Application of ZmWOX5b gene in improving genetic transformation efficiency of different maize inbred lines

Abstract

The invention relates to the field of plant genetic engineering, and discloses application of a ZmWOX5b gene in improvement of corn genetic transformation efficiency. By separating the ZmWOX5b gene and constructing a recombinant vector, an expression cassette or a recombinant bacterium containing the gene, genetic transformation is carried out on corn inbred lines B73, B104, Zheng 58, FSJ115 and Xiang 249 by utilizing an agrobacterium-mediated method, and a research result shows that the gene can remarkably improve the transformation efficiency. Compared with a traditional method, the method has the advantages that the efficiency of easily-transformed genotypes is effectively improved, meanwhile, the transformation effect of difficultly-transformed maize inbred lines is greatly improved, and the limitation of receptor genotypes in maize genetic transformation is effectively broken through. The achievement obviously widens the application range of corn genetic transformation, and provides a new tool for efficiently developing gene function research and application of high yield, high quality, disease and pest resistance, stress resistance and the like of corn.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to ZmWOX5b the application of a gene in the efficient genetic transformation of maize. Background Art

[0002] Since the successful application of plant transgenic technology in the 1980s, significant progress has been made in the research on improving crops by genetic engineering. In recent years, transgenic maize has become one of the important directions for the development of agricultural science and technology due to its advantages in increasing yield, enhancing resistance, improving quality, and reducing the use of pesticides and fertilizers. However, compared with the wide application of transgenic technology in other crops, the genetic transformation of maize still faces technical bottlenecks. Currently, maize transformation technology worldwide is limited by problems such as genotype dependence and low transformation efficiency, making it difficult to meet the actual needs of modern agriculture and biotechnology research. This limitation not only affects the in-depth development of gene function research but also restricts the creation of new germplasm resources and the application of gene editing and synthetic biology technologies. In recent years, with the advancement of maize genome sequencing and functional gene research, it has become particularly important to develop an efficient, safe, and multi-genotype applicable maize transformation system. On the one hand, the functional identification of target genes needs to overcome the influence of factors such as insertion sites and copy numbers on expression effects; on the other hand, to meet breeding goals such as high yield, high quality, and pest and disease resistance, it is urgent to improve genetic transformation efficiency and expand the transformation scale. The establishment of innovative maize transformation technology can not only accelerate the functional verification and breeding application of candidate genes but also lay a solid foundation for promoting the industrialization of transgenic maize and maize functional genomics research.

[0003] The WUSCHEL-related homeobox (WOX) gene family is an important transcription factor family in plants, involved in multiple processes such as plant embryonic development, stem cell maintenance, and organogenesis. The first gene of the WOX family WUS ( WUSCHEL ) was first discovered by Laux et al. in 1996 (Laux et al, 1996), and the research shows that WUS the gene maintains the activity and stability of stem cells by regulating the proliferation and differentiation of stem cells in the shoot apical meristem. Deletion of WUSGenes can cause premature differentiation of stem cells, thereby affecting plant growth. The WOX family includes multiple members, such as WOX1 to WOX14, which play roles in plant embryonic development and post-embryonic development (Deyhle et al, 2007). In particular, WOX5 maintains stem cell activity in the root apical meristem and is crucial for root development. Genes such as WOX3, WOX13, and WOX14 regulate flower and root development and modulate the homeostasis of stem cells in response to environmental changes (Rasheed et al, 2024).

[0004] The latest research shows that TaWOX5 The gene not only improves the transformation efficiency of wheat, but also significantly enhances the transformation efficiency of other cereal crops such as barley, rye, triticale, and secale. TaWOX5 The application of... has also led to a significant increase in the transformation frequency of some difficult-to-transform barley varieties. Currently, there are no reports on the functional research and application of WOX genes in maize genetic transformation. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the present invention aims to provide ZmWOX5b The application of the gene and its encoded protein in maize genetic transformation. The present invention has successfully isolated ZmWOX5b the gene, and carried out genetic transformation experiments through the Agrobacterium-mediated method. The results show that this gene can significantly improve the transformation efficiency of different genotypes of maize inbred lines. ZmWOX5b The discovery and application of the gene in improving the efficiency of maize genetic transformation not only contribute to expanding the range of inbred lines of maize transformation recipients, but also will promote the research progress of maize functional genomics and accelerate the process of maize bio-breeding, with important potential value.

[0006] To achieve the above object, the present invention adopts the following technical solutions: In the first aspect of the present invention, the maize ZmWOX5b gene is cloned; In the second aspect of the present invention, there is provided ZmWOX5b the application of the gene in efficient maize genetic transformation; The ZmWOX5b gene is a nucleic acid molecule as shown in the following (1) or (2): (1) A nucleic acid molecule whose nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO. 1; (2) A nucleic acid molecule other than (1) that encodes the amino acid sequence shown in SEQ ID NO. 2.

