Application of OsCRY1b gene in promoting plant height and tillering of rice

Abstract

The invention relates to the technical field of gene engineering, in particular to application of an OsCRY1b gene in promoting rice plant height and tillering. The OsCRY1b gene in the rice is knocked out, the sequence of the OsCRY1b gene is shown as SEQ ID NO.1, and the increase of the plant height and the tillering of the rice can be promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of the OsCRY1b gene in promoting the plant height and tillering of rice. Background Art

[0002] Food security is a major event related to national economy and people's livelihood. Rice is the main food crop in China, and increasing rice yield is the basic requirement for ensuring food security in China. The yield of crops is a complex trait index reflecting the overall performance of plants, and its basis lies in ensuring that plants can grow and develop healthily and vigorously. The growth and development of plants is a complex process, in which environmental factors play a crucial role. Plants adjust their physiological processes by perceiving and integrating various environmental signals to adapt to changing environmental conditions, which is crucial for their survival, reproduction, and efficient use of resources (Bechtold and Field, 2018). Among the environmental factors interacting with plants, light and nitrogen are two very important aspects. Light is the core driving force of plant life activities, providing energy for plant growth and the carbon skeleton of biological macromolecules through photosynthesis. At the same time, light can also act as a signal to play an important regulatory role throughout the life cycle of plants. Therefore, it is necessary to use genes to affect light signals to regulate plant growth. Summary of the Invention

[0003] The purpose of the present invention is to avoid the deficiencies in the prior art and provide an application of the OsCRY1b gene in promoting the plant height and tillering of rice. After the OsCRY1b gene is knocked out in rice, it can promote the increase of plant height and tillering of rice.

[0004] To achieve the above purpose, the present invention provides the following technical solutions:

[0005] Provide rice in which the OsCRY1b gene is knocked out, and the sequence of the OsCRY1b gene is as shown in SEQ ID NO.1.

[0006] Provide the application of the OsCRY1b gene in promoting the plant height and tillering of rice.

[0007] Provide a method for regulating the plant height and tillering of rice, knocking out the OsCRY1b gene of rice, and the sequence of the OsCRY1b gene is as shown in SEQ ID NO.1.

[0008] In some embodiments, the method for knocking out the OsCRY1b gene of rice includes:

[0009] Design the CCCTTGTTGATGCCGGCATG sequence in the OsCRY1b gene as the knocked-out OsCRY1b target sequence,

[0010] Construct a CRISPR / Cas9 vector containing the target sequence of OsCRY1b.

[0011] In some embodiments, the primers used to construct the CRISPR / Cas9 vector include:

[0012] OsU3T1F: ggcaCCCTTGTTGATGCCGGCATG

[0013] OsU3T1R: aaacCATGCCGGCATCAACAAGGG.

[0014] The beneficial effects of the application of an OsCRY1b gene in promoting the plant height and tillering of rice in the present invention:

[0015] OsCRY1b is a blue light receptor in rice and plays an important role in regulating plant light signals and photosynthesis. Nitrogen is the mineral nutrient element with the largest demand in plants and is a component of many biological macromolecules such as chlorophyll, nucleic acids, and proteins. At the same time, nitrogen plays an important role in regulating the plant height and tillering of plants. The present invention has discovered the OsCRY1b gene that affects the integration of light-nitrogen resources, and then knocked out this gene, effectively promoting the plant height and tillering of rice. Among them, compared with the wild-type rice Zhonghua 11, the rice with the OsCRY1b gene knocked out has a significantly increased plant height under both low-nitrogen and medium-nitrogen conditions; compared with the wild-type rice Zhonghua 11, the rice with the OsCRY1b gene knocked out has significantly more tillers under both low-nitrogen and medium-nitrogen conditions. Brief Description of the Drawings

[0016] Figure 1 It is a schematic diagram of the CRISPR / Cas9 vector of the OsCRY1b gene;

[0017] Figure 2 It is a sequence diagram of the mutation site after gene editing of the OsCRY1b gene;

