Vector for gene unmarked transformation in yarrowia lipolytica and application thereof

Abstract

The invention provides a vector for marker-free transformation of genes in yarrowia lipolytica. The vector comprises an inducible Cre gene expression cassette, and the inducible Cre gene expression cassette contains a yarrowia lipolytica inducible hybrid promoter, a Cre gene and a terminator in the direction from the 5'end to the 3 'end; the yarrowia lipolytica inducible hybrid promoter is formed by fusing an inducible promoter available in a yeast cell and an intron fragment in a promoter containing an intron.

Description

Technical Field

[0001] The present invention belongs to the field of microbial genetic engineering, and more specifically, relates to a vector for marker-free gene transformation in Yarrowia lipolytica and its application. Background Art

[0002] Yarrowia lipolytica is an important unconventional yeast, which can utilize various types of hydrophilic or hydrophobic inexpensive carbon sources including glycerol, glucose, hydrocarbons, lipids, and acetic acid, and has strong tolerance to various environments. Yarrowia lipolytica has a rich enzyme system and a relatively high tricarboxylic acid cycle flux. It contains a large amount of the precursor substance acetyl-CoA required for the synthesis of many natural products, and this yeast has been approved by the US Food and Drug Administration (FDA) as a GRAS biosafe microorganism. Currently, it has been widely used as a microbial host for the high-level expression of recombinant proteins and the synthesis of metabolites such as terpenoids, flavonoids, and sugar alcohols.

[0003] In order to construct recombinant Yarrowia lipolytica strains to achieve specific biological purposes, it is usually necessary to use genetic screening markers for a series of modifications to obtain engineered bacteria containing the modified target gene. Currently, the available screening markers in Yarrowia lipolytica cells are mainly antibiotic markers and auxotrophic markers. Among them, the commonly used antibiotic markers include hygromycin B, nourseothricin, etc., and the auxotrophic screening markers include Ura3, Leu2, Trp1, etc. Although with the in-depth research, some new elements have been successfully mined and used for the screening of Yarrowia lipolytica, such as dsdA, sucB, etc., the still limited screening markers bring difficulties to the multiple iterative modifications in this yeast. In addition, recombinant strains containing antibiotic genes are not suitable for the production of recombinant proteins or metabolites with high biosafety requirements. It can be seen that it is very necessary to develop a tool for the recovery of marker genes after vector transformation in Yarrowia lipolytica.

[0004] Cre / loxP site-specific recombination system is often used in research to perform marker-free gene manipulation in a variety of microorganisms. This system usually requires Cre recombinase and a pair of loxP sequences to achieve recombination reactions. Among them, the loxP sequence is 34bp in length, which is composed of 13bp inverted repeat sequences at both ends and 8bp spacer sequences in between. The spacer sequence determines the direction and type of the loxP site. Cre recombinase can catalyze the splicing reaction between two loxP sites in the same direction on the same DNA chain, so that the selection marker gene introduced by the vector can be recovered. However, the characteristic of using the Cre / loxP system for each round of marker recovery will leave a loxP sequence on the genome, so that direct use of the system for multiple marker-free gene transformations in a single host may lead to gene rearrangement. In order to overcome this problem, some studies have obtained some mutant lox sites with unique properties by mutating the 13bp inverted repeat sequence of the wild-type loxP sequence, including the left arm mutant lox sequence (such as lox71, 5'

[0005] -TACCGTTCGTATAGCATACATTATACGAAGTTAT-3’) and the right-arm mutant lox site (such as lox66, 5’-ATAACTTCGTATAGCATACATTATACGAACGGTA-3’), etc. An excision reaction occurring between a pair of mutant sites can generate a double-arm mutant lox site (such as lox72) that is difficult to participate in the recombination reaction again, making the use of this Cre recombination system for repeated marker-free gene manipulation more reliable. So far, the Cre recombination method established in the literature [New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. Journal of microbiological methods, 2003, 55(3):727-737] has often been used in research to recover selectable markers in Yarrowia lipolytica. Although it can alleviate the problem of limited selectable markers, because its loxP sequence and the Cre recombinase expression cassette are located on two different vectors or fragments, after gene integration using this method, an additional transformation with a vector carrying the Cre expression cassette is required to achieve marker recovery. This results in two transformation operations using two marker genes for each round of marker-free gene integration, with a long experimental period and relatively complex operations. Not long ago, patent document 202210528110.X disclosed a method of using the lactose operon sequence lacO to inhibit the leaky expression of the Cre gene in Escherichia coli, successfully constructing the Cre gene expression cassette regulated by an inducible promoter and a pair of loxP sequences on a single vector, and achieving marker-free integration with only a single transformation, effectively shortening the period of a single marker-free integration. Nevertheless, this method must rely on an Escherichia coli host containing the lacIq repressor to effectively inhibit the leaky expression of the Cre gene in Escherichia coli, which greatly limits the range of Escherichia coli hosts that can be selected when constructing this type of vector. And when the lacIq repression in the host is not strict, it may lead to the Cre leaky expression in the vector itself, resulting in recombination between the two lox sequences and causing instability. In addition, given that no very strict inducible promoter has been identified in Yarrowia lipolytica so far, after DNA transformation using a vector constructed based on this method, there may be a certain proportion of transformants in which the Cre recombination eliminates the selectable marker due to promoter leakage when not induced, which is difficult to accommodate different research scenarios where marker recovery is required at a specific time.

[0006] Therefore, on the basis of overcoming the above technical deficiencies, developing a method for marker-free gene transformation in Yarrowia lipolytica has important practical value. Summary of the Invention

[0007] In view of the above technical defects or improvement requirements of the prior art, the present invention provides a vector for markerless gene transformation in Yarrowia lipolytica and its application, aiming to more effectively solve the problem of Cre recombinase leakage in Escherichia coli, and can more conveniently achieve markerless integration in this yeast using a single vector according to different experimental requirements.

[0008] To achieve the above object, according to one aspect of the present invention, there is provided a vector for markerless gene transformation in Yarrowia lipolytica, the vector comprising an inducible Cre gene expression cassette, and the inducible Cre gene expression cassette contains a Yarrowia lipolytica inducible hybrid promoter, a Cre gene and a terminator in the direction from the 5'-end to the 3'-end; the Yarrowia lipolytica inducible hybrid promoter is formed by fusing an inducible promoter available in the yeast cell with the intron fragment in the promoter containing an intron.

