment involved in the embodiments of the present invention includes, but is not limited to, being able to inhibit the transmission of Tomato brown rugose fruit virus (ToBRFV) through tomato seeds, and also has varying degrees of inhibitory effects in other seed-borne species such as peppers.

Claims

1. A target segment for preventing and controlling the transmission of tomato brown wrinkled fruit virus through tomato seeds, characterized in that: The nucleotide sequence of the target segment is as shown in SEQ ID NO.3, or is substituted with a sequence having at least 90% homology with SEQ ID NO.3 and encoding an amino acid as shown in SEQ ID NO.

4.

2. The double-stranded RNA targeted to interfere with the target segment of claim 1, characterized in that: The double-stranded RNA is synthesized by in vitro transcription using SEQ ID NO.5 and SEQ ID NO.6 as primers and the target segment as a template for amplification.

3. The double-stranded RNA according to claim 2, characterized in that The double-stranded RNA consists of the nucleotide sequence shown in SEQ ID NO.7 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.

7.

4. Use of the double-stranded RNA according to any one of claims 2 to 3 in preventing and controlling the spread of tomato brown wrinkled fruit virus through tomato seeds.

5. The use according to claim 4, characterized in that: The method for preventing and controlling the spread of tomato brown wrinkled fruit virus through tomato seeds includes reducing the infection rate of tomato brown wrinkled fruit virus on germinated tomato seedlings without affecting the germination rate of tomato seeds.

6. A biological drug for preventing and controlling the spread of tomato brown fruit virus through tomato seeds, characterized in that: The active ingredient of the biopharmaceutical contains at least the double-stranded RNA according to any one of claims 2-3.

7. A method for preventing and controlling the spread of tomato brown fruit virus through tomato seeds, characterized in that: Targeted interference with the target segment described in claim 1 reduces the infection rate of tomato brown wrinkled fruit virus on tomato seedlings after germination without affecting the germination rate of tomato seeds.

8. The method according to claim 7, characterized in that Treating germinating tomato seeds with a solution containing the double-stranded RNA according to any one of claims 2 to 3 or the biopharmaceutical according to claim 6.

9. The method according to claim 8, characterized in that The method of treating germinating tomato seeds includes treating the germinating tomato seeds in isolation of a single seed and / or treating the germinating tomato seeds in batches.

Images