[0018] Figure 3 It is a phenotypic diagram of the OsCRY1b gene knockout material and the wild-type Zhonghua 11 in the medium-nitrogen field in the embodiment of the present invention;

[0019] Figure 4 It is the plant height statistical data of the OsCRY1b gene knockout material and the wild-type Zhonghua 11 in the field under low-nitrogen (LN) and medium-nitrogen (MN) conditions in the embodiment of the present invention;

[0020] Figure 5 It is the tillering statistical data of the OsCRY1b gene knockout material and the wild-type Zhonghua 11 in the field under low-nitrogen (LN) and medium-nitrogen (MN) conditions in the implementation of the invention. Detailed Embodiments

[0021] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the examples, the operations are carried out under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments not specified by the manufacturer can be obtained as conventional products commercially available. Detailed implementation manners

[0023] Example

[0024] This example discloses the steps of obtaining rice with the OsCRY1b gene knocked out.

[0025] The sequence of the OsCRY1b gene is as follows:

[0026] Sequence Listing

[0027] SEQ ID NO.1:

[0028]

[0029] The knockout steps include:

[0030] 1. CRISPR / Cas9 target prediction:

[0031] Use the website targetDesign (scau.edu.cn) to design targets for the OsCRY1b gene. Design the CCCTTGTTGATGCCGGCATG sequence in the OsCRY1b gene as the knockout target sequence.

[0032] 2. CRISPR / Cas9 vector construction:

[0033] Primers: OsU3T1F: ggcaCCCTTGTTGATGCCGGCATG

[0034] OsU3T1R: aaacCATGCCGGCATCAACAAGGG

[0035] First, precisely insert the designed gRNAs into the BsaI restriction site of the pYLsgRNA-OsU3 vector to construct the pYLsgRNA-OsU3-gRNA recombinant vector containing the target gRNA sequence. Then, use restriction enzyme digestion and ligation techniques to cut out the U3-gRNA expression cassette from the pYLsgRNA-OsU3-gRNA vector and directionally insert it into the BsaI site of the pYLCRISPR / Cas9-MH(B) vector. Finally, successfully construct the pYLCRISPR / Cas9-MH(B)-U3-gRNA recombinant vector. The CRISPR / Cas9 vector of the OsCRY1b gene is as Figure 1 shown.

[0036] 3. Agrobacterium-mediated genetic transformation of rice

[0037] 3.1 Induction and subculture of callus

[0038] (1) Seed disinfection and inoculation:

[0039] Remove the husk of rice seeds and place them in an Erlenmeyer flask. First, soak them in a 70% ethanol solution for 30 seconds to 1 minute for surface disinfection. After discarding the ethanol, add a sodium hypochlorite solution with an available chlorine concentration of 5% and gently shake for 30 minutes for thorough disinfection. After disinfection, rinse the seeds with sterile water at least 5 times to remove the residual disinfectant. Finally, inoculate the seeds on the NB0 medium and culture them in the dark at 25°C for 10 days.

[0040] (2) Subculture of callus:

[0041] After 10 days of dark culture, remove the buds and residual tissues on the surface of the seeds, transfer the induced callus to fresh NB0 medium, and continue to culture it in the dark at 25°C for 20 - 30 days until the callus grows into light yellow, hard, round granular form.

[0042] 3.2 Agrobacterium culture and co - culture

[0043] (1) Agrobacterium activation:

[0044] Draw an appropriate amount of the Agrobacterium liquid stored at - 80°C, evenly coat it on the LB solid medium plate containing three antibiotics, Rifampicin (Rif), Kanamycin (Kana) and Streptomycin (Strep), and place it in an incubator at 28°C for 2.5 days until the colonies grow to an appropriate size.

[0045] (2) Co - culture:

[0046] Take 40 ml of AAM liquid medium into a 50 ml centrifuge tube, add 40 μl of 100 mM acetosyringone (AS) solution, and mix well. Scrape an appropriate amount of the bacteria from the cultured Agrobacterium plate and suspend it in the above AAM liquid medium to ensure that the bacteria are evenly dispersed. Immerse the well - grown callus (light yellow, hard, round granular) into the Agrobacterium liquid, gently shake for 15 - 30 minutes to allow Agrobacterium to fully infect the callus. After the infection is completed, take out the callus, suck off the excess bacteria liquid on the surface, place it evenly on the NA solid medium, and co - culture it in the dark at 25°C for 2 - 3 days.