[0009] After the vector is transformed into an Escherichia coli host, the promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter utilizes the principle that Escherichia coli cannot recognize and splice eukaryotic introns, and prevents the leakage expression of the Cre gene in Escherichia coli by causing premature termination through the stop codon contained in its intron or by frameshifting the Cre gene.

[0010] Preferably, the vector further comprises: a left-arm mutant lox sequence and / or an Escherichia coli antibiotic gene and a replication origin and / or a Yarrowia lipolytica selection marker and / or a right-arm mutant lox sequence and / or a homologous arm and / or a target gene expression cassette.

[0011] Preferably, the vector comprises: a left-arm mutant lox sequence, an inducible Cre gene expression cassette, and a right-arm mutant lox sequence.

[0012] Preferably, the vector comprises: a left-arm mutant lox sequence, an inducible Cre gene expression cassette, an Escherichia coli antibiotic gene and a replication origin, a Yarrowia lipolytica selection marker, a right-arm mutant lox sequence, and a homologous arm.

[0013] Most preferably, the vector comprises: a left-arm mutant lox sequence, an inducible Cre gene expression cassette, an Escherichia coli antibiotic gene and a replication origin, a Yarrowia lipolytica selection marker, a right-arm mutant lox sequence, a homologous arm, and a target gene expression cassette.

[0014] After the vector is transformed into a Yarrowia lipolytica host, the promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter can cause the Cre gene expression cassette to be expressed under the regulation of the inducible promoter through intron splicing to produce a protein with recombinase function.

[0015] The promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter can regulate the strength of the inducible promoter, so that the leakage expression degree of the Cre gene expression cassette regulated by the inducible promoter in Yarrowia lipolytica is enhanced or weakened;

[0016] Preferably, the left-arm mutant lox sequence and the right-arm mutant lox sequence have the same spacer sequence and the same orientation on the vector;

[0017] Preferably, the inducible Cre gene expression cassette, the Escherichia coli antibiotic gene, the replication origin, and the Yarrowia lipolytica selection marker are all located between the 3'-end of the left-arm mutant lox sequence and the 5'-end of the right-arm mutant lox sequence on the vector;

[0018] Preferably, the homologous arms and the target gene expression cassette are both located between the 5'-end of the left-arm mutant lox sequence and the 3'-end of the right-arm mutant lox sequence on the vector;

[0019] After the vector is integrated into the Yarrowia lipolytica host chromosome, the left-arm mutant lox sequence and the right-arm mutant lox sequence contained in the vector can undergo an excision reaction mediated by Cre recombinase, and leave a double-arm mutant lox sequence on the host genome that is difficult to participate in the Cre recombination reaction again;

[0020] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid inducible promoter and the intron of the pICLin promoter in this yeast.

[0021] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid inducible promoter and the intron of the pFBAin promoter in this yeast.

[0022] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid inducible promoter and the intron of the pTEFin promoter in this yeast.

[0023] Preferably, when the vector is used for single-exchange integration, the homologous arm is a homologous sequence in the Yarrowia lipolytica host genome used for transformation, and it includes at least one restriction enzyme site A that uniquely exists on the vector.

[0024] Preferably, when the vector is used for double-exchange integration, the homologous arm is a fusion sequence of the downstream homologous sequence and the upstream homologous sequence in the Yarrowia lipolytica host genome used for transformation in the 5' to 3' direction, and there is at least one restriction enzyme site B between the downstream homologous sequence and the upstream homologous sequence that does not exist outside the homologous arm region of the vector.

[0025] Preferably, when the vector is used for double-exchange gene knockout, the vector may not contain a target gene expression cassette.

[0026] Preferably, the Yarrowia lipolytica selection marker is a nutritional auxotroph or an antibiotic selection marker.

[0027] Preferably, the length of each homologous sequence in the homologous arms is at least 500 bp.

[0028] According to another aspect of the present invention, there is provided an application of the vector as described above in markerless transformation of genes in Yarrowia lipolytica.

[0029] According to another aspect of the present invention, there is provided a method for markerless transformation of genes in Yarrowia lipolytica, the method comprising the following steps:

[0030] (1) Transformation: After linearizing the vector at the restriction enzyme site A or restriction enzyme site B contained in the homologous arms, transform the Yarrowia lipolytica host, and screen for target transformants using the selection medium corresponding to the yeast selection marker contained in the vector;

[0031] (2) Induction: Inoculate the transformants obtained in step (1) into a liquid induction medium for induction. When the bacterial cells grow to be significantly turbid, separate the bacterial liquid on a nutrient medium by dilution plating or continuous streaking to obtain single colonies; the nutrient medium is a medium on which a Yarrowia lipolytica strain without the selection marker can grow normally; the induction medium is a medium capable of inducing the expression of the Cre recombinase;

[0032] (3) Identification: Inoculate the single colonies obtained in step (2) into the selection medium used in step (1) and the nutrient medium described in step (2) respectively. Select the clones that can grow well on the nutrient medium but cannot grow normally on the selection medium for further genomic PCR verification. The clones with correct verification are the recombinant strains that have achieved the target markerless gene transformation.

[0033] Preferably, the transformation method used in step (1) is the lithium transformation method or the electroporation method.

[0034] Preferably, the transformants obtained in step (1) are verified by genomic PCR before proceeding to step (2).

[0035] Preferably, by repeating steps (1) to (3), multiple rounds of markerless gene transformation can be achieved in a single host.

[0036] Generally speaking, compared with the prior art through the above technical solutions conceived by the present invention, the main technical advantages are as follows:

[0037] (1)Previously, the technology disclosed in Patent Document 202210528110.X utilized the lactose operon sequence lacO element to inhibit the leakage of the Cre gene in Escherichia coli, but it had to rely on an Escherichia coli host containing the lacIq repressor, with more limiting conditions. The vector designed for markerless gene transformation in Yarrowia lipolytica in the present invention constructs an inducible hybrid promoter in Yarrowia lipolytica. By utilizing the principle that Escherichia coli cannot recognize and splice eukaryotic introns, and the stop codons contained within the intron sequence cause premature termination or by causing frameshift of the Cre gene, the leakage expression of the Cre gene in Escherichia coli can be effectively prevented. The present invention inhibits the leakage expression of the Cre gene in Escherichia coli from the perspective of gene coding, which is more rigorous than the inhibition when using the lacO regulatory element, and can effectively prevent the instability caused by Cre recombination of the vector itself when the lacIq repression in the host is not rigorous, with higher reliability. In addition, the construction of the markerless gene transformation vector in the present invention does not need to rely on an Escherichia coli host containing the lacIq repressor, and the range of selectable Escherichia coli hosts is wider, which is more conducive to practical operation and application.