[0007] In the third aspect of the present invention, there is provided ZmWOX5b the application of the protein encoded by the gene in improving the efficiency of maize genetic transformation; The ZmWOX5bThe protein encoded by the gene is the protein shown in the following (1) or (2): (1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing; (2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (1). Among them, the proteins described in (1) and (2) can be artificially synthesized, or their encoding genes can be synthesized first and then biologically expressed.

[0008] Among the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein by using in vitro DNA recombination technology for the purpose of facilitating the expression, detection, tracing, and / or purification of the target protein. Among them, in order to facilitate the purification of the protein in (1), a tag can be linked to the amino terminus or carboxyl terminus of the protein in (1). The tag can be Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK), or c-Myc (EQKLISEEDL), etc.

[0009] In the fourth aspect of the present invention, a method for improving the transformation efficiency of nucleic acid molecules introduced into a target plant is provided: ZmWOX5b The gene and the nucleic acid molecule are transferred into the target plant to achieve the purpose of improving the transformation efficiency of the nucleic acid molecule introduced into the target plant. The ZmWOX5b gene is the nucleic acid molecule shown in the following (1) or (2): (1) A nucleic acid molecule with a nucleotide sequence shown in SEQ ID NO. 1; (2) A nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 other than (1).

[0010] In the above method, ZmWOX5b the gene and the nucleic acid molecule can be transferred into the target plant through one vector or through different vectors.

[0011] Beneficial effects of the present invention: The present invention discovers for the first time the key role of the maize ZmWOX5b gene in promoting the genetic transformation efficiency of plants. This study shows that ZmWOX5b the gene can significantly improve the genetic transformation efficiency of maize inbred lines B73, B104, Zheng 58, FSJ115, and Xiang 249, effectively breaking through the technical bottleneck of maize transformation limited by genotype and broadening the selection range of transformation receptor inbred lines. This not only provides an important tool for analyzing maize functional genomics but also shows broad application potential in biological breeding, and has important economic value and social benefits for achieving the directional improvement of crop high yield, high quality, and stress resistance traits. Description of the Drawings

[0012] Figure 1It is a schematic diagram of the recombinant plasmid pG3GB411-mCherry.

[0013] Figure 2 It is a schematic diagram of the plant expression vector pG3GB411-ZmWOX5b.

[0014] Figure 3 It is for T0 seedlings Bar PCR detection results of the gene.

[0015] Figure 4 It is a comparison of the callus regeneration phenotypes between the control group and the overexpression of ZmWOX5b. Specific implementation manners

[0016] Example 1 ZmWOX5b Cloning of the gene Extract the RNA of immature embryos of maize inbred line B73 9 days after pollination, and perform reverse transcription. Using the synthesized cDNA as a template, amplify ZmWOX5b the gene, and the full length of the CDS region of this gene is 660 bp. The amplification system is shown in Table 1: Table 1 ZmWOX5b Gene amplification system

[0017] The primer sequences are as follows (5'-3'): WOX5b-F: GCTTAACTGGCGGTGTAGTG WOX5b-R: CTACACAATGATGCGTGAGAC The PCR reaction program is: pre-denaturation at 95 °C for 5 min; denaturation at 98 °C for 10 s, annealing at 59 °C for 30 s, extension at 68 °C for 30 s, 32 cycles; extension at 68 °C for 5 min, incubation at 16 °C. The obtained PCR product was analyzed by 1.5% agarose gel electrophoresis. Cut the gel and recover the target fragment. Connect the above PCR product to the pEASY-Blunt Zero Cloning Vector (CB501, TransGen Biotech) vector to obtain pEASY-Blunt-TaWOX5. Sequencing obtained the sequence of this PCR product as shown in SEQ NO.1, named ZmWOX5b the gene, the CDS length of this gene is 660bp, encoding 220 amino acids, and the sequence is shown in SEQ NO.2, named ZmWOX5b.

[0018] Example 2 Construction of pG3GB411-mCherry and pG3GB411-ZmWOX5b vectors Digest the target fragment mCherry (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) and the pG3GB411 plant expression vector (purchase link: https: / / www.addgene.org / 134748 / ) with BamHI. Use a PCR product purification kit (purchased from Tiangen Biochemical Technology Co., Ltd.) to recover the fragments respectively according to the instructions. The two fragments are ligated with a homologous recombination enzyme (purchased from Yeasen Biotech Co., Ltd.). The ligation system is shown in Table 2.

[0019] Table 2 Ligation system of digested fragments of mCherry and pG3GB411

[0020] Perform the ligation reaction at 50 °C for 20 min to construct the recombinant plasmid pG3GB411-mCherry ( Figure 1 ). Digest the target ZmWOX5b fragment prepared in Example 2 and the pG3GB411 plant expression vector with BamHI. Use a PCR product purification kit (purchased from Tiangen Biochemical Technology Co., Ltd.) to recover the fragments respectively according to the instructions. The two fragments are ligated with a homologous recombination enzyme (purchased from Yeasen Biotech Co., Ltd.). The ligation system is shown in Table 3.