[0047] 3.3 Screening and differentiation of resistant callus

[0048] (1) Resistance screening:

[0049] After the co - culture is completed, wash the callus several times with sterile water to remove the residual Agrobacterium on the surface. Then, soak the callus in sterile water containing cefotaxime for 30 minutes to further kill the residual Agrobacterium. After the washing is completed, transfer the callus to sterile filter paper to suck off the excess water, and finally place it on the S solid medium containing an appropriate amount of screening antibiotics and culture it in the dark at 25°C for 20 - 30 days to screen out the resistant callus.

[0050] (2) Differentiation culture:

[0051] Select resistant calli with good growth status, transfer them to P solid medium, and culture them in the dark at 25 °C for 20 days to induce callus differentiation. When white dense structures appear on the surface of the calli, subculture them to R solid medium and culture them in a light incubator at 28 °C for about 7 days until green seedlings are differentiated.

[0052] 3.4 Cultivation and Transplanting of Transgenic Seedlings

[0053] (1) Seedling Cultivation:

[0054] Transfer the differentiated green seedlings to a culture bottle containing 1 / 2 MS solid medium and culture them in a light incubator at 28 °C for 2 weeks to promote the development of seedling roots and plant growth.

[0055] (2) Greenhouse Transplanting:

[0056] Select robust transgenic seedlings, open the sealing film of the culture bottle, add an appropriate amount of sterile water, and acclimatize the seedlings in the light culture room for about 7 days. Subsequently, carefully wash off the medium attached to the roots of the seedlings, transplant them into the greenhouse soil, and perform normal water and fertilizer management until the plants mature.

[0057] 4. Identification of OsCRY1b Gene-Edited Materials

[0058] 4.1 Extraction of OsCRY1b Gene-Edited Rice DNA

[0059] (1) Sample Grinding:

[0060] Take an appropriate amount of rice leaves (about 0.1 g) and quickly freeze them with liquid nitrogen. Add liquid nitrogen to a pre-cooled mortar and grind the frozen leaves into fine powder.

[0061] (2) Cell Lysis:

[0062] Quickly transfer the ground powder to a pre-heated 2% CTAB extraction buffer (65 °C), gently mix. Incubate in a water bath at 65 °C for 30 minutes, gently invert and mix every 10 minutes during this period.

[0063] (3) Protein Removal:

[0064] Add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert and mix for 10 minutes. Centrifuge at 4 °C, 12000 rpm for 10 minutes. Carefully aspirate the supernatant to a new centrifuge tube.

[0065] (4) DNA Precipitation:

[0066] Add 0.6 times the volume of isopropanol, gently mix, and let stand at room temperature for 10 minutes. Centrifuge at 4 °C, 12000 rpm for 10 minutes, and discard the supernatant.

[0067] (5) DNA Washing:

[0068] Add 1 ml of 70% ethanol to wash the DNA precipitate, and gently invert to mix evenly. Centrifuge at 12,000 rpm for 5 minutes at 4°C, and discard the supernatant. Repeat the washing once.

[0069] (6) DNA Dissolution:

[0070] Air-dry the DNA precipitate at room temperature. Add an appropriate amount of TE buffer (pH 8.0) to dissolve the DNA.

[0071] (7) RNA Removal:

[0072] Add RNase A to a final concentration of 100 μg / ml and incubate at 37°C for 30 minutes.

[0073] (8) DNA Preservation:

[0074] Aliquot the DNA solution and store it at -20°C for future use.

[0075] 4.2 PCR Sequencing for Identifying Mutation Sites

[0076] (1) PCR Amplification of the OsCRY1b Target Fragment:

[0077] Primer: F: ACTACTCAGTGAATCGCAAG

[0078] R: TAACTCGACTCCTGCAGCTTG

[0079] Prepare the PCR reaction solution according to the following system:

[0080] Template DNA: 50 - 100 ng; Forward primer: 0.2 μM; Reverse primer: 0.2 μM; dNTPs: 0.2 mM; High-fidelity DNA polymerase: 1 U; PCR buffer: 1×; Sterile water: Make up to 25 μl.