[0038] (2)Given that a very rigorous inducible promoter has not been excavated in Yarrowia lipolytica yet, directly using the inducible promoter to regulate the Cre gene with the technology disclosed in Patent Document 202210528110.X is difficult to more finely regulate the strength of the promoter, and there may be events of Cre recombination removing the selection marker due to leakage expression of the promoter even without induction. Currently, auxotrophic selection marker genes are often used in Yarrowia lipolytica, and the main auxotrophic selection marker genes (such as Leu2, Ura3, etc.) may have varying degrees of influence on the growth and fermentation production of corresponding defective strains of Yarrowia lipolytica. When some studies need to first evaluate the impact of gene modification on strain growth and fermentation and then recover the defective gene marker, if a large number of recombinant strains during fermentation lead to the removal of the selection marker gene due to leakage expression of the promoter, it will have a greater impact on the reliability of the fermentation results. The present invention combines the characteristic that the intron sequence of the promoter in Yarrowia lipolytica can regulate the promoter strength, designs and constructs an inducible hybrid promoter in Yarrowia lipolytica, and regulates the strength of the inducible promoter through the promoter intron sequence, enabling the leakage expression degree of the Cre gene expression cassette regulated by the inducible promoter to increase or decrease in Yarrowia lipolytica. The inducible hybrid promoter with enhanced leakage can be used in scenarios where rapid marker recovery is required, while the inducible hybrid promoter with weakened leakage can be used in scenarios where the strain needs to be relatively stable and the marker is recovered when needed. It can be seen that the technology in this patent has stronger controllability in the process of marker recovery in Yarrowia lipolytica and can better balance different research scenarios that require marker recovery at specific times.

[0039] (3) Compared with traditional methods, the present invention only requires a single selection marker to achieve marker-free transformation in Yarrowia lipolytica, with fewer requirements for selection markers and a wider range of optional hosts.

[0040] (4) Compared with traditional methods, each round of marker-free transformation in the present invention only requires a single transformation, effectively shortening the experimental period and reducing the experimental workload.

[0041] (5) The recombinant Yarrowia lipolytica strain constructed by the present invention does not introduce any antibiotic genes, which is more conducive to its application in industrial fields with high biosafety requirements. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the principle of marker-free transformation of Yarrowia lipolytica genes in the present invention (shown by taking double crossover as an example).

[0043] Figure 2 It is a schematic diagram of the marker-free vector F17-pPOX2 ICLin -cre-lacZ based on the inducible hybrid promoter pPOX2. ICLin

[0044] Figure 3 It is the result of restriction enzyme digestion verification of several inducible hybrid promoter marker-free vectors using HindIII and BlnI. Lanes 1-2 are the F17-pPOX2 FBAin -cre-lacZ plasmid, lanes 3-4 are the F17-pPOX2 TEFin -cre-lacZ plasmid, lane 5 is the F17-pPOX2 ICLin -cre-lacZ plasmid, M is the DNA Marker.

[0045] Figure 4 It is a schematic diagram of the marker-free vector F17-pPOX2 TEFin -cre-lacZ based on the inducible hybrid promoter pPOX2. TEFin

[0046] Figure 5 It is a schematic diagram of the marker-free vector F17-pPOX2 FBAin -cre-lacZ based on the inducible hybrid promoter pPOX2. FBAin

[0047] Figure 6 It is for Po1f / F17-pPOX2 TEFin -cre-lacZ, Po1f / F17-pPOX2 ICLin -cre-lacZ and Po1f / F17-pPOX2 FBAin- Loss of the Ura3 marker in the -cre-lacZ recombinant bacteria without induction after culturing in YPD. Among them, A and B are Po1f / F17-pPOX2 respectively FBAin - Growth of -cre-lacZ in SD-Ura and YPD. C and D are Po1f / F17-pPOX2 TEFin - Growth of -cre-lacZ in SD-Ura and YPD. E and F are Po1f / F17-pPOX2 respectively ICLin - Growth of -cre-lacZ in SD-Ura and YPD. Among them, strains 1-21 on the plate are 21 randomly selected clones, and C is Po1f as the control strain

[0048] Figure 7 is Po1f / F17-pPOX2 TEFin -cre-lacZ, Po1f / F17-pPOX2 ICLin -cre-lacZ and Po1f / F17-pPOX2 FBAin - Loss of the Ura3 marker in the -cre-lacZ recombinant bacteria after induction with oleic acid. Among them, A and B are Po1f / F17-pPOX2 respectively FBAin - Growth of -cre-lacZ in SD-Ura and YPD. C and D are Po1f / F17-pPOX2 TEFin - Growth of -cre-lacZ in SD-Ura and YPD. E and F are Po1f / F17-pPOX2 respectively ICLin - Growth of -cre-lacZ in SD-Ura and YPD. Among them, strains 1-21 on the plate are 21 randomly selected clones, and C is the strain that makes up for the uracil auxotrophy based on Po1f as the control

[0049] Figure 8 is Po1f / F17-pPOX2 TEFin -cre-lacZ, Po1f / F17-pPOX2 ICLin -cre-lacZ and Po1f / F17-pPOX2 FBAin - Genomic PCR results of the -cre-lacZ recombinant bacteria after removing the Ura3 marker by induction with oleic acid. Among them, numbers 1-8 in Figure A are Po1f / F17-pPOX2 ICLin - Eight randomly selected transformants of -cre-lacZ after removing the Ura3 marker by induction with oleic acid, numbers 1-8 in Figure B are Po1f / F17-pPOX2 TEFin - Eight randomly selected transformants of -cre-lacZ after removing the Ura3 marker by induction with oleic acid, numbers 9-16 in Figure B are Po1f / F17-pPOX2FBAin Eight randomly selected transformants after oleic acid-induced excision of the Ura3 marker in -cre-lacZ, M is the DNA Marker.