[0021] Table 3 Ligation system of ZmWOX5b and pG3GB411

[0022] Perform the ligation reaction at 50 °C for 20 min to construct the recombinant plasmid pG3GB411-ZmWOX5b ( Figure 2 ).

[0023] Transform the Agrobacterium tumefaciens pVS1-LBA4404 competent cells with pG3GB411-ZmWOX5b and the control vector pG3GB411-mCherry, and obtain the Agrobacterium strains available for transformation.

[0024] Example 3 Agrobacterium-mediated transformation of maize immature embryos

[0025] I. Agrobacterium-mediated genetic transformation of maize immature embryos Three days before infection, inoculate the Agrobacterium tumefaciens pVS1-LBA4404 containing pG3GB411-ZmWOX5b and pG3GB411-mCherry onto YEP solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and culture them in the dark at 28 °C for 1-2 days in an incubator. Pick single colonies as the seed bacterial solutions of Agrobacterium for subsequent preparation.

[0026] Select young embryos of freshly dissected maize inbred lines B73, B104, Zheng 58, FSJ115, and X249 (Xiang 249) with a size of 1.2 - 1.8 mm as receptor materials. Place the dissected maize embryos into 2 mL centrifuge tubes containing 1.8 mL of suspension. The duration of the dissection process should not exceed 1 hour, and approximately 60 young embryos are placed in each centrifuge tube.

[0027] After infecting with the resuspended liquid of Agrobacterium tumefaciens pVS1-LBA4404 containing pG3GB411-ZmWOX5b and pG3GB411-mCherry, place the scutellar sides of the young embryos face up and flat on the co-culture medium (1 / 2 MS basal medium, 20 g / L sucrose, 10 g / L glucose, 100 μM acetosyringone, and 8 g / L agarose), and culture them in the dark at 23°C in an incubator for 2 days.

[0028] Transfer the co-cultured young embryos to the recovery medium (MS basal medium, MS vitamins, 0.5 mg / L 2,4-D, 2.2 mg / L Picloram, 0.1 g / L casein, 30 g / L sucrose, 40 μM AgNO3, 200 mg / L ticarcillin, and 3 g / L phytagel), and culture them in the dark at 28°C in an incubator for 7 - 10 days.

[0029] Transfer the callus after recovery culture to the differentiation medium I (MS basal medium, 60 g / L sucrose, 1 g / L inositol, 1 mg / L 6-BA, 5 mg / L zeatin, 200 mg / L ticarcillin, 3 g / L phytagel, and 1.5 mg / L bialaphos) for differentiation screening culture, and culture them at 25°C in an incubator under 16-hour light conditions for 10 - 14 days.

[0030] Transfer the emerged green regenerated shoots to the differentiation medium II (add 2.0 mg / L bialaphos to the differentiation medium I) for high-concentration screening, and culture them at 25°C in an incubator under 16-hour light conditions for 10 - 14 days.

[0031] When the regenerated seedlings grow to 3 leaves, transplant the seedlings to the rooting medium and culture them indoors. After the seedlings grow new leaves and roots, take them out of the rooting medium and transplant them into small pots containing nutrient soil and vermiculite (volume ratio 1:3). When the seedlings grow 2 - 3 new leaves, they can be transplanted to the field.

[0032] II. Statistics of transformation efficiency of different genotypes of maize inbred lines Using Bar (The pG3GB411 vector contains BarThe primers of the gene (F: TGCACCATCGTCAACCACTACAT; R: GCTGCCAGAAACCCACGTCAT) were used to perform PCR amplification on the pG3GB411-ZmWOX5b transgenic seedlings with B104 as the receptor. The results are as Figure 3 shown. M: 5000bp DNA marker; Lane 1 is the pG3GB411-ZmWOX5b vector as a positive control, and Lane 2 is the common maize inbred line B104 as a negative control; Lanes 3-50 are the T0 seedlings of pG3GB411-ZmWOX5b. Among the 48 tested T0 seedlings, 7 negative seedlings and 41 positive seedlings were identified, and the positive rate of transgenic seedlings was 85.42%.