[0081] PCR reaction program: Pre-denaturation: 98°C, 2 min; Denaturation: 98°C, 10 s; Annealing: 58°C, 15 s; Extension: 72°C, 30 s; Number of cycles: 35 cycles; Final extension: 72°C, 5 min.

[0082] (2) Agarose Gel Electrophoresis for Detecting PCR Products:

[0083] Prepare a 1% agarose gel and add nucleic acid dye; Take 5 μl of the PCR product and mix it with 1 μl of 6× loading buffer, and load it into the agarose gel wells; Perform electrophoresis at a voltage of 5 V / cm until the bromophenol blue indicator migrates to 2 / 3 of the gel; Observe and photograph with a gel imaging system.

[0084] (3) Sequencing:

[0085] Send the PCR product to a commercial sequencing company for sequencing, and use the PCR amplification forward primer as the sequencing primer.

[0086] (4) Sequencing result analysis:

[0087] Use DNA sequence analysis software to analyze the sequencing results.

[0088] Experimental example

[0089] Plant two knockout lines of OsCRY1b (OsCRY1b-1 and OsCRY1b-2) and the wild type (Zhonghua 11) under the same conditions. Among them, as Figure 3 shown in the phenotypic diagram of the OsCRY1b gene knockout material and the wild type Zhonghua 11 in the medium-nitrogen paddy field, it can be seen that the growth state of the wild type Zhonghua 11 is obviously worse than that of the OsCRY1b gene knockout material.

[0090] Furthermore, compared with the wild type (Zhonghua 11), two knockout lines of OsCRY1b (OsCRY1b-1 and OsCRY1b-2, and the sequences of OsCRY1b-1 and OsCRY1b-2 are as Figure 2 shown), it can be seen from Figure 4 that the plant height is significantly increased whether under low nitrogen (LN) or medium nitrogen (MN).

[0091] Compared with the wild type (Zhonghua 11), two knockout lines of OsCRY1b (OsCRY1b-1 and OsCRY1b-2), Zhonghua 11 is marked as ZH11. It can be seen from Figure 5 that the tillering significantly increases whether under low nitrogen (LN) or medium nitrogen (MN).

[0092] It can be known that the OsCRY1b gene has a significant regulatory effect on the plant height and tiller number of rice. In summary, through the CRISPR / Cas9 system, materials OsCRY1b-1 and OsCRY1b-2 of OsCRY1b gene function-deficient mutants were constructed, and the phenotypes of the two mutant materials were measured. It was found that compared with the wild type, whether under low nitrogen or medium nitrogen conditions, OsCRY1b-1 and OsCRY1b-2 have higher plant heights and more tillers, indicating that OsCRY1b plays an important role in regulating the plant height and tillering of rice.

[0093] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A rice plant, characterized in that: The OsCRY1b gene in the rice is knocked out, and the sequence of the OsCRY1b gene is shown as SEQ ID NO.

1.

2. Application of OsCRY1b gene in promoting rice plant height and tillering.

3. A method for regulating rice plant height and tillering, characterized in that: The OsCRY1b gene of rice is knocked out, and the sequence of the OsCRY1b gene is shown in SEQ ID NO.

1.

4. The method for regulating rice plant height and tillering according to claim 3, characterized in that: The method of knocking out the OsCRY1b gene of rice includes: The CCCTTGTTGATGCCGGCATG sequence in the OsCRY1b gene was designed as the knockout OsCRY1b target sequence. Construct a CRISPR / Cas9 vector containing the OsCRY1b target sequence.

5. The method for regulating rice plant height and tillering according to claim 4, characterized in that: The primers used to construct the CRISPR / Cas9 vector include: OsU3T1F:ggcaCCCTTGTTGATGCCGGCATG OsU3T1R:aaacCATGCCGGCATCAACAAGGG.

Images