[0050] Figure 9 The lacZ markerless integration vector D17-pPOX2 at the D17 locus FBAin Schematic diagram of -cre-lacZ.

[0051] Figure 10 The recombinant strain Po1f-lacZ / D17-pPOX2 FBAin -cre-lacZ(SmiI) and Po1f-lacZ / D17-pPOX2 FBAin The loss of the Ura3 marker in -cre-lacZ(Mph1103I) after oleic acid induction. Among them, A and B are Po1f-lacZ / D17-pPOX2 respectively FBAin The growth of -cre-lacZ(SmiI) in SD-Ura and YPD, C and D are Po1f-lacZ / D17-pPOX2 FBAin The growth of -cre-lacZ(Mph1103I) in SD-Ura and YPD. Among them, the strains numbered 1-21 on the plate are 21 randomly selected clones, and C is the strain that compensates for the uracil auxotrophy on the basis of Po1f and serves as a control.

[0052] Figure 11 The recombinant strain Po1f-lacZ / D17-pPOX2 FBAin -cre-lacZ(SmiI) and Po1f-lacZ / D17-pPOX2 FBAin The genomic PCR results of -cre-lacZ(Mph1103I) after oleic acid-induced excision of the Ura3 marker. Among them, numbers 1-6 in Figure A are Po1f-lacZ / D17-pPOX2 FBAin Six randomly selected transformants after oleic acid-induced excision of the Ura3 marker in -cre-lacZ(SmiI), numbers 1-5 in Figure B are Po1f-lacZ / D17-pPOX2 FBAin Five randomly selected transformants after oleic acid-induced excision of the Ura3 marker in -cre-lacZ(Mph1103I), C is the Po1f control, M is the DNA Marker. Detailed implementation method

[0053] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.

[0054] Experimental materials

[0055] Unless otherwise specified, the experimental methods used in the present invention are all conventional methods. Escherichia coli DH5α and Top10F' competent cells were purchased from Shanghai Weidi Biotechnology; the Yarrowia lipolytica Po1f strain was derived from ATCC; the vector pUC-lacZ containing the lacZ gene and the vector pKB-D17 containing the upstream and downstream homologous fragments of the Yarrowia lipolytica D17 locus were preserved by our company. The Ura3 gene was synthesized according to the Po1g strain sequence information, the Cre recombinase gene was synthesized according to the codon preference of Yarrowia lipolytica, the Escherichia coli Amp antibiotic gene and replicon were synthesized according to the commercial pPIC9K vector sequence information, and all DNA syntheses were performed by Anhui General Biology Co., Ltd.; the Ready-to-Use Seamless Cloning Kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.; restriction enzymes were purchased from Thermo Fisher Scientific; PCR polymerase was purchased from TaKaRa; plasmid miniprep kits and DNA gel extraction kits were purchased from Suzhou Youyiland Biotechnology Co., Ltd.; DO Supplement-Ura-Leu amino acids were from Beijing Coolaber Technology Co., Ltd.

[0056] Cultivation conditions: Related strains of Escherichia coli were cultured at 37 °C, and related strains of Yarrowia lipolytica were cultured at 30 °C.

[0057] Primers were synthesized as shown in Table 1:

[0058] Table 1

[0059]

[0060]

[0061]

[0062] SEQ ID NO 42:

[0063] Intron sequence of the pICL promoter

[0064] AGTGAGTATCCAACAGCGACACGTGAGATGGCAGAGACACAGAGACGTGTCTACATGGTTGGACAAGTCTCCACATTCGCCAGAGACGTATCCACATACAAACACAATCTCACAGCTGATCTGCTCCTGTGACAGCACAGTACATGTTAGTGGATGAGGTGTTGTGTGGTGGGTTAAATGGGTGGACTGATTCAGTGGCATCGGTGGCGACACCCTCTACTCTTCATGTCGTCACCTACCGTTCGGAATCCCAAAAATCTGATGAACTAAACGATTTCTGGCCAAAACACAATTTTGCCAAAGAAGTCGGTCTCACCAATGCAAGTGTCACATCAAACATCTGTCCCGTACTAACCCAGTG

[0065] SEQ ID NO 43:

[0066] Intron sequence of pTEF promoter

[0067] ATGCCTGTTACTGACGTCCTTAAGCGAAAGTCCGGTGTCATCGTCGGCGACGATGTCCGAGCCGTGAGTATCCACGACAAGATCAGTGTCGAGACGACGCGTTTTGTGTAATGACACAATCCGAAAGTCGCTAGCAACACACACTCTCTACACAAACTAACCCAGCTCTTC

[0068] SEQ ID NO 44:

[0069] Intron sequence of pFBA promoter

[0070] ATGCCTGTTACTGACGTCCTTAAGCGAAAGTCCGGTGTCATCGTCGGCGACGATGTCCGAGCCGTGAGTATCCACGACAAGATCAGTGTCGAGACGACGCGTTTTGTGTAATGACACAATCCGAAAGTCGCTAGCAACACACACTCTCTACACAAACTAACCCAGCTCTTC

[0071] Example 1: General description of a vector for marker - free gene transformation in Yarrowia lipolytica of the present invention

[0072] The vector includes lox71, an inducible Cre gene expression cassette, an Escherichia coli antibiotic gene and a replication origin, a Yarrowia lipolytica selection marker, lox66, a homologous arm, and a target gene expression cassette. The inducible Cre gene expression cassette contains a Yarrowia lipolytica inducible hybrid promoter, the Cre gene, and a terminator in the direction from the 5'-end to the 3'-end. The Yarrowia lipolytica inducible hybrid promoter is formed by fusing an inducible promoter available in the yeast cell with the intron fragment in a promoter containing an intron.

[0073] The lox77 and lox66 sequences have the same direction on the vector.

[0074] The inducible Cre gene expression cassette, the Escherichia coli antibiotic gene and the replication origin, and the Yarrowia lipolytica selection marker are all located between the 3'-end of lox71 and the 5'-end of the lox66 sequence on the vector.

[0075] The homologous arm and the target gene expression cassette are both located between the 5'-end of the lox71 sequence and the 3'-end of the lox66 sequence on the vector.