[0033] Furthermore, based on the detection results of all transgenic seedlings Bar of the gene, the resistance callus induction rate, the regeneration efficiency of callus into positive seedlings, and the finally exhibited transformation efficiency of different inbred lines were statistically analyzed. Among them, the resistance callus induction rate = (number of resistant calli / number of immature embryos) × 100%, the regeneration efficiency = (number of positive seedlings / number of resistant calli) × 100%, and the transformation efficiency = (number of positive seedlings / number of immature embryos) × 100%. The results are shown in Table 4 and Figure 4 as follows. Compared with the vector pG3GB411-mCherry (control) without the ZmWOX5b gene, the vector pG3GB411-ZmWOX5b (ZmWOX5b-OE) can greatly improve the transformation efficiency of maize of the same variety. The first reference genome of maize was the B73 genome published in 2009, which greatly promoted the work of mining maize functional genes and analyzing the genetic mechanisms of important trait formation. In the transformation experiment of transgenic maize inbred lines, B73 showed significant difficulty in callus induction and transformation. In the control group, the callus induction rate of B73 was only 5.68%, and it was almost impossible to produce transgenic plants, and its transformation efficiency was close to zero; however, after introducing ZmWOX5b the vector, the callus induction rate increased significantly from 5.68% to 79.81%, and the transformation efficiency increased significantly from 0 to 47.12%. For B104 with a relatively high transformation efficiency, the transformation efficiency also increased significantly. The callus induction rate of the control group was 64.00%, the regeneration efficiency was 31.25%, and the final transformation efficiency was 20%. When ZmWOX5b the vector was introduced, the callus induction rate increased to 96.71%, the regeneration efficiency increased to 80.68%, and the transformation efficiency jumped to 78.02% (Table 4 and Figure 4 ).

[0034] In addition, for the maize inbred lines Zheng 58 and Xiang 249 with relatively low transformation rates all the time, during the transformation ZmWOX5bAfter the vector was introduced, both the callus induction rate and the transformation efficiency were significantly improved. For Zheng 58, the callus induction rate increased from 27.42% to 71.62%, the regeneration efficiency of callus increased from 17.65% to 77.36%, and the transformation efficiency increased from 4.83% to 55.41%. For X249 (Xiang 249), the callus induction rate increased from 49.25% to 91.18%, the regeneration efficiency of callus increased from 21.21% to 56.45%, and the transformation efficiency increased from 10.45% to 51.47%. It is worth noting that for the FSJ115 variety, which was previously considered unable to be effectively transformed, after the introduction of ZmWOX5b the vector, the callus induction rate increased from 7.01% to 71.16%, and the transformation efficiency could also reach 26.92%.

[0035] Table 4 Statistics of transformation efficiency of different maize inbred lines

[0036] Further analysis showed that although some callus in the control group differentiated into seedlings, compared with the callus containing ZmWOX5b , the former showed a higher rate of browning and necrosis ( Figure 4 ). This indicates that ZmWOX5b the vector not only significantly increased the callus induction rate of maize inbred lines, but also improved the health status of callus, increased the regeneration efficiency of callus differentiating into seedlings, thus resulting in an increase in transformation efficiency.

[0037] From the above results, it can be seen that ZmWOX5b the gene can improve the transformation efficiency of different maize inbred lines, and to a certain extent, solve the problem of severe dependence on receptor genotypes in maize genetic transformation.

[0038] References Laux T, Mayer K F X, Berger J, et al. The WUSCHEL gene is requiredfor shoot and floral meristem integrity in Arabidopsis[J]. Development, 1996,122(1): 87-96. Deyhle F, Sarkar A K, Tucker E J, et al. WUSCHEL regulates celldifferentiation during anther development[J]. Developmental biology, 2007,302(1): 154-159. Rasheed H, Shi L, Winarsih C, et al. Plant Growth Regulators: An Overview of WOX Gene Family[J]. Plants, 2024, 13(21): 3108。

Claims

1. ZmWOX5b Use of a gene in improving the genetic transformation efficiency of maize; the ZmWOX5b gene is a nucleic acid molecule as shown in the following (1) or (2), and the amino acid sequence of the encoded protein is as shown in SEQ ID NO. 2; (1) A nucleic acid molecule with the nucleotide sequence shown in SEQ ID NO. 1; (2) A nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 other than (1).

2. The application according to claim 1, characterized in that, The said ZmWOX5b gene improves the resistant callus induction rate and regeneration efficiency of the recipient plant, thereby improving the genetic transformation efficiency of maize.

3. ZmWOX5b Application of the protein encoded by the gene in improving the genetic transformation efficiency of maize; characterized in that, The said ZmWOX5b The protein encoded by the gene is the protein shown in the following (1) or (2): (1) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing; (2) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (1).

4. A method for improving the transformation efficiency of exogenous nucleic acid molecules into maize, characterized in that, Transfer ZmWOX5b a gene and an exogenous nucleic acid molecule into maize to achieve the purpose of improving the transformation efficiency of nucleic acid molecules introduced into target plants; the ZmWOX5b gene is a nucleic acid molecule as shown in the following (1) or (2): (1) A nucleic acid molecule with the nucleotide sequence shown in SEQ ID NO. 1; (2) A nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 other than (1).

Images