[0076] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid-induced promoter with the intron of the pICLin promoter in this yeast.

[0077] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid-induced promoter with the intron of the pFBAin promoter in this yeast.

[0078] Preferably, the Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic acid-induced promoter with the intron of the pTEFin promoter in this yeast.

[0079] Preferably, when the vector is used for single crossover integration, the homologous arm is a homologous sequence in the Yarrowia lipolytica host genome for transformation, and it includes at least one restriction site A that uniquely exists on the vector.

[0080] Preferably, when the vector is used for double crossover integration, the homologous arm is a fusion sequence of the homologous sequence downstream and the homologous sequence upstream of the target site in the Yarrowia lipolytica host genome for transformation in the 5'-to-3' direction, and there is at least one restriction site B between the downstream homologous sequence and the upstream homologous sequence that does not exist outside the homologous arm region of the vector.

[0081] The Yarrowia lipolytica selection marker is a nutritional defect type or an antibiotic selection marker.

[0082] After the vector is transformed into an E. coli host, the promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter utilizes the principle that E. coli cannot recognize and splice eukaryotic introns, and prevents the Cre gene from leaking out in the E. coli by causing premature termination through the stop codon contained in the intron or by causing the Cre gene to shift its frame;

[0083] After the vector is transformed into a Yarrowia lipolytica host, the promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter can be spliced ​​through introns so that the Cre gene expression cassette can be expressed under the regulation of the inducible promoter to produce a protein with a recombinase function;

[0084] The promoter intron sequence contained in the Yarrowia lipolytica inducible hybrid promoter can adjust the strength of the inducible promoter, so that the degree of leaky expression of the Cre gene expression cassette regulated by the inducible promoter in Yarrowia lipolytica is enhanced or weakened.

[0085] Example 2: General description of marker-free transformation of the gene of the invention in Yarrowia lipolytica

[0086] The principle of achieving marker-free transformation of Yarrowia lipolytica genes in the present invention is as follows: Figure 1 As shown (double exchange is used as an example for demonstration). After the vector for gene marker-free transformation in Yarrowia lipolytica is integrated into the target homologous site in a targeted manner, the inducible hybrid promoter of Yarrowia lipolytica regulates the expression of the Cre recombinase gene through induction culture. The recombinase recognizes and mediates the splicing reaction between the lox71 and lox66 sequences in the same direction, so that the inducible Cre gene expression cassette, Escherichia coli antibiotic gene and replication origin, Yarrowia lipolytica selection marker, etc. between the two sequences are all removed, and the double-arm mutant lox72 site remains in the genome, so as to achieve the purpose of gene marker-free transformation in Yarrowia lipolytica.

[0087] Preferably, each round of label-free transformation process comprises the following steps:

[0088] (1) Transformation: The vector for marker-free transformation of genes in Yarrowia lipolytica described in Example 1 is linearized at the restriction site A or restriction site B contained in the homology arm, and then transformed into a Yarrowia lipolytica host, and the target transformants are screened using a screening medium corresponding to the yeast selection marker contained in the vector;

[0089] (2) Induction: Inoculate the transformants obtained in step (1) into a liquid induction medium for induction. When the bacterial cells grow to obvious turbidity, separate the bacterial liquid on a nutrient medium by dilution plating or streak plating to obtain single colonies; the nutrient medium is a medium on which the Yarrowia lipolytica strain without the screening marker can grow normally; the induction medium is a medium required to induce the expression of the Cre recombinase;

[0090] (3) Identification: Inoculate the single colonies obtained in step (2) into the screening medium used in step (1) and the nutrient medium described in step (2) respectively. Select the clones that can grow well on the nutrient medium but cannot grow normally on the screening medium for further genomic PCR verification. The clones with correct verification are the recombinant strains that have achieved marker-free gene transformation.

[0091] The transformation method used in step (1) is the lithium transformation method or the electroporation method.

[0092] The transformants obtained in step (1) are subjected to genomic PCR verification before proceeding to step (2).

[0093] Example 3: Based on the inducible hybrid promoter pPOX2 ICLin Inhibiting the leaky expression of the Cre gene in Escherichia coli

[0094] Construct the recombinant vector F17-pPOX2 ICLin -cre-lacZ (see Figure 2 ) The process is as follows:

[0095] (1) Using the Po1f genome as a template, the downstream homologous sequence dwF17 of the F17 locus was amplified using the primer pair 66dwF17-F / dwF17-R, the upstream homologous sequence upF17 of the F17 locus was obtained by PCR using the primers upF17-F and upF17-R, the promoter pTEF was cloned using the primers F17UTEF-F and pTEFlacZ-R, the terminator Xpr2 was amplified using the primers XprTT-F and XprTT-R, the terminator lip2 fused with the lox71 sequence at the end was amplified using the primers lip2TT-F and 71lip2TT-R1, the intron sequence ICLin (SEQ ID NO 42) of the pICL1 promoter was cloned using the primers ICLin-F and ICLin-R, and the promoter pPOX2 was obtained by PCR using the primers pPOX2-F and pPOX2-R; using the synthesized Ura3 gene as a template, the Ura3 fragment was amplified using the primer pair Ura3-F / Ura3-R; using the synthesized Escherichia coli Amp antibiotic gene and the replication origin fragment as templates, the Amp-ori fragment fused with the lox66 sequence at the end was amplified using the primers uraAmp-F and 66ori-R; starting from pUC-lacZ, the lacZ gene was cloned using the primers lacZ-F and lacZ-R; using the synthesized Cre gene as a template, the Cre fragment was obtained using the primers Cre-F and Cre-R;

[0096] (2) Using the mixed fragment of ICLin, Cre, and lip2 obtained in step (1) as a template, the fusion fragment 1 was obtained by overlap-PCR using the primers ICLin-F and 71lip2TT-R2; using the mixed fragments of dwF17, upF17, and pTEF obtained in step (1) as a template, the fusion fragment 2 was obtained using the primers 66dwF17-F and pTEFlacZ-R; using lacZ and Xpr2 in step (1) as templates, the fusion fragment 3 was obtained by PCR using the primers lacZ-F and XprTT-R;

[0097] (3) After mixing the pPOX2, Ura3, Amp-ori obtained in step (1) and the fusion fragments 1, 2, and 3 obtained in step (2), the fragment assembly was carried out using the Ready-to-Use Seamless Cloning Kit. The ligation product was transformed into Escherichia coli DH5α competent cells, and the transformants were screened using an LB plate containing 100 μg / mL ampicillin. After screening the clones by colony PCR using the primers upF17-F and upF17-R, the positive clones were selected, passaged and inoculated once, and then the plasmids were extracted and verified by digestion with HindIII and BlnI (see Figure 3),two bright bands (with theoretical sizes of approximately 12000 bp and approximately 2300 bp respectively) can be obtained. Further sequencing analysis of the plasmid showed completely correct results, further proving the use of the inducible hybrid promoter pPOX2 ICLin The pICL1 promoter intron fragment contained in it cannot be recognized and spliced by Escherichia coli, and through gene frameshift, the leakage expression of the Cre gene in Escherichia coli can be effectively prevented, enabling the Cre gene expression cassette to be successfully constructed with a pair of lox sequences on a single recombinant vector. The vector with correct sequencing is named F17-pPOX2 ICLin -cre-lacZ.

[0098] Example 4: Suppression of the leakage expression of the Cre gene in Escherichia coli based on the inducible hybrid promoter pPOX2 TEFin Suppression of the leakage expression of the Cre gene in Escherichia coli

[0099] Based on pPOX2 TEFin Construct the recombinant vector F17-pPOX2 TEFin -cre-lacZ (see Figure 4 ) The process is as follows:

[0100] (1) Using the F17-pPOX2 ICLin -cre-lacZ plasmid as a template, use primers Cre-F and xprBlnI-R1 to amplify and obtain a partial Cre gene expression cassette fragment, use primers HindIIIPox2-F and pPOX2-R to amplify and obtain a partial pPOX2 promoter fragment 3'Pox2; use the Po1f genome as a template, use primer pair TEFin-F / TEFin-R to clone and obtain the pTEF promoter intron sequence TEFin (SEQ ID NO 43). Further, starting from the mixed template of 3'Pox2 and TEFin, use primers HindIIIPox2-F and 5'Cre-R for fusion PCR to obtain the 3'pPOX2 TEFin fragment;

[0101] (2) Use HindIII and BlnI to digest F17-pPOX2 ICLin -cre-lacZ and purify to obtain the backbone fragment containing the lacZ expression cassette, and combine it with the partial Cre gene expression cassette and 3'pPOX2 obtained in step (1) of this example TEFinAfter the fragments were mixed, a Ready-to-Use Seamless Cloning Kit was used for fragment assembly. The ligation product was transformed into competent Escherichia coli DH5α cells, and transformants were screened using LB plates containing 100 μg / mL ampicillin. After the clones were screened by colony PCR with upF17-F and upF17-R primers, positive clones were selected, passaged once, and plasmids were extracted and verified by digestion with HindIII and BlnI (see Figure 3 ), and two bright bands (with theoretical sizes of approximately 12000 bp and approximately 2070 bp, respectively) could be obtained. Further sequencing analysis of the plasmid showed completely correct results, further demonstrating that the pTEF promoter intron fragment contained in the inducible hybrid promoter pPOX2 TEFin could not be recognized and spliced by Escherichia coli, and Cre gene leakage expression in Escherichia coli could also be effectively prevented by gene frameshift, enabling the Cre gene expression cassette to be successfully constructed with a pair of lox sequences in a single recombinant vector. The vector with correct sequencing was named F17-pPOX2 TEFin -cre-lacZ.

[0102] Example 5: Suppression of Cre gene leakage expression in Escherichia coli based on the inducible hybrid promoter pPOX2 FBAin The process of constructing the recombinant vector F17-pPOX2

[0103] -cre-lacZ based on pPOX2FBAin is as follows: FBAin (see Figure 5 ) is as follows:

[0104] Using the Po1f genome as a template, the pFBA promoter intron sequence FBAin (SEQ ID NO 44) was cloned using primers FBAin-F and FBAin-R. This fragment was mixed with the backbone fragment, partial Cre gene expression cassette fragment, and 3' Pox2 fragment obtained by digesting the F17-pPOX2 ICLin -cre-lacZ plasmid with HindIII and BlnI in Example 4. After that, a Ready-to-Use Seamless Cloning Kit was used for fragment assembly. The ligation product was transformed into competent Escherichia coli DH5α cells, and transformants were screened using LB plates containing 100 μg / mL ampicillin. After the clones were screened by colony PCR with upF17-F and upF17-R primers, positive clones were selected, passaged once, and plasmids were extracted and verified by digestion with HindIII and BlnI (see Figure 3) Two bright bands (with theoretical sizes of approximately 12000 bp and approximately 2110 bp respectively) can be obtained. Further sequencing analysis of the plasmid shows that the results are completely correct, further proving the use of the inducible hybrid promoter pPOX2 FBAin The pFBA promoter intron fragment contained in it cannot be recognized by Escherichia coli for splicing, and the Cre gene can also be effectively prevented from leaking and expressing in Escherichia coli by the way of premature termination through the stop codon it contains, enabling the Cre gene expression cassette to be successfully constructed with a pair of lox sequences in a single recombinant vector. The vector with correct sequencing is named F17-pPOX2 FBAin -cre-lacZ.

[0105] Example 6: The first-round markerless integration of the lacZ gene at the F17 locus of Yarrowia lipolytica

[0106] In this example, F17-pPOX2 ICLin -cre-lacZ, F17-pPOX2 TEFin -cre-lacZ and F17-pPOX2 FBAin -cre-lacZ vectors were used to achieve markerless integration of the lacZ gene in the Po1f strain, which specifically includes the following steps:

[0107] (1) Transformation: After linearizing the plasmids F17-pPOX2 ICLin -cre-lacZ, F17-pPOX2 TEFin -cre-lacZ and F17-pPOX2 FBAin -cre-lacZ with FseI endonuclease inside the F17 homologous arms, they were respectively transferred into Po1f competent cells by the lithium transformation method, and transformants were screened using SD-Ura medium without uracil (5 g / L ammonium sulfate, 1.7 g / L yeast nitrogen base without ammonium sulfate, DO Supplement-Ura-Leu 1.19 g / L, 20 g / L glucose, 0.38 g / L leucine). Colony PCR was performed on several different transformants using the primer pairs F17out-F / 3upF17-R and Ori-F / F17out-R to screen for Po1f / F17-pPOX2 ICLin -cre-lacZ, Po1f / F17-pPOX2 TEFin -cre-lacZ and Po1f / F17-pPOX2 FBAin -cre-lacZ transformants that were correctly transformed into the F17 locus by single crossover. The transformants were respectively inoculated into YPD (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose) liquid medium until it grew turbid;

[0108] (2) Stringency of different inducible hybrid promoters: The bacterial solutions obtained by culturing different transformants in step (1) were respectively spread on YPD plates by dilution coating to obtain monoclonal colonies. These are the recombinant bacteria that have not been induced after culturing on YPD. Randomly select 21 recombinant bacteria each and spot them onto YPD and SD-Ura plates. As Figure 6 shown, in addition to the control strain with uracil deficiency, there are 17 Po1f / F17-pPOX2 TEFin -cre-lacZ clones, 10 Po1f / F17-pPOX2 ICLin -cre-lacZ clones and 1 Po1f / F17-pPOX2 FBAin -cre-lacZ transformants that can grow on YPD medium but cannot grow on SD-Ura medium, indicating that the Ura3 marker in these clones has been excised due to recombination caused by the leaky expression of the Cre gene in Yarrowia lipolytica, and it also shows that the pPOX2 TEFin 、pPOX2 ICLin 、pPOX2 FBAin hybrid inducible promoters have different stringency intensities in Yarrowia lipolytica. It can be seen that the leaky intensity of the inducible promoter can be adjusted by different intron sequences. The Cre gene regulated by the inducible hybrid promoter with enhanced leakiness can be used in scenarios where rapid marker recovery is required (such as Po1f / F17-pPOX2 TEFin -cre-lacZ in this example), while the Cre gene regulated by the inducible hybrid promoter with weakened leakiness can be used in scenarios where the strain needs to be relatively stable (such as Po1f / F17-pPOX2 FBAin -cre-lacZ in this example) and the marker is recovered when needed.

[0109] (3) Induction: Take 100 μL of the bacterial solutions obtained by culturing different transformants in step (1) and transfer them respectively to SO oleic acid liquid medium containing uracil (5 g / L ammonium sulfate, 1.7 g / L yeast nitrogen base without ammonium sulfate, DO Supplement-Ura-Leu 1.19 g / L, 0.38 g / L leucine, 20 mL / L oleic acid, 0.076 g / L uracil). At this time, different hybrid promoters based on the pPOX2 promoter will be induced by oleic acid to activate the expression of the Cre gene. After about 8 h of induced culture, take the bacterial solutions and spread them on YPD plates by dilution coating to obtain monoclonal colonies. Randomly select 23 recombinant bacteria each and spot them onto YPD and SD-Ura plates. As Figure 7 shown, in addition to the control strain that makes up for uracil deficiency, Po1f / F17-pPOX2 ICLin -cre-lacZ, Po1f / F17-pPOX2 TEFin-cre-lacZ and Po1f / F17-pPOX2 FBAin -After oleic acid induction, randomly selected recombinant bacteria of -cre-lacZ could grow normally on YPD plates but not on SD-Ura medium, indicating that the Cre gene in these clones could efficiently remove the Ura3 marker during induction. Randomly select Po1f / F17-pPOX2 ICLin -cre-lacZ, Po1f / F17-pPOX2 TEFin -cre-lacZ and Po1f / F17-pPOX2 FBAin -Eight clones of -cre-lacZ after successful marker removal were verified by genomic PCR using primers 3lacZ-F / F17out-R, and the results showed that the target bands consistent with the theoretical size of about 3100bp could be successfully amplified (see Figure 8 ). Sequencing analysis of the PCR bands proved that the Ura3 gene in these three recombinant strains was removed by the preset Cre recombination method, achieving marker-free integration of the lacZ expression cassette at the F17 locus and leaving a single lox72 site. Among them, the transformant of Po1f / F17-pPOX2 FBAin -cre-lacZ after marker removal was named Po1f / F17-lacZ.

[0110] Example 7: Further perform the second round of marker-free integration of the lacZ gene at the D17 locus in Po1f / F17-lacZ

[0111] (1) Vector construction: Digest the -cre-lacZ plasmid of F17-pPOX2 FBAin with HindIII and MluI, and purify and recover the fragment containing the Amp-ori element; Digest the -cre-lacZ plasmid of F17-pPOX2 FBAin with MssI and XbaI, and purify and recover the fragment containing the lacZ gene; Using F17-pPOX2 FBAinUsing the -cre-lacZ plasmid as a template, a partial pPOX2 fragment was amplified using HindIII Pox2-F and pPox2 XbaI-R; using the pKB-D17 plasmid as a template, the downstream homologous partial sequence dwD17 of the D17 locus was amplified by dwD17-F and dwD17-R, and the upstream homologous partial sequence upD17 of the D17 locus was amplified by upD17-F and upD17-R. After mixing the above 5 fragments, a Ready-to-Use Seamless Cloning Kit was used for fragment assembly. The ligation product was transformed into Escherichia coli Top10F' competent cells, and transformants were screened using an LB plate containing 100 μg / mL ampicillin. After screening the clones by colony PCR, positive clones were selected for sequencing analysis, and the vector with correct sequencing was named D17-pPOX2 FBAin -cre-lacZ (see Figure 9 ).

[0112] (2) After linearizing D17-pPOX2 FBAin -cre-lacZ between the upstream and downstream homologous arms using SmiI enzyme, it was transferred into Po1f / F17-lacZ competent cells by the lithium transformation method. Recombinant bacteria were screened using SD-Ura medium, and transformants Po1f-lacZ / D17-pPOX2 FBAin -cre-lacZ (SmiI) integrated into the D17 locus by double crossover were obtained by PCR screening; another D17-pPOX2 FBAin -cre-lacZ was linearized inside the dwD17 homologous fragment using Mph1103I, transferred into Po1f / F17-lacZ competent cells by the lithium transformation method, screened using SD-Ura medium, and recombinant bacteria Po1f-lacZ / D17-pPOX2 FBAin -cre-lacZ (Mph1103I) integrated into the dwD17 locus by single crossover were obtained by PCR screening. The two recombinant strains were activated in YPD medium and then induced with oleic acid, and the specific process was the same as in Example 6. Randomly selected induced transformants were transferred to YPD and SD-Ura plates respectively. As Figure 10 shown, except for the control strain that compensated for the uracil auxotrophy, all clones could not grow normally in the medium lacking uracil, indicating that the Ura3 marker was efficiently induced and removed. Randomly selected 6 Po1f-lacZ / D17-pPOX2 FBAin -cre-lacZ (SmiI) and 5 Po1f-lacZ / D17-pPOX2 FBAinAfter induction with -cre-lacZ (Mph1103I), the clones were verified by colony PCR using 3lacZ-F and D17out-R. As a result, target fragments consistent with the theoretical size of approximately 2550 bp after removing the screening marker were amplified from 6 and 4 clones respectively (see Figure 11 ). Sequencing analysis of the PCR bands showed complete agreement with the theoretical expectations, demonstrating that the Ura3 gene in both recombinant strains was efficiently removed through the preset Cre recombination method. This example shows that on the basis of the marker-free integration of the lacZ expression cassette at the F17 locus, marker-free integration of the lacZ expression cassette at the D17 locus was effectively achieved based on single crossover integration and double crossover respectively.

[0113] It is easy for those skilled in the art to understand that the above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A vector for marker - free gene transformation in Yarrowia lipolytica, which vector comprises an inducible Cre gene expression cassette. The inducible Cre gene expression cassette contains a Yarrowia lipolytica inducible hybrid promoter, a Cre gene and a terminator in the direction from the 5'-end to the 3'-end. The Yarrowia lipolytica inducible hybrid promoter is formed by fusing an inducible promoter available in the yeast cell with the intron fragment in a promoter containing an intron.

2. The carrier according to claim 1, wherein The vector further comprises: a left - arm mutant lox sequence and / or an Escherichia coli antibiotic gene and replication origin and / or a Yarrowia lipolytica selection marker and / or a right - arm mutant lox sequence and / or a homologous arm and / or a target gene expression cassette.

3. The carrier according to claim 2, wherein The vector comprises: a left - arm mutant lox sequence, an inducible Cre gene expression cassette, a right - arm mutant lox sequence.

4. The carrier according to claim 2, characterized in that, The vector comprises: a left - arm mutant lox sequence, an inducible Cre gene expression cassette, an Escherichia coli antibiotic gene and replication origin, a Yarrowia lipolytica selection marker, a right - arm mutant lox sequence, a homologous arm.

5. The carrier according to claim 2, characterized in that The vector comprises: a left - arm mutant lox sequence, an inducible Cre gene expression cassette, an Escherichia coli antibiotic gene and replication origin, a Yarrowia lipolytica selection marker, a right - arm mutant lox sequence, a homologous arm and a target gene expression cassette.

6. The carrier according to any one of claims 2-5, characterized in that, The left - arm mutant lox sequence and the right - arm mutant lox sequence have the same spacer sequence and have the same direction on the vector.

7. The carrier according to any one of claims 2-5, characterized in that, The inducible Cre gene expression cassette, the Escherichia coli antibiotic gene and replication origin, and the Yarrowia lipolytica selection marker are all located between the 3'-end of the left - arm mutant lox sequence and the 5'-end of the right - arm mutant lox sequence on the vector.

8. The carrier according to any one of claims 4-5, characterized in that, The homologous arm and / or the target gene expression cassette are all located between the 5'-end of the left - arm mutant lox sequence and the 3'-end of the right - arm mutant lox sequence on the vector.

9. The carrier according to any one of claims 1-5, characterized in that, The Yarrowia lipolytica inducible hybrid promoter is constructed by hybridizing the pPOX2 oleic - acid - type inducible promoter with the intron of the pICLin promoter, pFBAin promoter or pTEFin promoter in this yeast.

10. The carrier according to any one of claims 1-5, characterized in that, When the vector is used for single - crossover integration, the homologous arm is a homologous sequence in the Yarrowia lipolytica host genome to be transformed, and it includes at least one restriction site A that is uniquely present on the vector; or when the vector is used for double - crossover integration, the homologous arm is a fusion sequence of the downstream homologous sequence and the upstream homologous sequence in the Yarrowia lipolytica host genome to be transformed in the 5'-to - 3' direction at the target site, and there is at least one restriction site B between the downstream homologous sequence and the upstream homologous sequence that does not exist outside the homologous arm region of the vector.

11. The carrier according to claim 2, 4 or 5, characterized in that, The Yarrowia lipolytica selection marker is a nutritional - deficiency type or an antibiotic selection marker.

12. Use of the vector according to any one of claims 1 - 9 for marker - free gene transformation in Yarrowia lipolytica.

13. A method for marker - free gene transformation in Yarrowia lipolytica, the method comprising the following steps: (1) Transformation: After linearizing the vector containing the enzyme cleavage site A or enzyme cleavage site B in the homologous arms with the vector described in any one of claims 1-9, transform the Yarrowia lipolytica host, and screen for the target transformants using the screening medium corresponding to the yeast selection marker contained in the vector; (2) Induction: Inoculate the transformants obtained in step (1) into a liquid induction medium for induction. When the bacterial cells grow to an obvious turbidity, separate the bacterial liquid on the nutrient medium by dilution plating or continuous streaking to obtain single colonies; the nutrient medium is a medium on which a Yarrowia lipolytica strain without the selection marker can grow normally; the induction medium is a medium capable of inducing the expression of the Cre recombinase; (3) Identification: Inoculate the single colonies obtained in step (2) into the screening medium used in step (1) and the nutrient medium described in step (2) respectively. Select the clones that can grow well on the nutrient medium but cannot grow normally on the screening medium for further genomic PCR verification. The clones with correct verification are the recombinant strains that achieve the marker-free gene transformation.

14. The method according to claim 11, wherein The transformation method used in step (1) is the lithium transformation method or the electroporation method.

15. The method according to claim 11, characterized in that, The transformants obtained in step (1) are verified by genomic PCR before proceeding to step (2).

16. The method according to claim 11, characterized in that By repeating steps (1) to (3), multiple rounds of marker-free gene transformation can be achieved in a single host.

Images